Skip to main content
NCBI home page
Translational Oncology logoLink to Translational Oncology
. 2013 Aug 1;6(4):405–412. doi: 10.1593/tlo.13340

Comprehensive Analysis of ETS Family Members in Melanoma by Fluorescence In Situ Hybridization Reveals Recurrent ETV1 Amplification

Rohit Mehra *,†,‡,1, Saravana M Dhanasekaran *,1, Nallasivam Palanisamy *, Pankaj Vats *, Xuhong Cao *, Jung H Kim *, David SL Kim *, Timothy Johnson §, Douglas R Fullen †,§, Arul M Chinnaiyan *,†,‡,¶,#
PMCID: PMC3730015  PMID: 23908683

Abstract

E26 transformation-specific (ETS) transcription factors are known to be involved in gene aberrations in various malignancies including prostate cancer; however, their role in melanoma oncogenesis has yet to be fully explored. We have completed a comprehensive fluorescence in situ hybridization (FISH)-based screen for all 27 members of the ETS transcription factor family on two melanoma tissue microarrays, representing 223 melanomas, 10 nevi, and 5 normal skin tissues. None of the melanoma cases demonstrated ETS fusions; however, 6 of 114 (5.3%) melanomas were amplified for ETV1 using a break-apart FISH probe. For the six positive cases, locus-controlled FISH probes revealed that two of six cases were amplified for the ETV1 region, whereas four cases showed copy gains of the entire chromosome 7. The remaining 26 ETS family members showed no chromosomal aberrations by FISH. Quantitative polymerase chain reaction showed an average 3.4-fold (P value = .00218) increased expression of ETV1 in melanomas, including the FISH ETV1-amplified cases, when compared to other malignancies (prostate, breast, and bladder carcinomas). These data suggest that a subset of melanomas overexpresses ETV1 and amplification of ETV1 may be one mechanism for achieving high gene expression.

Introduction

In a world being driven by precision medicine [1,2], there is an impetus toward finding gene aberrations in deadly tumors of various types that might elucidate the biology of such high-grade malignancies or identify potential therapeutic targets. Although melanomas account for less than 5% of all skin cancers, they are responsible for the majority of skin cancer-related deaths [3]. Furthermore, the incidence of melanomas is increasing worldwide in white populations [4]. Early detection of melanomas allows surgical excision with high cure rates. However, once melanomas disseminate outside of their primary cutaneous location, they are usually refractory to current therapeutic modalities and, in fact, carry a dismal prognosis. The most recent 5-year relative survival rates from the National Cancer Institute's Surveillance Epidemiology and End Results review were 98.2% for localized disease, 62.4% for cancers spread to regional lymph nodes or beyond the primary site, and 15.1% for melanomas with distant metastases [5]. Thus, there is an intense need for identification of genetic aberrations in melanomas that can detail the pathobiology of this tumor or be informative for identifying rational therapies currently available or in clinical trials.

E26 transformation-specific (ETS) transcription factors consist of 27 members, many of which have been shown to play a role in cancer initiation and progression [6]. Gene fusions involving ETS family members are implicated in numerous malignancies including Ewing sarcoma, infantile fibrosarcoma, breast cancer, myelodysplastic syndromes, acute lymphoblastic leukemia, and acute myeloid leukemia. Recurrent gene fusions have traditionally been thought to play only a minor role in solid tumors, largely because of technical limitations of cytogenetics. In the past few years, however, an increasing number of recurrent gene fusions have been recognized in epithelial cancers [7–10]. Our group has recently discovered and elucidated the involvement of four members of the ETS family transcription factors, ERG, ETV1, ETV4, and ETV5, in recurrent gene fusion events in a majority of clinically localized and castration-resistant metastatic prostate cancers [7,11–14]. In the prostate, gene fusions result in aberrant overexpression of the ETS transcription factor in prostate epithelial cells and confer a neoplastic phenotype [8,15].

