Skip to main content
Nucleic Acids Research logoLink to Nucleic Acids Research
. 2004 Feb 11;32(3):1018–1027. doi: 10.1093/nar/gkh207

Mycobacterium tuberculosis Rv2118c codes for a single-component homotetrameric m1A58 tRNA methyltransferase

U Varshney, V Ramesh 1, A Madabushi 2, R Gaur, H S Subramanya 2, U L RajBhandary 1,*
PMCID: PMC373377  PMID: 14960715

Abstract

Modified nucleosides in tRNAs play important roles in tRNA structure, biosynthesis and function, and serve as crucial determinants of bacterial growth and virulence. In the yeast Saccharomyces cerevisiae, mutants defective in N1-methylation of a highly conserved adenosine (A58) in the TΨC loop of initiator tRNA are non-viable. The yeast m1A58 methyltransferase is a heterotetramer consisting of two different polypeptide chains, Gcd14p and Gcd10p. Interestingly, while m1A58 is not found in most eubacteria, the mycobacterial tRNAs have m1A58. Here, we report on the cloning, overexpression, purification and biochemical characterization of the Rv2118c gene-encoded protein (Rv2118p) from Mycobacterium tuberculosis, which is homologous to yeast Gcd14p. We show that Rv2118c codes for a protein of ∼31 kDa. Activity assays, modified base analysis and primer extension experiments using reverse transcriptase reveal that Rv2118p is an S-adenosyl-l-methionine-dependent methyltransferase which carries out m1A58 modification in tRNAs, both in vivo and in vitro. Remarkably, when expressed in Escherichia coli, the enzyme methylates the endogenous E.coli initiator tRNA essentially quantitatively. Furthermore, unlike its eukaryotic counterpart, which is a heterotetramer, the mycobacterial enzyme is a homotetramer. Also, the presence of rT modification at position 54, which was found to inhibit the Tetrahymena pyriformis enzyme, does not affect the activity of Rv2118p. Thus, the mycobacterial m1A58 tRNA methyltransferase possesses distinct biochemical properties. We discuss aspects of the biological relevance of Rv2118p in M.tuberculosis, and its potential use as a drug target to control the growth of mycobacteria.

INTRODUCTION

Post-transcriptional modification of the four standard RNA nucleosides in tRNA transcripts at selective positions is an elegant cellular strategy to impart a distinct ability to mature tRNAs to faithfully carry out their crucial biological functions (1). Over 80 modified nucleosides have been characterized so far in tRNAs (2–4). Some of the modified nucleosides play important roles in the recognition and discrimination of tRNAs by the cognate aminoacyl-tRNA synthetases (5) and translation factors (6), in conferring stability to tRNA tertiary structure by facilitating non-canonical base pairing schemes (7) and in codon recognition (8). More recently, the role of base modifications in tRNAs of pathogenic bacteria as a virulence factor and as a growth rate determinant has also been reported (9,10).

One of the base modifications, N1-methyladenosine, is found at a highly conserved position A58 in the TΨC loop (m1A58) of tRNAs from all three domains of life (11). While this modification occurs infrequently in eubacteria, its presence is fairly common in the tRNAs of most eukaryotes and archaea. In fact, in the yeast Saccharomyces cerevisiae, m1A58 modification is essential for the processing and stability of the initiator tRNA and for survival of yeast under normal growth conditions (12). Similarly, in Thermus thermophilus, gene disruption studies suggest that m1A58 modification is required for growth of the bacteria at extreme temperatures (13).

The presence of m1A58 modification in mycobacterial tRNAs as well as the identification of an enzymatic activity responsible for this modification was reported over two decades ago (14,15). The emergence of tuberculosis as a serious infection is once again a major global concern. Fortunately, the availability of the complete genome sequence of Mycobacterium tuberculosis (16), the causative agent of tuberculosis, has provided a new thrust to the structural and functional analyses of the mycobacterial gene products. Such studies are required not only to understand the biology of this important group of bacteria but also to identify and develop new drug targets to control the growth of M.tuberculosis, especially the multiple drug-resistant strains whose effective treatment is presently a major concern.

In yeast, the m1A58 modification is carried out by a heterotetrameric protein consisting of Gcd10p and Gcd14p polypeptides (17). Gcd10p is an RNA-binding protein and Gcd14p is the catalytic subunit. In our attempts to determine whether M.tuberculosis m1A58 tRNA methyltransferase also consists of two different polypeptides, we performed BLAST searches and multiple sequence alignments which revealed that the genome of M.tuberculosis contains an open reading frame (ORF; Rv2118c), which shows homology with Gcd14p. However, no homologs of Gcd10p were detected. A similar observation was made earlier for adenosine deaminase which converts A34 to I34 in many tRNAs. In yeast, a heterodimeric protein consisting of Tad2p and Tad3p carries out this modification (18). While Tad2p and Tad3p are homologous, both these proteins are essential for the modification reaction. Interestingly, in prokaryotes, a gene encoding only one such polypeptide is found [cited in Gerber and Keller (18)].

In the original genome annotation of M.tuberculosis H37Rv, Rv2118p was included in the category of conserved hypothetical proteins (protein isoaspartate methyltransferase). Surprisingly, however, cloning, expression and biochemical analysis of the Rv2118c-encoded protein (Rv2118p) showed that this protein alone had m1A tRNA methyltransferase activity (our unpublished results). Based on the above identification of Rv2118p as a tRNA methyltransferase, as a part of our structural genomics effort, we then determined the three-dimemsional structure of Rv2118p in complex with S-adenosyl-l-methionine (AdoMet) by X-ray crystallography (19). Interestingly, unlike the two-component heterotetrameric enzyme from yeast, the mycobacterial enzyme is a homotetramer. While biochemical characterization of m1A58 tRNA methyltransferase from mammals (20), Tetrahymena pyriformis (21), S.cerevisiae (17) and more recently from T.thermophilus (13) has been reported, the three-dimensional structure of none of these enzymes is known. On the other hand, while the crystal structure of Rv2118p had been solved to a resolution of 1.98 Å, characterization of its biochemical properties has not been described.