A recent study has identified ETV1 amplification in 13% of primary and 18% of metastatic melanomas [16]. Interestingly, telomerase reverse transcriptase (TERT) promoter mutations have also been identified within melanomas that generate de novo consensus binding motifs for the ETS transcription factors [1]. However, no definitive studies that have done a comprehensive investigation of aberrations involving ETS family members in melanomas exist. Because ETS transcription factors are key proto-oncogenes playing an important role in many different cancers, we decided to use a comprehensive fluorescence in situ hybridization (FISH) screen to determine if any chromosomal aberrations involving the ETS family exist in melanomas.

Materials and Methods

Study Population, Clinical Data, and Tissue Microarray Construction

Two melanoma tissue microarrays (TMAs) were constructed as previously described [13]. Briefly, melanoma patients were identified by searching the University of Michigan pathology archives. Slides were reviewed for diagnosis, staging parameters, and adequate tumor volume by the pathologists involved in this study (R.M., D.S.L.K., and D.R.F.). The first TMA consists of 118 unique tissues spotted in triplicates and includes 107 melanomas (87 primary and 20 metastatic) and 11 controls (5 normal skin, 3 benign nevi, and 3 dysplastic nevi). The second TMA consists of 120 unique tissues spotted in triplicates and includes 116 metastatic melanomas and 4 benign nevi. This study was approved by the University of Michigan Medical School's Institutional Review Board.

FISH Screening Strategy

A previously validated FISH-based split probe strategy was used to screen the 27 ETS family members on the two melanoma TMAs [17]. Bacterial artificial chromosomes (BACs) were obtained from the BACPAC Resource Center (Oakland, CA), and probes were prepared as described [13,15,17]. The integrity and correct localization of all probes were verified by hybridization to metaphase spreads of normal peripheral lymphocytes. Slides were examined using an ImagingZ1 microscope (Carl Zeiss, Oberkochen, Germany). FISH signals were scored manually (100x oil immersion) in morphologically intact and non-overlapping nuclei by a pathologist with extensive experience in FISH evaluation (R.M.); a minimum of 50 cancer cells from each site was recorded. Cancer sites with very weak or no signals were recorded as insufficient hybridization.

A schematic representing our FISH-based screening strategy is shown in Figure 1. ETS gene-specific split probes flanking the gene of interest (100–1000 kb) were used to screen the melanoma TMAs. Cases positive for amplification by the initial split probe screen were rehybridized with an ETV1 locus-specific probe (RP11-124L22) and a commercially available centromeric (locus-controlled) FISH probe to chromosome 7, Vysis CEP7 (Abbott Park, IL).

Figure 1.

Figure 1

Open in a new tab

Schematic for comprehensive ETS FISH screen in melanoma and follow-up analysis of amplified cases. (A) Break-apart FISH probe design for each member of the 27 ETS family. The ETS gene is shown as a teal-colored box with direction of transcription indicated by the overlying arrow. 5′ and 3′ BACs are indicated with their corresponding probe color. (B) Schematic for possible outcomes of FISH-based screening using the split probe strategy outlined in A. Tightly co-localizing red and green signals produce yellow fluorescence; the cell nucleus is highlighted in blue using 4′6-diamidino-2-phenylindole. Translocation (split) is indicated by separation in space of the 5′ and 3′ probe pairs. Amplification is detected by greater than two copies of the probed locus. A deletion is indicated by loss of one 5′ or 3′ signal. In our experiments, we discovered six melanoma cases that were amplified for ETV1 by the above scheme. (C) To assess whether the six positive cases were amplified specifically for the ETV1 locus, we rehybridized the cases with an ETV1-specific probe (green) and a commercially available centromeric probe, CEP7 (orange).

Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction

Quantitative polymerase chain reaction (Q-PCR) was carried out according to standard protocols as previously described [7,15,17]. Briefly, total RNA was extracted from formalin-fixed paraffin-embedded melanoma specimens. ETV1 (forward: aacagccctttaaattcagctatgga and reverse: ggagggcctcattcccacttg) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) oligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA). All samples were normalized to the housekeeping gene GAPDH and calibrated to Clontech normal liver (Mountain View, CA) ETV1 expression levels.