Here we describe the properties of Rv2118p in vitro and in vivo in Escherichia coli, and show that Rv2118p is indeed an m1A58 tRNA methyltransferase. The enzyme methylates A58 of E.coli initiator tRNA essentially quantitatively. The availability of the high-resolution crystal structure of Rv2118p (19) and now its characterization as a distinct m1A58 tRNA methyltransferase make this protein an ideal member of this class of enzymes for further studies of tRNA recognition.

MATERIALS AND METHODS

Growth of E.coli, Mycobacterium smegmatis and M.tuberculosis

Escherichia coli was grown in Luria–Bertani medium [LB; 1% tryptone, 0.5% yeast extract and 1% sodium chloride, (w/v)] (22) and M.smegmatis mc2155 (23) was grown in LB supplemented with 0.2% Tween-80. For growth on a solid surface, 1.5% agar was added to broth media. Mycobacterium tuberculosis H37Ra (an avirulent laboratory strain derived from M.tuberculosis H37Rv) was grown in Middlebrook 7H9-ADC (liquid) containing 0.05% (v/v) Tween-80. Pre-mixed media or the components were from Difco, USA. Liquid cultures were grown at 37°C under shaking. When needed, media for E.coli were supplemented with ampicillin (100 µg/ml).

Cloning of the Rv2118c gene

The ORF of Rv2118c was amplified by PCR with Pfu DNA polymerase using 250 ng of M.tuberculosis H37Rv genomic DNA and 20 pmol each of forward (GGTACCATGGCAGCAACCGGCCCATTCAGC) and reverse (GCTTAGATCTCCCGTCGCGTCCCTCGCGCT) primers containing an NcoI and BglII site (shown in italics), respectively. Briefly, the samples were heated to 94°C for 4 min and PCR was carried out for 25 cycles consisting of incubations at 94°C for 45 s, 52°C for 45 s and 68°C for 2 min. A final extension of 68°C for 10 min was also included. The PCR product was purified by phenol/chloroform extractions, digested with NcoI and BglII, separated on low melting agarose (SeaPlaque) gel, and cloned between the same sites of pQE60 (Qiagen) expression vector as a fusion construct with a hexahistidine tag at the C-terminal end of the ORF.

Purification of Rv2118p

Escherichia coli DH5α or TG1 cells (22) harboring pQE60Rv2118c were harvested from cultures grown in LB (1 l) following induction with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG). The cells were suspended and sonicated in a buffer consisting of 50 mM sodium phosphate pH 7.0, 10 mM imidazole, 300 mM NaCl and 1 mM phenylmethylsulfonyl fluoride (PMSF), and clarified by centrifugation. The supernatant was passed through an Ni2+-NTA column (Qiagen), followed by extensive washing of the column with the loading buffer, and Rv2118p was eluted with a gradient of 10 mM to 1 M imidazole in the same buffer. Fractions containing the over-expressed protein were pooled and precipitated with ammonium sulfate to 40% saturation. The precipitate was dissolved in a buffer consisting of 50 mM Tris–HCl pH 7.2, 300 mM NaCl and 2 mM Na2EDTA, and further purified by gel filtration on a Superdex 200 column (Amersham Biosciences).

Preparation of total tRNA from E.coli and M.smegmatis

tRNAs of E.coli, which lack m1A58 modification, were used as substrate for methyltransferase assays. RNA was prepared (24) by extraction of the cell suspension with phenol, the aqueous layer was subjected to precipitation with ethanol and the precipitate was dissolved in 1 ml 10 mM NaOAc pH 5.0 and 1 mM Na2EDTA. The solution was adjusted to a concentration of 1.5 M in NaCl, left at 4°C for 2–3 h, and centrifuged to remove the high molecular weight rRNAs. The supernatant containing total tRNA was mixed with 2.5 vols ethanol, kept at 4°C overnight, and centrifuged to pellet the tRNA. The tRNA was dissolved in 10 mM Tris–HCl, 1 mM Na2EDTA and stored. Total tRNA from M.smegmatis mc2155 was isolated as described (25). For further purification, the total tRNA was loaded onto a DEAE–cellulose (DE52, Whatman) column in a buffer containing 50 mM Tris–HCl pH 7.5 and 100 mM LiCl, washed with 10 column volumes of the same buffer and eluted with 50 mM Tris–HCl pH 7.5 containing 1 M LiCl.

Preparation of cell-free extracts of M.tuberculosis H37Ra

Bacterial cells from 1 l cultures grown to late exponential phase were harvested by centrifugation, washed with 50 mM Tris–HCl pH 7.5 containing 25% sucrose (w/v), suspended in 25 ml of the same buffer and frozen at –70°C. The suspension was thawed on ice and lysed at 18 000 p.s.i. pressure in a French press. The lysate was centrifuged at 15 000 r.p.m. for 30 min in a SS34 rotor (Sorvall). The S20 supernatant was then subjected to ultracentrifugation at 31 200 r.p.m. for 1 h using a Type 70 Ti rotor (Beckman) to obtain S100 supernatant. The proteins in the S100 supernatant were precipitated with ammonium sulfate (0.35 g/ml), recovered by centrifugation, dissolved in 50 mM Tris–HCl pH 7.5, 1 mM Na2EDTA, 2 mM β-mercaptoethanol and 10% glycerol (v/v) and dialyzed against the same buffer containing 50 mM KCl. Total proteins were estimated by using Bradford’s reagent with bovine serum albumin (BSA) as standard (26).

tRNA methyltransferase activity assays

Methyltransferase activity assays (27) utilized [methyl-14C]AdoMet as cofactor to transfer the [methyl-14C] group to the substrate tRNA. The assay mixture (100 µl) contained R buffer [100 mM Tris–HCl pH 8.0, 100 mM NaCl, 2 mM dithiothreitol (DTT), 0.5 mM Na2EDTA], 40 µM [methyl-14C]AdoMet (60 mCi/mmol, Amersham Biosciences) and tRNA (6–50 µM). The reaction was initiated by addition of 5 µg of purified Rv2118p and incubated at 37°C. Aliquots were taken at different times and the tRNA was precipitated on GF/C filters pre-wetted with 5% trichloroacetic acid (TCA) and 2% peptone. The filters were washed three times in 5% TCA and once in ethanol, dried and subjected to scintillation counting. The details of reaction volumes when scaled down from the standard 100 µl reaction are as provided in the figure legends.

Modified base analysis

Fresh overnight cultures of E.coli cells harboring vector alone or the Rv2118p expression construct pQERv2118c were subcultured (1% inoculum) in 5 ml of 2YT medium containing ampicillin (100 µg/ml) and grown at 37°C with constant aeration for 4 h. The cells were harvested, suspended in 1 ml of low phosphate medium (24), supplemented with 500 µCi of [32P]orthophosphate and incubated at 37°C for 1 h. Initiator tRNAs were purified from the total tRNA preparation by electrophoresis on a 15% preparative polyacrylamide gel under non-denaturing conditions (24). The 32P-labeled tRNA (20 000 c.p.m.) was incubated with nuclease P1 (1 µg) in 20 µl 50 mM ammonium acetate buffer pH 5.3 at 37°C for 5 h and the incubation mixture was evaporated to dryness under vacuum. Traces of ammonium acetate were eliminated by drying the contents twice more under vacuum after dissolving in 20 µl water each time. The contents were mixed with 0.1 A260 unit of pm1A in water and applied onto cellulose thin-layer plates in a 2 µl volume. Two-dimensional thin-layer chromatography (TLC) was performed on cellulose plates using isobutyric acid:water:ammonium hydroxide (66:33:1, by vol.) as the solvent for the first dimension, and 0.1 M sodium phosphate pH 7.2:ammonium sulfate:n-propanol (100:60:2, v/w/v) as the solvent for the second dimension, exactly as described (28), air-dried and subjected to phosphorimaging (Molecular Dynamics).

Chemical conversion of pm1A to pm6A and its analysis

Escherichia coli tRNA2fMet was subjected to methylation with Rv2118p in the presence of [methyl-14C]AdoMet and purified by phenol extraction and ethanol precipitation. The tRNA was digested with nuclease P1, and the contents were heated in a sealed capillary for 1 h at 100°C in 50 mM ammonium bicarbonate pH 9.2 (27). Under these conditions, pm1A rearranges to pm6A, which can be clearly separated from pm1A by two-dimensional TLC (28). The marker for pm6A was generated by the same procedure by heating ∼8 OD of pm1A in a 10 µl volume in a sealed capillary. Chemical conversion was confirmed by a quantitative shift of the absorption maxima from 258 nm (pm1A) to 264 nm (pm6A).

Primer extension with reverse transcriptase

Total tRNA (1 A260 unit) and 2 pmol (200 000 c.p.m.) of 5′-32P-labeled DNA oligomer (TGGTTGCGGGGGC) were mixed, heated to 90°C and quick-frozen in dry ice. The contents were made up to 15 µl in a buffer consisting of 50 mM Tris–HCl pH 8.3, 30 mM KCl, 8 mM MgCl2, 10 mM DTT, 0.5 mM dNTPs, supplemented with 10 U of MMLV reverse transcriptase and incubated at 37°C for 30 min. The reaction was terminated by addition of 5 µl of sample buffer containing 8 M urea and 0.01% xylene cyanolFF and heating at 90°C for 2 min. The reaction products were analyzed on an 8 M urea–15% polyacrylamide sequencing gel (29) of 0.4 mm thickness, and visualized by autoradiography.

RESULTS

Identification of Rv2118p as a putative m1A58 tRNA methyltransferase in M.tuberculosis

Unlike tRNAs from E.coli and most other eubacteria, the mycobacterial tRNAs possess the m1A58 modification (14). Although the presence of m1A58 modification in tRNAs and of m1A58 tRNA methyltransferase in M.smegmatis (a closely related fast-growing mycobacterium) was reported over two decades ago, no further characterization of this enzyme has since been carried out. The observation that the m1A58 modification in S.cerevisiae is essential for its growth stimulated us to characterize the enzyme responsible for this modification in M.tuberculosis, the causative agent of tuberculosis. Availability of the sequence of both the Gcd10p (RNA-binding subunit) and Gcd14p (catalytic subunit) proteins of the two-component m1A58 tRNA methyltransferase in S.cerevisiae, and the complete genome sequence of M.tuberculosis allowed us to take a bioinformatics approach to search for gene(s) which might encode this activity in mycobacteria. While no homologs of Gcd10p were found, Rv2118p was found as a homolog of Gcd14p in M.tuberculosis (Fig. 1A). Rv2118p showed a sequence identity of 22% and sequence similarity of 33% with S.cerevisiae Gcd14p. The Rv2118p sequence contained the hallmark motifs I and II of the AdoMet-dependent methyltransferases identified in Gcd14p [Fig. 1A; Calvo et al. (30)]. In addition, the invariant glycine and leucine residues of the otherwise less conserved motif III are also present in Rv2118p [Fig. 1A; Gupta et al. (19) and Kagan and Clark (31)]. While Rv2118p is the subject of this study, the availability of the partial genome sequence of M.smegmatis allowed us to identify a homolog of Rv2118p also in this closely related fast-growing mycobacterium (Fig. 1B). As expected, the mycobacterial proteins show high identity (76%) and similarity (81%) scores.

Figure 1.