Results and Discussion

We screened for the presence of chromosomal aberrations among all the 27 ETS family genes using FISH split probe hybridizations on our two melanoma TMAs; cases positive for amplifications were rehybridized with a locus-controlled FISH probe (see Figure 1 for schematic). Initial FISH screening using split probes revealed 6 cases amplified for ETV1 of 114 evaluable cases (5.3%). Remaining 26 ETS loci were negative for chromosomal aberrations (Figure 1B) on our melanoma TMAs by the FISH approach described above.

Tissue sections from the six amplification-positive melanoma cases identified by the initial split-apart FISH approach were rehybridized with an ETV1-specific probe along with a probe specific to the centromere of chromosome 7 (CEP7) as detailed in Figure 1C. Two cases, a primary melanoma and a metastatic melanoma, were found to be amplified specifically for the ETV1 locus (representative image of primary melanoma case, Figure 2C). The remaining four cases were amplified for entire chromosome 7 (representative image, Figure 2D). All other cases on the two melanoma TMAs, including normal skin, nevi (representative image, Figure 2A), and non-amplified melanomas (representative image, Figure 2B), demonstrated the normal two copies of CEP7 and ETV1.

Figure 2.

Figure 2

Open in a new tab

ETV1 locus-controlled FISH. (A) Benign nevus control with normal copy number of ETV1/chromosome 7. (B) Melanoma cells with normal copy number of ETV1/chromosome 7. (C) Primary melanoma with ETV1-specific amplification; ETV1 locus-specific probe (green) shows greater than two copies per nucleus, whereas chromosome 7 centromeric probe CEP7 (orange) demonstrates the normal two copies. (D) Melanoma aneuploid for chromosome 7. Balanced increase in both ETV1 and CEP7.

We next queried the Oncomine database (version Q4, November 2012) for ETS family gene expression in the melanoma samples. To date, 10 studies have reported a total of 24,524 data points (1010 nevi and 23,514 melanoma) from 404 specimens (20 nevi and 384 melanoma) characterized by Affymetrix array platforms (U133A, U133A 2.0, and 133 Plus 2.0). ETV2 gene was not represented in the data sets and was excluded from this analysis. Outlier expression analysis of the 26 ETS family genes revealed a differential expression of select members in melanoma compared to the benign nevi samples (Figure 3). Specifically, ETV1 gene showed outlier expression in approximately 12% of the samples at 95% confidence interval (Figure 3). Similarly, ETV5 (7.4%), ELF1 (11.9%), EHF (9%), and ETS2 (12%) genes also showed outlier expression revealing broad ETS family dysregulation in melanoma samples. To assess whether chromosome 7 amplification and/or ETV1-specific amplification in melanomas correlated with increased expression levels of ETV1, we performed real-time Q-PCR. ETV1-specific primers spanning the exon 5/6 junction were used in all Q-PCR experiments (Figure 4A). Relative quantification was performed using the ΔΔCT method. The Q-PCR data are summarized using box plots; a central rectangle indicates the first to third quartiles with a horizontal line within the box corresponding to the median, the whiskers indicate the minimum and maximum, and individual tumor samples are represented by dots in the background (Figure 4, B and C).

Figure 3.

Figure 3

Open in a new tab

ETS family gene outlier expression analysis in melanoma samples. Melanoma gene expression data sets available in the Oncomine database were queried for 26 ETS family outlier expression. Box plot represents expression of ETS family members in benign nevi (B), n = 20, and melanoma (M) specimens, n = 384. ETV1 gene (red arrow) showed outlier expression in approximately 12% of the samples at 95% confidence interval; however, the median expression was not significantly different between nevi and melanoma.

Figure 4.