Figure 1

Figure 1

Sequence alignment of Rv2118p from M.tuberculosis H37Rv with Gcd14p from S.cerevisiae (A) and with its homolog in M.smegmatis (B). The α-helices and β-strands in Rv2118p, determined from its crystal structure (19), are shown as solid boxes and arrows, respectively (A). The three conserved AdoMet-dependent methyltransferase motifs are boxed. The sequence alignment was done using PILEUP, and CLUSTAL W. BOXSHADE was used to obtain the shaded schematic representation. Identical amino acids are highlighted in black, and similar amino acids are highlighted in gray. Rv2118p and Gcd14p show identity and similarity scores of 22 (62/280) and 33% (91/280), respectively. The corresponding scores between Rv2118p and its homolog from M.smegmatis (B) are 76 (212/280) and 81% (228/280), respectively.

Overproduction and purification of Rv2118p

To study the relationship between Rv2118p and the yeast m1A58 tRNA methyltransferase, the Rv2118c ORF was cloned into the pQE60 expression vector to generate pQE60Rv2118c. This cloning resulted in fusion of a hexahistidine tag to the C-terminus of the ORF (Fig. 2A). Analysis of cellular extracts of E.coli harboring pQE60Rv2118c revealed that expression (Fig. 2B) of Rv2118p was inducible, and that there was an appreciable level of its expression in both DH5α and TG1, common laboratory strains of E.coli. Affinity purification of cellular extracts on an Ni2+-NTA column followed by gel filtration chromatography resulted in purification of Rv2118p to near homogeneity. However, SDS–PAGE of a large amount (15 µg) of the protein revealed the presence of trace levels of a few contaminating bands (Fig. 2B, lane 5). The electrophoretic mobility also suggested an Mr of ∼31 kDa for Rv2118p, which agrees with the expected molecular weight from an ORF of 280 amino acids fused to a hexahistidine sequence. However, the analysis of this protein on a size exclusion column (S-200) showed that it migrated (Fig. 2C) with an apparent mol. wt of ∼115 kDa, suggesting that, under native conditions, Rv2118p exists as a homotetramer. Further analysis of this protein by MALDI-TOF revealed an Mr of 31 088 kDa which corresponded (within a 0.1% limit of error) to the calculated theoretical mass of the protein. Both the authenticity of the primary sequence and the quaternary structures of the protein were borne out from a high resolution X-ray crystal structure of the protein (19).

Figure 2.

Figure 2

(A) A schematic diagram of the expression construct (pQE60Rv2118c) of Rv2118p with a hexahistidine tag at the C-terminus. (B) Analysis of the expression profile, and purification of Rv2118p by SDS–PAGE. The E.coli strains DH5α (lanes 1 and 2) and TG1 (lanes 3 and 4) harboring pQE60Rv2118c were either induced (lanes 2 and 4) or not induced (lanes 1 and 3) with 1 mM IPTG, and the total cell extracts were analyzed by SDS–PAGE. Rv2118p was purified by chromatography on an Ni2+-NTA column, and ∼15 µg of purified protein was analyzed (lane 5). (C) Approximately 1.5 mg (7.5 mg/ml) of Rv2118p was applied on a S-200 size exclusion column. The elution volume of 13.23 ml corresponded to a mol. wt of ∼115 kDa. Absorbance is shown in milliunits (mA).

Rv2118p functions as a tRNA methyltransferase in vitro

Earlier studies (19) showed the presence of an AdoMet binding pocket in Rv2118p. To demonstrate its activity as a m1A tRNA methyltransferase, a total tRNA preparation from E.coli, which lacks m1A58 modification in its tRNAs, was used as substrate in assays with Rv2118p. Incorporation of 14C radiolabel from [methyl-14C]AdoMet into tRNA was monitored by TCA precipitation. As shown in Figure 3, in the reaction not supplemented with Mg2+, Rv2118p catalyzed efficient incorporation of the radiolabel into tRNA, suggesting that it is a tRNA methyltransferase.

Figure 3.

Figure 3

Effect of Mg2+ ions on methylation activity of Rv2118p. Reactions (15 µl) containing 0.8 µg of Rv2118p, 40 µM [methyl-14C]AdoMet, ∼50 µM tRNA and varying amounts of MgCl2 in R buffer (Materials and Methods) were incubated at 37°C. TCA-precipitable counts in 4.5 µl aliquots were determined for each time point.

Presence of Mg2+ in the reaction inhibits tRNA methylation by Rv2118p

It was reported that the m1A58 methyltransferase activity of the T.pyriformis enzyme increased in the presence of divalent cations such as Mg2+ (21). However, as shown in Figure 3, inclusion of MgCl2 (1–10 mM) in the reaction with Rv2118p resulted in an overall decrease in the rate of methylation of total tRNA. At 10 mM MgCl2, the rate of incorporation of 14C was reduced to <5% of the control.

Rv2118p methylates E.coli tRNAs in vivo

To demonstrate that Rv2118p methylates tRNAs in vivo, we prepared total tRNA from E.coli harboring the expression construct pQE60Rv2118c. When such a tRNA preparation was used in in vitro methylation reactions, a very low level of methylation was observed, suggesting that the tRNA was already methylated in vivo (Fig. 4). Since E.coli tRNAs naturally lack m1A58 modification, total tRNA isolated from cells carrying the control pQE60 plasmid was methylated efficiently. Further, as these experiments were carried out under limiting tRNA concentrations, in a reaction containing an equimolar mixture of the two tRNA preparations, the extent of methylation was, as expected, about half that of the control tRNA. Importantly, this experiment ruled out the possibility that the preparation of tRNA from E.coli expressing Rv2118p contained inhibitors of the methylation reaction.

Figure 4.

Figure 4

In vivo methylation of tRNA by Rv2118p. Total tRNA (∼6 µM) from E.coli harboring pQE60Rv2118c or the vector alone, or an equimolar mix of the two, was used in reactions (15 µl) containing 0.8 µg of Rv2118p and 40 µM [methyl-14C]AdoMet in R buffer and incubated at 37°C. TCA-precipitable counts in 4.5 µl aliquots were determined for each time point.

Rv2118p does not methylate total tRNA from M.smegmatis

Mycobacterium smegmatis and M.tuberculosis are phylogenetically closely related. When total tRNAs from M.smegmatis were used for in vitro methylation by Rv2118p, only a background level of 14C-methyl incorporation was seen (Fig. 5). Since the M.smegmatis tRNAs possess m1A58 modification, the background level incorporation of 14C indicates that Rv2118p does not methylate other positions in tRNA to any significant extent, and that the Rv2118p is a tRNA methyltransferase specific for the A58 position. As expected, the control tRNA from E.coli was methylated efficiently. Furthermore, as in Figure 4, in this experiment also, an equimolar mixture of the two tRNA preparations resulted in methylation to an expected extent of about half that of the control E.coli tRNA (Fig. 5).

Figure 5.

Figure 5

Methylation of total tRNA from E.coli and M.smegmatis. Reactions (15 µl) containing 0.8 µg of Rv2118p, 40 µM [methyl-14C]AdoMet and ∼6 µM tRNA in varying proportions from M.smegmatis and E.coli, in R buffer, were incubated at 37°C. TCA-precipitable counts in 4.5 µl aliquots were determined for each time point.

Characterization of Rv2118p as an m1A tRNA methyltransferase

For studies on the nucleoside specificity in vivo of Rv2118p, we carried out modified base analysis of the initiator tRNA prepared from E.coli cells harboring either the vector (pQE60) or the expression plasmid (pQE60Rv2118c). The analysis of the tRNAs from the cells harboring vector alone did not show a spot corresponding to m1A. On the other hand, the m1A spot was present in the tRNA preparation from the Rv2118p-expressing cells (Fig. 6A, panels i and ii).

Figure 6.

Figure 6

(A) Modified base analysis. tRNA1fMet and tRNA2fMet were gel purified from metabolically labeled (32P) E.coli cells harboring vector (panel i) or the expression plasmid for Rv2118p (panel ii), respectively, and subjected to modified base analysis. The spot corresponding to pm1A (identified from UV visualization of a non-radioactive pm1A marker) is indicated by an arrow. (B) Chemical conversion of pm1A to pm6A. tRNA2fMet methylated in the presence of [methyl-14C]AdoMet was purified and digested with nuclease P1 and analyzed (Materials and Methods) for modified base analysis before (panel i) and after heat treatment (panel ii). Circles with dotted lines show the position of non-radioactive markers determined by UV shadowing.

The nucleoside m1A is known to undergo isomerization to m6A when heated at a slightly alkaline pH. To confirm the identity of the pm1A spot that appeared in the modified base analysis, we carried out an in vitro methylation reaction using tRNA2fMet in the presence of [methyl-14C]AdoMet. The product of the reaction was purified and treated with nuclease P1. The P1 digest was then heated in a sealed capillary tube. Two-dimensional TLC revealed a quantitative conversion of the pm1A to pm6A (Fig. 6B, panels i and ii).

Primer extension analysis of tRNA isolated from E.coli expressing Rv2118p shows that Rv2118p is an m1A58 tRNA methyltransferase that methylates essentially quantitatively the E.coli initiator tRNA in vivo

To map the location of m1A in the tRNA, primer extension by reverse transcriptase was employed. Since, the N1 position in adenosine is involved in Watson–Crick base pairing, a modification at this position in the template blocks DNA synthesis. As shown in Figure 7 (left panel), use of a DNA oligomer (Materials and Methods) complementary to positions 76–64 of the E.coli initiator tRNAs, in the extension reaction with reverse transcriptase, results in a major product corresponding to its full-length extension when either the pure native tRNA2fMet or the total tRNA preparation from E.coli harboring vector alone was used as template (compare lanes 2 and 3 with lane 5, left panel). However, use of the same primer in a reaction with total tRNA, isolated from cells harboring Rv2118p, as template resulted in premature termination of DNA synthesis (the major band marked with an asterisk, lane 4). When compared with the marker ladder generated by partial digestion of 5′-32P-labeled tRNA2fMet with RNase T1 (lane 1), the size of the product agrees with termination at position 58 of the tRNA. These results clearly show that Rv2118p modifies adenosine at position 58 in tRNAs, and that Rv2118p is indeed an m1A58 tRNA methyltransferase in vivo. Furthermore, a complete block in primer extension in lane 4 suggests that A58 is methylated quantitatively in the initiator tRNA in vivo. Thus, the mycobacterial Rv2118p is a highly efficient m1A58 tRNA methyltransferase in E.coli.

Figure 7.

Figure 7

Analysis of the products of primer extensions. The 5′-32P-labeled DNA oligomer (TGGTTGCGGGGGC), complementary to the 3′ end of the initiator tRNA, was annealed to total tRNA and extended using MMLV reverse transcriptase (Materials and Methods). The reaction products were analyzed on an 8 M urea–15% polyacrylamide sequencing gel and visualized by autoradiography. Lane 1, partial digestion of 5′-32P-labeled initiator tRNA with RNase T1; lanes 2–4, primer extensions using pure initiator tRNA (lane 2), total tRNA from cells harboring vector (lane 3) or Rv2118p expression vector (lane 4) as templates; lane 5, 5′-32P-end-labeled primer as marker. The panel on the right shows the experimental strategy.

Rv2118p is a single-component tRNA methyltransferase

Although the experiments discussed above suggest that Rv2118p is a homotetrameric tRNA methyltransferase, these experiments do not rule out that undetectable minor contaminating proteins may be facilitating the methylation of tRNA by Rv2118p. We reasoned that if Rv2118p, like the yeast enzyme, requires ancillary proteins for its activity, supplementation of total cell proteins to a highly purified preparation of Rv2118p, such as the one used here, should lead to enhancement of its methyltransferase activity. Thus, we supplemented the reactions with various amounts (0.75– 7.5 µg) of total cellular proteins of M.tuberculosis H37Ra origin. As seen in Figure 8, inclusion of total mycobacterial proteins in the reaction did not lead to any increase in either the extent or the rate of tRNA methylation.