Figure 4

Open in a new tab

Reverse Transcription-PCR of ETV1 in melanoma. ETV1-specific real-time Q-PCR was performed on melanoma tumors including the six cases positive for ETV1 amplification. (A) ETV1-specific primers spanning the exon boundary between exons 5 and 6 (88-bp amplicon, depicted with red arrows) were designed. (B) Relative quantification was performed using the ΔΔCT method; y-axis for both graphs are plotted on a log-based 2 scale. For each tumor type, the box plots show a central rectangle indicating the first to third quartiles with a horizontal line within the box corresponding to the median; the whiskers indicate the minimum and maximum, and individual tumor samples are represented by dots in the background. The amplified melanomas include the two ETV1-specific amplified melanomas (clear dots) and the four chromosome 7-amplified melanomas (black dots). Nevi box plot includes two dysplastic nevi (clear dots) and seven benign nevi (black dots). There was no statistically significant mean expression difference between amplified melanomas and non-amplified melanomas (Welch t test: t = 0.482, P value = .6478). (C) Raw data plotted in B aggregated to compare ETV1 expression in all melanomas versus nevi and other cancers (bladder, prostate, and breast). There was no statistically significant expression difference between melanomas and nevi (Welch t test: t = -0.2781, P value = .7832). Mean fold expression difference between all melanomas versus all other cancers was 3.4051 (P value = .002182).

Figure 4B, from left to right, shows box plots of 6 amplified melanomas (two ETV1 locus specific amplified cases are highlighted by clear dots and the four melanomas with chromosome 7 amplifications are indicated by black dots), 15 non-amplified melanomas, 9 nevi (7 benign nevi indicated by black dots and 2 dysplastic nevi highlighted by clear dots), 17 breast cancer cases, 3 prostate cancers, and 3 bladder cancers. Figure 4C shows data from Figure 4B reaggregated to compare expression levels between all melanomas versus nevi and other cancers (bladder, prostate, and breast). Table 1, A and B, summarizes the Welch t test results from all possible pairwise comparisons between the different tissue types displayed in the box plots in Figure 4. Mean fold expression difference between all melanomas and all other cancers was statistically significant at 3.405 (P value = .002182; see Figure 4C, and Table 1). These data suggest that a subset of melanomas overexpresses ETV1 and amplification of ETV1 may be the underlying mechanism for achieving high gene expression.

Table 1.

Welch T Test of Q-PCR Data.

(A)
Amplified Melanoma Non-amplified Melanoma Nevi Breast Cancer Prostate Cancer Bladder Cancer
Amplified melanoma
Non-amplified melanoma 0.4967 (.6377)
Nevi 0.2391 (.819) -0.6293 (.5359)
Breast cancer 1.415 (.2154) 3.1629 (.0052) 3.5737 (.00496)
Prostate cancer 1.346 (.2243) 1.8994 (.1289) 2.3172 (.07144) 0.0844 (.94)
Bladder cancer 1.593 (.1716) 3.8554 (.00126) 4.1755 (.00212) 1.8286 (.09122) 0.3385 (.7663)
(B)
All Melanomas Nevi All Other Cancers
All melanomas
Nevi -0.2781 (.7832)
All other cancers 3.405 (.002182) 3.668 (.004337)
Open in a new tab

(A) Statistical analysis using Welch t test comparisons of average expression values from Figure 4B. For each box, column heading is compared to the corresponding row heading; the t test result is given on top with P value in parentheses below. (B) Statistical analysis using Welch t test comparisons of average expression values from Figure 4C. For each box, column heading is compared to the corresponding row heading; the t test result is given on top with P value in parenthesis below.

In vitro and in vivo experiments indicate an important role for ETV1 in prostate cancer oncogenesis [15]. Benign cancer cells induced to express high levels of ETV1 show increased metastatic potential as assessed by a modified basement membrane invasion assay; furthermore, these cells upregulate a gene expression signature involving cell invasion. In addition, a subset of Ewing sarcomas display an oncogenic fusion resulting in constitutively activated ETV1 [18], and HER2/neu-positive breast cancers express high levels of ETV1 that contributes to tumorigenicity [19,20]. These studies, along with our results, suggest that elevated levels of ETV1 in melanocytes may contribute toward transformation to melanoma.

Our results are in accordance with the findings of a related previously published study that has reported ETV1 amplification in a subset of melanomas [16]. Melanoma cell lines in this study, including those with ETV1 amplification, exhibited dependency on ETV1 expression for proliferation and anchorage-independent growth. Moreover, overexpression of ETV1 in combination with oncogenic NRASG12D transformed primary melanocytes and promoted tumor formation in mice. The observations in this study implicate deregulated ETV1 in melanoma genesis and suggest a pivotal lineage dependency mediated by oncogenic ETS transcription factors in this malignancy. The mechanism by which ETV1 may contribute to melanoma formation could be the reported up-regulation of the microphthalmia-associated transcription factor. ETV1 FISH assay performed by these authors also exhibited a “break-apart” pattern in two cases of metastatic melanoma, suggestive of targeted gene disruption or possible translocation of the ETV1 locus. However, we did not find evidence of any such aberrations in any of the melanoma cases represented on our two TMAs in the current study.

Our data reveal that nevi and melanomas have comparable expression levels of ETV1 and both show statistically significant increased expression compared to other cancers (breast, prostate, and bladder; see Table 1B). This would indicate that elevated ETV1 expression would not be sufficient for malignant transformation in melanoma because benign nevi express equivalent levels to melanomas; however, up-regulation of ETV1 could provide an early proliferative signal to melanocytes that is kept in check within nevi by an unknown mechanism. A precedent for such a scenario is provided by the most common genetic mutation found in melanomas, the BRAFV600E mutation. This missense mutation is one of the most well-studied mutations in melanomas and has been found to confer a malignant phenotype when induced in melanocytes [21]. However, similar to ETV1, it is expressed in both melanomas and benign nevi. Studies using primary melanocyte cultures artificially expressing the oncogenic BRAFV600E mutation found that these cells undergo an initial burst of proliferation and then proceed to cell cycle arrest; this study also showed that the melanocytes of nevi are in senescence [22]. Further studies have revealed that in established murine BRAFV600E-driven nevi, acute shRNA-mediated depletion of PTEN prompted tumor progression [23]. Thus, an oncogenic mutation often needs a second mutation, perhaps involving a tumor suppressor gene, to proceed to an overt malignant phenotype. Further experiments will have to be performed to see if this is the case for ETV1 in melanoma.

ETV1 has also been implicated in the development of gastrointestinal stromal tumors (GISTs), which are primarily characterized by mutations in the KIT or PDGFRA receptor tyrosine kinase [24]. ETV1 is universally highly expressed in GISTs. It has been proposed that GISTs arise from interstitial cells of Cajal with high levels of endogenous ETV1 expression that, when coupled with an activating KIT mutation, drives an oncogenic ETS transcriptional program [25]. This differs from what we have seen in our past work on prostate cancer, our current study on melanomas, and in Ewing sarcoma or acute myeloid leukemia, where genomic translocation or amplification drives aberrant ETS expression.

Currently, there are only a few published ETS studies in melanomas and this is the first describing a comprehensive FISH screen on melanomas using all 27 members of the ETS family. A recent publication reported high ETV4 (also known as E1AF) expression in melanoma cells lines that correlated with elevated expression levels of membrane-type-1 matrix metalloproteinase, suggesting a role for ETV4 in melanoma invasion [26]. Toralkovic et al. suggested expression of Fli-1 in malignant melanoma to be associated with biologically more aggressive tumors [27]. Several studies have reported on ETS-1 in melanoma with conflicting results. An early study used immunohistochemistry on a relatively small panel of melanocytic lesions (10 cutaneous melanomas and 24 benign melanocytic lesions) and reported that the ETS-1 staining intensity correlated with malignant behavior, i.e., benign melanocytic lesions showed minimal staining intensity, melanoma in situ revealed intermediate staining, and melanomas stained the strongest [28]. Rothhammer et al. described similar findings using in situ hybridization on melanocytic lesions; benign melanocytic lesions showed lowest ETS-1 expression levels and melanoma showed highest ETS-1 expression; in addition, a melanoma cell line with baseline high levels of ETS-1 showed diminished ability to invade in a Boyden chamber assay when ETS-1 expression was abrogated using an antisense assay [29]. Houssaye et al. found ETS-1 and ETS-2, along with their downstream signaling pathways, to be upregulated in pigmented ocular neoplasms in a transgenic mouse model driving SV-40 large T antigen using a tyrosine-related protein-1 promoter [30]. In contrast to the aforementioned three studies, Torlakovic et al. used immunohistochemistry on 218 melanocytic lesions but reported no correlation between ETS-1 staining intensity and malignant behavior, disease-specific survival, or time to treatment failure [31]. The current study identified a genomic basis for ETV1 overexpression and our outlier analysis suggests increased transcript expression of additional ETS family members such as ETV5, ELF1, EHF, and ETS2 genes in melanomas. This observation gain enormous significance in the light of a more recent study that describes a tumor-specific regulation of TERT gene by ETS proteins because of a recurrent somatic mutation in melanoma [1]. Huang et al. [1] recently described two independent highly recurrent somatic mutations in human melanoma samples. These mutations occurred in the TERT gene core promoter region in approximately 71% of melanoma specimens studied. The mutation creates an ETS binding motif and increases the transcriptional activity of the TERT promoter by two-fold to four-fold and is considered to play a role in tumorigenesis.