Figure 8.

Figure 8

Effect of total cell proteins of M.tuberculosis H37Ra on methylation activity of Rv2118p in vitro. Reactions (15 µl) containing 0.8 µg of Rv2118p, 40 µM [methyl-14C]AdoMet and ∼50 µM tRNA in R buffer were supplemented with varying amounts of total cell proteins and incubated at 37°C. TCA-precipitable counts in 4.5 µl aliquots were determined for each time point.

Efficiency of methylation at A58 is not affected by the presence of riboT at position 54

It was shown that the activity of T.pyriformis m1A58 tRNA methyltransferase was drastically decreased by the presence of riboT at position 54 of the substrate (21). Since, we used E.coli tRNA from the strains which possess rT modification, we wished to study the methyltransferase activity using tRNA substrates where rT modification does not occur. This was important because the mycobacterial tRNAs lack rT54 modification. Thus, total tRNA was prepared from E.coli KL356 lacking the rT modification (32,33). Both the rates and the extent of methylation of this preparation were indistinguishable from those of the reference tRNA prepared from E.coli KL16 possessing rT at position 54 (data not shown), suggesting that the activity of the mycobacterial m1A58 tRNA methyltransferase is unaffected by the presence of rT54 in the tRNA substrate.

DISCUSSION

The occurrence of methylation at N1 of the adenosine at position 58 of the TΨC loop (m1A58) has now been reported from all three phylogenetic realms of life (11). The A58 is an invariant important residue which stabilizes the well-defined conformation of the TΨC loop by formation of a trans Hoogsteen pair with T54 (7). The TΨC loop structure is additionally stabilized by hydrogen bonding of the anionic oxygen of phosphate of C60 to O2′ of A58 as well as the amino group of C61. The presence of a methyl group on N1 of A58 facilitates the hydrophobic packing in its vicinity, and the introduction of a positive charge on tRNA (a consequence of modification) may also contribute to the overall stability of tRNA (7).

While the earlier studies have suggested that mammalian m1A58 tRNA methyltransferases may be constituted of a single polypeptide (20), neither the gene that codes for this activity nor the in vivo function of the identified protein has been characterized. However, the homologs of Gcd10p and Gcd14p are easily recognizable in several eukaryotes, including human [cited in Anderson et al. (17)], suggesting the common presence of a two-component m1A58 tRNA methyltransferase and/or indicating the presence of more than one class of m1A58 tRNA methyltransferases in eukaryotes. In this context, it would also be of interest to determine the subunit composition of the m1A9 tRNA methyltransferase, which carries out methylation at N1 of A9 in some tRNAs in mammalian mitochondria, critical for formation of the correct tRNA structure and aminoacylation of the tRNA (34).

In this study, we have shown that unlike the well-characterized two-component tetrameric enzyme from S.cerevisiae, the M.tuberculosis enzyme is a homotetramer. Also, unlike the m1A58 tRNA methyltransferase from T.pyriformis whose activity is greatly reduced by the presence of rT at position 54, the M.tuberculosis enzyme is unaffected by the presence of rT modification at position 54. Thus, the M.tuberculosis m1A58 tRNA methyltransferase is biochemically distinct from its eukaryotic counterparts. It was also observed that the T.pyriformis enzyme showed enhanced activity in the presence of Mg2+. However, in our studies, we noticed that inclusion of Mg2+ resulted in a decrease in the activity of Rv2118p. A major difference between our studies and those with the T.pyriformis enzyme is that we used tRNAs as substrate in contrast to 17 nt synthetic RNA hairpins used as substrate with the T.pyriformis enzyme. Hence, it is quite likely, as also pointed out by Agris and co-workers (21), that the stimulating effect of Mg2+ and the deleterious effect of rT54 on activity of the T.pyriformis enzyme is because of their effect on the local conformation of the TΨC loop. In other words, the conformation of the TΨC loop is different between full-length tRNA and the synthetic RNA hairpins. More recently, the m1A58 tRNA methyltransferase from T.thermophilus, another homotetrameric enzyme, has also been described (13). It would, therefore, be interesting to compare the detailed biochemical properties of the T.thermophilus enzyme with the mycobacterial enzyme.

In S.cerevisiae, deletion of Gcd14p is lethal. The defect in m1A58 methylation can be overcome by overproduction of initiator tRNA, suggesting that lack of m1A58 modification affects stability/processing of the tRNA precursors. Interestingly, while many other tRNAs in yeast possess m1A58 modification, it is only the initiator tRNA which is most affected. Notably, with the exception of Bombyx mori alanine tRNAs (35), eukaryotic initiator tRNAs are also the only tRNAs that contain A54 instead of T54 (36,37). It is, therefore, possible that a non-canonical base pair between A54 and A58, necessary for stabilization of the TΨC loop structure, requires that A58 be methylated to m1A58. It would be interesting to see whether the presence of m1A58 is also important for the stability and/or processing of the B.mori alanine precursor tRNA.

In mycobacteria, all tRNAs lack rT modification at position 54. Concomitantly, mycobacterial tRNAs have m1A58. This raises the question of whether m1A58 plays an important role in stabilization of tRNA structure in mycobacterial tRNAs. However, it should be mentioned that mycoplasma which also lack rT modification in tRNA do not have the m1A58 modification (38). In addition, T.thermophilus tRNAs which have m1A58 have s2T at position 54 (39,40).