In summary, our data suggest that ETS gene aberrations, apart from ETV1, do not play a predominant role in the oncogenesis of melanomas. Our study further confirms that ETV1 is amplified in a subset of melanomas. Results from the recent study, which identified generation of ETS binding site in TERT promoter, now provides a potential oncogenic mechanism for ETV1 overexpression in melanomas [1]. So how can this knowledge be used in cancer treatment? Currently, it is hard to target ETV1 directly with siRNA. However, it is possible to use/develop enzymatic inhibitors for proteins like poly[adenosine diphosphate (ADP)-ribose] polymerase 1 (PARP1), which has been demonstrated to bind to ETV1 and is required for ETV1 activity [32]. Poly(ADP-ribose) polymerase inhibitors are under active clinical investigation and the subject of several clinical trials currently and offer hope into targeted treatment for such cancers [33]. Overall, insight into the biology of such genomic alterations will allow novel therapies to be tailored to susceptible molecular subtypes of melanoma cases.

Acknowledgments

We acknowledge Khalid Suleman, Bo Han, Manish Subramaniam, Lei Wang, Michele LeBlanc, Nishi Singhal, Katherine A. Linetzky, Hannah K. Howells, Pe-feng Hsieh, JessicaWeiss, Anjana Menon, and Sailiaja Pullela for help with tissue processing, tissue assessment, and data analysis.

References

  • 1.Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, Garraway LA. Highly recurrent TERT promoter mutations in human melanoma. Science. 2013;339:957–959. doi: 10.1126/science.1229259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Roychowdhury S, Iyer MK, Robinson DR, Lonigro RJ, Wu YM, Cao X, Kalyana-Sundaram S, Sam L, Balbin OA, Quist MJ, et al. Personalized oncology through integrative high-throughput sequencing: a pilot study. Sci Transl Med. 2011;3:111ra121. doi: 10.1126/scitranslmed.3003161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.American Cancer Society, author. Cancer Facts & Figures 2008. Atlanta, GA: American Cancer Society; 2008. [Google Scholar]
  • 4.Garbe C, Leiter U. Melanoma epidemiology and trends. Clin Dermatol. 2009;27:3–9. doi: 10.1016/j.clindermatol.2008.09.001. [DOI] [PubMed] [Google Scholar]
  • 5.Howlader N, Noone AM, Krapcho M, Neyman N, Aminou R, Altekruse SF, Kosary CL, Ruhl J, Tatalovich Z, Cho H, Mariotto A, et al., editors. SEER Cancer Statistics Review, 1975–2009 (Vintage 2009 Populations) Bethesda, MD: National Cancer Institute; 2009. Available at: http://seer.cancer.gov/csr/1975_2009_pops09/, based on November 2011 SEER data submission, posted to the SEER web site. [Google Scholar]
  • 6.Seth A, Watson DK. ETS transcription factors and their emerging roles in human cancer. Eur J Cancer. 2005;41:2462–2478. doi: 10.1016/j.ejca.2005.08.013. [DOI] [PubMed] [Google Scholar]
  • 7.Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005;310:644–648. doi: 10.1126/science.1117679. [DOI] [PubMed] [Google Scholar]
  • 8.Tomlins SA, Laxman B, Varambally S, Cao X, Yu J, Helgeson BE, Cao Q, Prensner JR, Rubin MA, Shah RB, et al. Role of the TMPRSS2-ERG gene fusion in prostate cancer. Neoplasia. 2008;10:177–188. doi: 10.1593/neo.07822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, et al. Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature. 2007;448:561–566. doi: 10.1038/nature05945. [DOI] [PubMed] [Google Scholar]
  • 10.Palanisamy N, Ateeq B, Kalyana-Sundaram S, Pflueger D, Ramnarayanan K, Shankar S, Han B, Cao Q, Cao X, Suleman K, et al. Rearrangements of the RAF kinase pathway in prostate cancer, gastric cancer and melanoma. Nat Med. 2010;16:793–798. doi: 10.1038/nm.2166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Mehra R, Tomlins SA, Yu J, Cao X, Wang L, Menon A, Rubin MA, Pienta KJ, Shah RB, Chinnaiyan AM. Characterization of TMPRSS2-ETS gene aberrations in androgen-independent metastatic prostate cancer. Cancer Res. 2008;68:3584–3590. doi: 10.1158/0008-5472.CAN-07-6154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Helgeson BE, Tomlins SA, Shah N, Laxman B, Cao Q, Prensner JR, Cao X, Singla N, Montie JE, Varambally S, et al. Characterization of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer. Cancer Res. 2008;68:73–80. doi: 10.1158/0008-5472.CAN-07-5352. [DOI] [PubMed] [Google Scholar]
  • 13.Mehra R, Tomlins SA, Shen R, Nadeem O, Wang L, Wei JT, Pienta KJ, Ghosh D, Rubin MA, Chinnaiyan AM, et al. Comprehensive assessment of TMPRSS2 and ETS family gene aberrations in clinically localized prostate cancer. Mod Pathol. 2007;20:538–544. doi: 10.1038/modpathol.3800769. [DOI] [PubMed] [Google Scholar]
  • 14.Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE, Cao X, Wei JT, Rubin MA, Shah RB, et al. TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res. 2006;66:3396–3400. doi: 10.1158/0008-5472.CAN-06-0168. [DOI] [PubMed] [Google Scholar]
  • 15.Tomlins SA, Laxman B, Dhanasekaran SM, Helgeson BE, Cao X, Morris DS, Menon A, Jing X, Cao Q, Han B, et al. Distinct classes of chromosomal rearrangements create oncogenic ETS gene fusions in prostate cancer. Nature. 2007;448:595–599. doi: 10.1038/nature06024. [DOI] [PubMed] [Google Scholar]
  • 16.Jane-Valbuena J, Widlund HR, Perner S, Johnson LA, Dibner AC, Lin WM, Baker AC, Nazarian RM, Vijayendran KG, Sellers WR, et al. An oncogenic role for ETV1 in melanoma. Cancer Res. 2010;70:2075–2084. doi: 10.1158/0008-5472.CAN-09-3092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Han B, Mehra R, Dhanasekaran SM, Yu J, Menon A, Lonigro RJ, Wang X, Gong Y, Wang L, Shankar S, et al. A fluorescence in situ hybridization screen for E26 transformation-specific aberrations: identification of DDX5-ETV4 fusion protein in prostate cancer. Cancer Res. 2008;68:7629–7637. doi: 10.1158/0008-5472.CAN-08-2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Janknecht R. EWS-ETS oncoproteins: the linchpins of Ewing tumors. Gene. 2005;363:1–14. doi: 10.1016/j.gene.2005.08.007. [DOI] [PubMed] [Google Scholar]
  • 19.Shin S, Bosc DG, Ingle JN, Spelsberg TC, Janknecht R. Rcl is a novel ETV1/ER81 target gene upregulated in breast tumors. J Cell Biochem. 2008;105:866–874. doi: 10.1002/jcb.21884. [DOI] [PubMed] [Google Scholar]
  • 20.Kurpios NA, Sabolic NA, Shepherd TG, Fidalgo GM, Hassell JA. Function of PEA3 Ets transcription factors in mammary gland development and oncogenesis. J Mammary Gland Biol Neoplasia. 2003;8:177–190. doi: 10.1023/a:1025948823955. [DOI] [PubMed] [Google Scholar]
  • 21.Hocker TL, Singh MK, Tsao H. Melanoma genetics and therapeutic approaches in the 21st century: moving from the benchside to the bedside. J Invest Dermatol. 2008;128:2575–2595. doi: 10.1038/jid.2008.226. [DOI] [PubMed] [Google Scholar]
  • 22.Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T, van der Horst CM, Majoor DM, Shay JW, Mooi WJ, Peeper DS. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature. 2005;436:720–724. doi: 10.1038/nature03890. [DOI] [PubMed] [Google Scholar]
  • 23.Vredeveld LC, Possik PA, Smit MA, Meissl K, Michaloglou C, Horlings HM, Ajouaou A, Kortman PC, Dankort D, McMahon M, et al. Abrogation of BRAFV600E-induced senescence by PI3K pathway activation contributes to melanomagenesis. Genes Dev. 2012;26:1055–1069. doi: 10.1101/gad.187252.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pierotti MA, Tamborini E, Negri T, Pricl S, Pilotti S. Targeted therapy in GIST: in silico modeling for prediction of resistance. Nat Rev Clin Oncol. 2011;8:161–170. doi: 10.1038/nrclinonc.2011.3. [DOI] [PubMed] [Google Scholar]
  • 25.Chi P, Chen Y, Zhang L, Guo X, Wongvipat J, Shamu T, Fletcher JA, Dewell S, Maki RG, Zheng D, et al. ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours. Nature. 2010;467:849–853. doi: 10.1038/nature09409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hata H, Kitamura T, Higashino F, Hida K, Yoshida K, Ohiro Y, Totsuka Y, Kitagawa Y, Shindoh M. Expression of E1AF, an ets-oncogene transcription factor, highly correlates with malignant phenotype of malignant melanoma through up-regulation of the membrane-type-1 matrix metalloproteinase gene. Oncol Rep. 2008;19:1093–1098. [PubMed] [Google Scholar]
  • 27.Torlakovic EE, Slipicevic A, Florenes VA, Chibbar R, DeCoteau JF, Bilalovic N. Fli-1 expression in malignant melanoma. Histol Histopathol. 2008;23:1309–1314. doi: 10.14670/HH-23.1309. [DOI] [PubMed] [Google Scholar]
  • 28.Keehn CA, Smoller BR, Morgan MB. Expression of the ets-1 protooncogene in melanocytic lesions. Mod Pathol. 2003;16:772–777. doi: 10.1097/01.MP.0000082395.59356.4F. [DOI] [PubMed] [Google Scholar]
  • 29.Rothhammer T, Hahne JC, Florin A, Poser I, Soncin F, Wernert N, Bosserhoff AK. The Ets-1 transcription factor is involved in the development and invasion of malignant melanoma. Cell Mol Life Sci. 2004;61:118–128. doi: 10.1007/s00018-003-3337-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.De la Houssaye G, Vieira V, Masson C, Beermann F, Dufier JL, Menasche M, Abitbol M. ETS-1 and ETS-2 are upregulated in a transgenic mouse model of pigmented ocular neoplasm. Mol Vis. 2008;14:1912–1928. [PMC free article] [PubMed] [Google Scholar]
  • 31.Torlakovic EE, Bilalovic N, Nesland JM, Torlakovic G, Florenes VA. Ets-1 transcription factor is widely expressed in benign and malignant melanocytes and its expression has no significant association with prognosis. Mod Pathol. 2004;17:1400–1406. doi: 10.1038/modpathol.3800206. [DOI] [PubMed] [Google Scholar]
  • 32.Brenner JC, Ateeq B, Li Y, Yocum AK, Cao Q, Asangani IA, Patel S, Wang X, Liang H, Yu J, et al. Mechanistic rationale for inhibition of poly(ADP-ribose) polymerase in ETS gene fusion-positive prostate cancer. Cancer Cell. 2011;19:664–678. doi: 10.1016/j.ccr.2011.04.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Park SR, Chen A. Poly(adenosine diphosphate-ribose) polymerase inhibitors in cancer treatment. Hematol Oncol Clin North Am. 2012;26:649–670. ix. doi: 10.1016/j.hoc.2012.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Translational Oncology are provided here courtesy of Neoplasia Press

RESOURCES