Finally, M.tuberculosis multiplies in the hostile environment of the host macrophages. It also establishes itself in a state of dormancy to remain viable for decades in macrophages. Also, at an opportune time, when the host immune system is compromised, such as during human immunodeficiency virus infection, the bacteria begin to multiply aggressively to cause tuberculosis. During the period of latency, when metabolic activities are at a minimum, longer half- lives of RNA molecules, which are otherwise prone to turn over, may be necessary for continued sustenance. Thus, the presence of m1A58 in the mycobacterial tRNAs which lack riboT modification at position 54 may be crucial to ensure greater stability of the tRNAs. A recent study in T.thermophilus, an extremophile, showed that disruption of trmI whose product is responsible for the m1A58 modification is crucial for adaptation to high temperatures. The definitive biochemical characterization of Rv2118p described here, now sets the stage for us to carry out targeted gene disruption studies to further analyze the essentiality of this enzyme in mycobacteria. Such studies may provide us with a unique opportunity to selectively target this enzyme to control growth of M.tuberculosis, an organism which survives in the extreme habitat of the host macrophages.

Acknowledgments

ACKNOWLEDGEMENTS

This work was supported by research grants from the Department of Science and Technology, the Department of Biotechnology and the Indian Council of Medical Research, New Delhi, India (to U.V.); and R37GM17151 from the National Institutes of Health, USA (to U.L.R.).

REFERENCES

  • 1.Söll D. and RajBhandary,U.L. (1995) tRNA Structure, Biosynthesis and Function. ASM Press, Washington, DC. [Google Scholar]
  • 2.McCloskey J.A., Pamela,F. and Crain,P.F. (1998) The RNA modification database—1998. Nucleic Acids Res., 26, 196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rozenski J., Crain,P.F. and McCloskey,J.A. (1999) The RNA modification database: 1999 update. Nucleic Acids Res., 27, 196–197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sprinzl M., Hartman,T., Weber,J., Blank,J. and Zeidler,R. (1989) Sequences supplement. Nucleic Acids Res., 17, r1–r172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Muramatsu T., Nishikava,K., Nemota,F., Kuchino,Y., Nishimura,S., Miyazawa,T. and Yokoyama,S. (1988) Codon and amino-acid specificities of a transfer RNA are both converted by a single post-transcriptional modification. Nature, 336, 179–181. [DOI] [PubMed] [Google Scholar]
  • 6.Astrom S.U. and Bystrom,A.S. (1994) Rit1, a tRNA backbone-modifying enzyme that mediates initiator and elongator tRNA discrimination. Cell, 79, 535–546. [DOI] [PubMed] [Google Scholar]
  • 7.Dirheimer G., Keith,G., Dumas,P. and Westhof,E. (1995) In Söll,D. and RajBhandary,U.L. (eds), tRNA Structure Biosynthesis and Function. ASM Press, Washington, DC, pp. 93–126. [Google Scholar]
  • 8.Yokoyama S. and Nishimura,S. (1995) In Söll,D. and RajBhandary,U.L. (eds), tRNA Structure Biosynthesis and Function. ASM Press, Washington, DC, pp. 207–223. [Google Scholar]
  • 9.Durand J.M., Okada,N., Tobe,T., Watarai,M., Fukuda,I., Suzuki,T., Nakata,N., Komatsu,K., Yoshikawa,M. and Sasakawa,C. (1994) vacC, a virulence-associated chromosomal locus of Shigella flexneri, is homologous to tgt, a gene encoding tRNA-guanine transglycosylase (Tgt) of E.coli K-12. J. Bacteriol., 176, 4627–4634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Durand J.M.B. and Bjork,G.R. (2003) Putrescine or a combination of methionine and arginine restores virulence gene expression in a tRNA modification deficient mutant of Shigella flexneri: a possible role in adaptation of virulence. Mol. Microbiol., 47, 519–527. [DOI] [PubMed] [Google Scholar]
  • 11.Bujnicki J.M. (2001) In silico analysis of the tRNA:m1A58 methyltransferase family: homology-based fold prediction and identification of new members from Eubacteria and Archaea. FEBS Lett., 507, 123–127. [DOI] [PubMed] [Google Scholar]
  • 12.Anderson J., Phan,L., Cuesta,R., Carlson,B.A., Pak,M., Asano,K., Bjork,G.R., Tamame,M. and Hinnebusch,A.G. (1998) The essential Gcd10p–Gcd14p nuclear complex is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA. Genes Dev., 12, 3650–3662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Droogmans L., Roovers,M., Bujnicki,J.M., Tricot,C., Hartsch,T., Stalon,V. and Grosjean,H. (2003) Cloning and characterization of tRNA (m1A58) methyltransferase (TrmI) from Thermus thermophilus HB27, a protein required for cell growth at extreme temperatures. Nucleic Acids Res., 31, 2148–2156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vani B.R., Ramakrishnan,T., Taya,Y., Noguchi,S., Yamaizumi,Z. and Nishimura,S. (1979) Occurrence of 1-methyladenosine and absence of ribothymidine in transfer ribonucleic acid of Mycobacterium smegmatis. J. Bacteriol., 137, 1084–1087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Brahmachari V. and Ramakrishnan,T. (1984) Studies on 1-methyl adenine transfer RNA methyltransferase of Mycobacterium smegmatis. Arch. Microbiol., 140, 91–95. [DOI] [PubMed] [Google Scholar]
  • 16.Cole S.T., Brosch,R., Parkhill,J., Garnier,T., Churcher,C., Harris,D., Gordon,S.V., Eiglmeier,K., Gas,S., Barry,C.E.,III et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature, 393, 537–544. [DOI] [PubMed] [Google Scholar]
  • 17.Anderson J., Phan,L. and Hinnebusch,A.G. (2000) The Gcd10p/Gcd14p complex is the essential two-subunit tRNA(1-methyladenosine) methyltransferase of Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 97, 5173–5178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gerber A.P. and Keller,W. (1999) An adenosine deaminase that generates inosine at the wobble position of tRNAs. Science, 286, 1146–1148. [DOI] [PubMed] [Google Scholar]
  • 19.Gupta A., Kumar,P.H., Dineshkumar,T.K., Varshney,U. and Subramanya,H.S. (2001) Crystal structure of Rv2118c: an AdoMet-dependent methyltransferase from Mycobacterium tuberculosis H37Rv. J. Mol. Biol., 312, 381–391. [DOI] [PubMed] [Google Scholar]
  • 20.Glick J.M. and Leboy,P.S. (1977) Purification and properties of tRNA(adenine-1)-methyltransferase from rat liver. J. Biol. Chem., 252, 4790–4795. [PubMed] [Google Scholar]
  • 21.Sengupta R., Vainauskas,S., Yarian,C., Sochacka,E., Malkiewicz,A., Guenther,R.H., Koshlap,K.M. and Agris,P.F. (2000) Modified constructs of the tRNA TΨC domain to probe substrate conformational requirements of m(1)A(58) and m(5)U(54) tRNA methyltransferases. Nucleic Acids Res., 28, 1374–1380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Sambrook J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 23.Snapper S.B., Melton,R.E., Mustafa,S., Kieser,T. and Jacobs,W.R.,Jr (1990) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol., 4, 1911–1919. [DOI] [PubMed] [Google Scholar]
  • 24.Seong B.L. and RajBhandary,U.L. (1987) Escherichia coli formylmethionine tRNA: mutations in GGGCCC sequence conserved in anticodon stem of initiator tRNAs affect initiation of protein synthesis and conformation of anticodon loop. Proc. Natl Acad. Sci. USA, 84, 334–338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Vasanthakrishna M., Kumar,N.V. and Varshney,U. (1997) Characterization of the initiator tRNA gene locus and identification of a strong promoter from Mycobacterium tuberculosis. Microbiology, 143, 3591–3598. [DOI] [PubMed] [Google Scholar]
  • 26.Sedmak J.J. and Grossberg,S.E. (1977) A rapid, sensitive and versatile assay for protein using Coomassie brilliant blue G250. Anal. Biochem., 79, 544–552. [DOI] [PubMed] [Google Scholar]
  • 27.Spremulli L.L., Agris,P.F., Brown,G.M. and RajBhandary,U.L. (1974) Escherichia coli formylmethionine tRNA: methylation of specific guanine and adenine residues catalyzed by HeLa cells tRNA methylases and the effect of these methylations on its biological properties. Arch. Biochem. Biophys., 162, 22–37. [DOI] [PubMed] [Google Scholar]
  • 28.Silberklang M., Gillum,A.M. and RajBhandary,U.L. (1979) Use of in vitro32P labeling in the sequence analysis of nonradioactive tRNAs. Methods Enzymol., 59, 58–109. [DOI] [PubMed] [Google Scholar]
  • 29.Maxam A.M. and Gilbert,W. (1980) Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol., 65, 499–560. [DOI] [PubMed] [Google Scholar]
  • 30.Calvo O., Cuesta,R., Anderson,J., Gutierrez,N., Garcia-Barrio,M.T., Hinnebusch,A.G. and Tamame,M. (1999) GCD14p, a repressor of GCN4 translation, cooperates with Gcd10p and Lhp1p in maturation of initiator methionyl-tRNA in Saccharomyces cerevisiae. Mol. Cell. Biol., 19, 4167–4181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kagan R.M. and Clarke,S. (1994) Widespread occurrence of three sequence motifs in diverse S-adenosylmethionine-dependent methyltransferases suggests a common structure for these enzymes. Arch. Biochem. Biophys., 310, 417–427. [DOI] [PubMed] [Google Scholar]
  • 32.Marinus M.G., Morris,N.R., Söll,D. and Kwong,T.C. (1975) Isolation and partial characterization of three Escherichia coli mutants with altered transfer ribonucleic acid methylases. J. Bacteriol., 122, 257–265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thanedar S., Dineshkumar,T.K. and Varshney,U. (2001) The mere lack of rT modification in initiator tRNA does not facilitate formylation-independent initiation in Escherichia coli. J. Bacteriol., 183, 7397–7402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Helm M., Giege,R. and Florentz,C. (1999) A Watson–Crick base-pair-disrupting methyl group (m1A9) is sufficient for cloverleaf folding of human mitochondrial tRNALys. Biochemistry, 38, 13338–13346. [DOI] [PubMed] [Google Scholar]
  • 35.Sprague K.U., Hagenbuchle,O. and Zuniga,M.C. (1977) The nucleotide sequence of two silk gland alanine tRNAs: implications for fibroin synthesis and for initiator tRNA structure. Cell, 11, 561–570. [DOI] [PubMed] [Google Scholar]
  • 36.Simsek M. and RajBhandary,U.L. (1972) The primary structure of yeast initiator transfer ribonucleic acid. Biochem. Biophys. Res. Commun., 49, 508–515. [DOI] [PubMed] [Google Scholar]
  • 37.Gillum A.M., Roe,B.A., Anandaraj,M.P. and RajBhandary,U.L. (1975) Nucleotide sequence of human placenta cytoplasmic initiator tRNA. Cell, 6, 407–413. [DOI] [PubMed] [Google Scholar]
  • 38.Walker R.T. and RajBhandary,U.L. (1978) The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri. Nucleic Acids Res., 5, 57–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Horie N., Hara-Yokoyama,M., Yokoyama,S., Watanabe,K., Kuchino,Y., Nishimura,S. and Miyazawa,T. (1985) Two tRNA1Ile species from an extreme thermophile, Thermus thermophilus HB8: effect of 2-thiolation of ribothymidine on the thermostability of tRNA. Biochemistry, 24, 5711–5715. [DOI] [PubMed] [Google Scholar]
  • 40.Watanabe K., Oshima,T., Iijima,K., Yamaizumi,Z. and Nishimura,S. (1980) Purification and thermal stability of several amino acid-specific tRNAs from an extreme thermophile, Thermus thermophilus HB8. J. Biochem., 87, 1–13. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES