Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jun 1.
Published in final edited form as: Clin Exp Metastasis. 2012 Dec 15;30(5):569–578. doi: 10.1007/s10585-012-9561-6

Integrin alpha2beta1 (α2β1) Promotes Prostate Cancer Skeletal Metastasis

Joseph L Sottnik 1, Stephanie Daignault-Newton 1, Xiaotun Zhang 2, Colm Morrissey 2, Maha H Hussain 3, Evan T Keller 1, Christopher L Hall 1,4
PMCID: PMC3736758  NIHMSID: NIHMS494211  PMID: 23242739

Abstract

Men who die of prostate cancer (PCa) do so because of systemic metastases, the most frequent of which are within the skeleton. Recent data suggest that the colonization of the skeleton is mediated in part by collagen type I, the most abundant protein within the bone. We have shown that enhanced collagen I binding through increased expression of integrin α2β1 stimulated in vitro invasion and promoted the growth of PCa cells within the bone. Accordingly, we sought to determine whether α2β1 integrin is a potential mediator of skeletal metastasis. To examine whether α2β1 integrin mediates PCa metastasis, α2 integrin was over-expressed in low-tumorigenic LNCaP PCa cells or selectively knocked-down in highly metastatic LNCaPcol PCa cells. We document that the over-expression of α2 cDNA stimulated whereas α2 shRNA inhibited the ability of transduced cells to bind to or migrate towards collagen in vitro. Correspondingly, α2 integrin knock-down reduced the tumor burden of intra-osseous tumors compared to control-transduced cells. To investigate the clinical significance of α2β1 expression in PCa, α2β1 protein was measured in prostatic tissues and in soft tissue and bone metastases. The data demonstrate that α2β1 protein was elevated in PCa skeletal metastases compared to either PCa primary lesions or soft tissue metastases suggesting that α2β1 contributes to the selective metastasis to the bone. Taken together, these data support that α2β1 integrin is needed for the efficient metastasis of PCa cells to the skeleton.

Keywords: prostate cancer, skeleton, metastasis, integrin, collagen

Introduction

Prostate cancer (PCa) is a significant health problem among men in the United States. In 2012, PCa is expected to be the most frequently diagnosed cancer in men and the second leading cause of cancer-related deaths within this group [1]. Of the 28,000 estimated deaths attributable to PCa this year, all will follow the metastatic spread of the disease from the prostate to distant organs including the dura, liver, lung, lymph nodes, and skeleton. The most frequent distant metastases formed by malignant PCa are within the skeleton [2]. Studies of men with progressive castration-resistant, non-metastatic PCa indicate that nearly one half of patients will develop skeletal metastases within two years whereas greater than 80% of all men who die of PCa will have metastatic disease within the bone, specifically in the trabecular bone of the pelvis, femur, and vertebral bodies [3,4]. Outgrowth of tumors within the bone is quite debilitating resulting in severe pain, fracture, nerve compression/paralysis, and death. Thus to improve the quality of life for PCa patients, a better understanding of the biology of skeletal metastases is needed.

The molecular mechanisms that mediate the preferential metastasis of PCa cells to the skeleton are not well defined. Adhesion to bone-specific factors may facilitate the selective metastasis of PCa cells to the skeleton. Identification of these factors may reveal important clues about the mechanism of bone metastasis as well as provide new targets for the prevention of skeletal metastasis. Collagen type I is a protein factor that is expressed at high levels in the tendon, dermis, and bone. Further, it is the most abundant protein within the bone making up over 90% of the total protein within this site [5]. The broad distribution of collagen I within the bone suggests that it may have a prominent role in skeletal metastasis.

The receptors for type I collagen include integrin (α1β1, α2β1, and α 11β1) and non-integrin receptors (Discoidin Domain Receptor 1 and 2, glycoprotein VI, Leukocyte-associated IG-like receptor-1, and the mannose receptor family); however, the most common cell surface receptors for collagen I are integrins (reviewed in [6,7]). The integrin family is a class of transmembrane adhesion molecules composed of noncovalently linked α and β subunits. Each αβ heterodimer mediates attachment to a specific set of extracellular matrix proteins, which for collagen I include integrin pairs α1β1, α2β1, and α11 [8]. α2β1 integrin is the high affinity receptor for collagen I [9]. It binds to collagen I through the specific amino acid sequence GFOGER (Gly-Phe-HPro-Gly-Glu-Arg) [10] when present in the native triple-helical conformation of the type I collagen fibril.

The integrin β subunit interacts with numerous intracellular signaling molecules including focal adhesion kinase (Fak), integrin-linked kinase, and the non-receptor tyrosine kinase Src (reviewed in [11]). Induction of these molecules through β1 integrin can mediate cellular proliferation and motility through the activation of mitogen activated protein kinase (MAPK), phosphatidylinositol 3-kinase (PI3-K), or RhoA GTPase [12,13]. The cytoplasmic region of the α2 integrin subunit can also promote RhoA activation and cell spreading suggesting that both integrin subunits contribute to outside-in signal transduction [14–16]. We have shown that collagen I binding to α2β1 activates the monomeric G-protein RhoC GTPase [17] resulting in PCa cell invasion and migration. Thus, integrin α2β1 can activate multiple signal transduction pathways which may support tumor cell invasion and metastasis.

Published data support a role for α2β1 in the metastasis of PCa cells to the skeleton. For example, antibodies to α2β1 were found to block the attachment of PC-3 PCa to bone matrix [18] whereas treatment with Transforming Growth Factor β1 [19] or osteoblast conditioned medium [20] enhanced α2β1 synthesis and adhesion to collagen I. We have demonstrated that the ability to bind collagen I is a characteristic of PCa cells isolated from bone vs. soft tissue metastases [21]. To examine the relationship between collagen I adhesion and bone metastatic potential, a collagen I binding variant of human LNCaP PCa cells was derived through serial passage on collagen I. These cells, LNCaPcol, displayed a 51% increase in the surface expression of α2β1, bound tightly to collagen I, and were stimulated to invade through collagen I in a α2β1 integrin-dependent manner [21]. When injected directly into the bone, the collagen I binding LNCaPcol cells had an increased ability to form osseous lesions compared non-collagen binding LNCaP cells [21]. These data demonstrated that an enhanced ability to bind to collagen I can promote PCa establishment within the bone but does not provide direct evidence that α2β1 expression or signaling mediates PCa bone metastasis. We therefore queried whether α2β1 integrin is a potential mediator of skeletal metastasis. Herein we provide evidence that bone metastases from PCa patients express elevated levels of α2β1 compared to soft tissue metastases. Further, the selective knock-down of the α2 subunit in metastatic PCa cells not only blocked the ability of PCa cells to bind to or migrate towards collagen I in vitro but also reduced the capability of cells to grow within the bone. These data support the hypothesis that α2β1 integrin is needed for the efficient metastasis of PCa cells to the skeleton.

Materials and Methods

Cells

Human LNCaP PCa cells were obtained from the American Type Culture Collection (Rockville, MD) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum and lx penicillin-streptomycin (Invitrogen, Carlsbad, CA). The isogenic variant LNCaPcol PCa cells were derived from LNCaP cells through in vitro panning on collagen I as previously described [21]. Both cell lines were engineered to over-express the gene for firefly luciferase through transduction with commercially available lentiviral transduction particles (GenTarget, San Diego, CA). Stable pools of luciferase+/RFP+ positive cells were selected through treatment with 50 µg/ml blasticidin. All cells were shown to be free of Mycoplasma by the PlasmTest mycoplasma detection method (Invivogen, San Diego, CA).

Generation of α2 integrin cDNA and shRNA transduced cells

The pLenti6- α2 plasmid containing the full-length cDNA for human α2 integrin was the kind gift of Mary Zutter (Vanderbilt University, Nashville, TN). The expression cassette was excised from the plasmid following digestion with SpeI/XhoI and subcloned into the pLenti4/TO/V5-DEST vector (Invitrogen, Carlsbad, CA). Transduction particles were then prepared using the Virapower lentiviral expression system and used to transduce LNCaP-luc PCa cells. Stable pools of luciferase+/RFP+/α2+ cells were selected with 50 µg/ml blasticidin and 100 µg/ml zeocin (Invitrogen). LNCaP-luc cells transduced with the empty pLenti4 vector served as a control for α2 enforced expression. To achieve α2 knock-down, the α2-specific shRNA set in pLKO was purchased from Sigma-Aldrich (St. Louis, MO). Plasmids were packaged into virus particles according to manufacturer’s instructions and used to transduce LNCaPcol-luc cells. Stable pools were selected with 50 µg/ml blasticidin and 1 µg/ml puromycin (Invivogen, San Diego, CA). Cells transduced with a non-targeting shRNA served as a control for α2 shRNA expression.

Characterization of α2 integrin expression

The cell surface expression of α2 protein was determined by flow cytometry. Briefly, 2×105 PCa cells were incubated with a FITC conjugated antisera to integrin a2 (clone, AK-7, BD Bioscience, San Jose, CA) or IgG1κ isotype control for 30 minutes at 4°C. Labeled cells were washed, and evaluated on a Coulter FACS Scan flow cytometer (Beckman-Coulter, Fullerton, CA). Analysis of the surface expression of integrin subunits on, α3, α5, α6, β1, and α v β3 were conducted as above following incubation with the proceeding purified antibodies and a FITC-conjugated secondary antibody [on, clone SR84; α3, clone C3 II1; α5, clone IIA1; α6, clone GoH3; β1, clone MAR4; αvβ3 clone 23C6, and FITC anti-mouse IgG each from BD Bioscience, San Jose, CA].

The expression of α2β1 mRNA was measured by quantitative PCR. Total RNA was isolated using the RNAeasy kit (Qiagen, Valencia, CA) and 1 µg RNA reverse transcribed using the reverse transcription kit (Promega, Madison, WI). Integrin α2 and β1 specific transcripts were measured on a Roche Lightcycler 480 as previously described [22]. The primers used were as follows: ITGA2–1131F 5’ GGGCATTGAAAACACTCGAT 3’; ITGA2–1966R 5’ TCGGATCCCAAGATTTTCTG 3’; β-actin-736F 5’ GGACTTCGAGCAAGAGATGG 3’; β-actin-969R 5’ AGCACTGTGTTGGCGTACAG 3’; ITGB1 2054F 5’ CATCTGCGAGTGTGGTGTCT 3’; ITGB1 2262R 5’ GGGGTAATTTGTCCCGACTT 3’.

In vitro characterization of α2β1 integrin function

In vitro assays to measure attachment, proliferation, and migration of α2 transduced cells were performed as described previously [21].

Intratibial injection

Tumor cells (5×105 cells/50 µl) were injected into the tibia of male SCID mice at 7–8 weeks of age as described previously [21]. Tumors were allowed to grow for 9 weeks. Tumor burden was measured by bioluminescent imaging using a Xenogen IVIS imaging system (Xenogen Corporation, Alameda, CA). Animals were then evaluated using Faxitron radiography (Faxitron x-ray Corp, Wheeling, IL). Injected tibiae and contralateral tibiae without tumors were removed and processed for histology as previously described [21].

Intracardiac experimental metastasis model

Male SCID mice at 7–8 weeks of age were injected into the left cardiac ventricle as previously described [23,24]. Nine weeks post tumor cell injection, tumor burden was measured by bioluminescent imaging using a Xenogen IVIS imaging system (Xenogen Corporation,Alameda, CA). Based on our BLI analysis, the liver and mandible were removed from each animal and processed for histology as previously described [21].

cDNA microarray analysis

The ONCOMINE database and gene microarray analysis tool, a repository for published cDNA microarray data (http://141.214.6.50/oncomine/main/index.jsp), was explored for mRNA expression of ITGA2 in clinical cases of prostate cancer. Statistical analysis of differences was performed using ONCOMINE algorithms to account for the multiple comparisons among different studies as previously described [25].

Case Selection and Tissue Microarrays

Human primary and metastatic PCa tissues were obtained as part of the PCa research program and University of Washington Medical Center PCa Donor Rapid Autopsy Program. The radical prostatectomy TMA series consisted of 185 evaluable cores taken from 47 total patients; 66 cores of non-neoplastic prostate (from 30 cases), 43 cores of BPH (from 22 cases), and 76 cores of localized PCa (from 30 cases). The PCa metastasis arrays were constructed from soft tissue and bone metastases taken from 42 available autopsies [26]. The arrays comprised 293 evaluable cores of metastases of the liver (18 cases), lymph node (27 cases), and bone (38 cases). Clinical data relating to the 42 autopsy patients is described in [27]. The Institutional Review Board of the University of Washington Medical Center approved all procedures involving human subjects, and all subjects signed written informed consent.

Immunohistochemistry and Evaluation

Five micron sections were deparaffinized and rehydrated. Antigen retrieval was performed in 10 mM Tris buffer (pH 9.0) in a pressure cooker for ten minutes at 20 psi. The slides were then blocked with a 3% H2O2 solution followed by an avidin/biotin blocking solution (Vector Laboratories Inc.). After incubation with a 5% chicken/goat/horse serum solution, sections were incubated with mouse anti-human integrin α2 antibody (20 µg/mL; cat # MCA2025; AbD Serotec, Raleigh, NC) overnight at 4°C. Negative control slides were incubated with mouse anti-MOPC21 at the same concentration. All slides were then incubated with biotinylated anti-mouse Ab (BA-2000, Vector Laboratories Inc.), developed using the Vectastain ABC kit (Vector Laboratories Inc.) and stable DAB (Invitrogen Corp.). The slides were counterstained with hematoxylin, dehydrated, and mounted with Cytoseal XYL (Richard-Allan Scientific).

Staining intensity was scored by a genitor-urinary research pathologist (XY) as absent (no staining) [0], weak (faint or fine chromogen deposition) [1], or strong (clear and coarse granular chromogen deposition) [2] as previously described [28]. The percent of positive stained cells was determined from the entire tissue field. For each core, the integrin α2 protein expression index (EI), the product of staining intensity and the percentage of positive staining, was determined as described previously [29].

Statistical Analysis

A t-test was used to determine statistical significance between groups for continuous covariates. TMA staining intensity was analyzed using a stratified cumulative logistic model where the patient was the stratification factor. The stratification was needed to properly adjust for the correlation of multiple cores from each patient in the model. The type of disease in each core was the lone independent predictor in the model with odds ratios and associated Wald chi-square p-values reported. Analyses were completed using SAS 9.2 (SAS Institute, Cary, NC).

Results

Modulation of α2 integrin expression alters collagen I-stimulated attachment and migration

We previously demonstrated that LNCaP cells selected in vitro for the ability to bind type I collagen gain the capacity to grow within the bone [21]. Relative to LNCaP cells, these bone metastatic LNCaPcol PCa cells were found to have increased expression of the collagen I receptor integrin α2β1 compared to LNCaP cells suggesting that α2β1 mediated the formation of PCa bone lesions [21]. To ascertain the role α2β1 in PCa bone metastasis, integrin α2 was over-expressed in low-tumorigenic LNCaP PCa cells or selectively knocked-down in highly-metastatic LNCaPcol PCa cells. A stable pool transduced with small-hairpin RNA (shRNA) molecules that target position 1528 on α2 integrin reduced α2 RNA and protein expression 2.4-fold and 31% respectively compared to a non-targeting control shRNA transduced cell line (Figure 1 A and B). In contrast, the forced expression of α2 integrin cDNA increased α2 RNA and protein expression of 35-fold and 87% respectively compared to empty vector control transduced cells (Figure 1 D and E). The β1 integrin subunit was abundantly expressed on both LNCaP and LNCaPcol cell but its expression changed in relation to α2 expression such that it decreased 26% in α2 shRNA- transduced cells and increased 17% in α2 cDNA-transduced cells compared to the appropriate control cells (Figure 1 C and F). As the change in the β1 integrin subunit occurred without a corresponding change in β1 RNA transcripts (supplemental Figure 1H), the data support that LNCaP cells coordinate the cell surface expression of the α2 and β1 subunits at the post-transcriptional level.

Figure 1. Modulation of α2 integrin mRNA and protein following stable expression of specific shRNA oligonucleotides or α2 cDNA.

Figure 1

Open in a new tab

A, D) Quantitative PCR. Total RNA was isolated from stable pools of LNCaPcol-luc control shRNA-transduced, LNCaPcol-luc α2 integrin shRNA-transduced, LNCaP-luc empty vector-transduced, and LNCaP-luc α2 cDNA-transduced cells. The RNA was reverse transcribed and α2 integrin mRNA transcripts evaluated on a Roche LightCycler 480 according to manufacturer’s instructions. Shown is the mean ± the standard deviation of duplicate experiments, p<0.05 by t-test. B, C, E, F) Flow cytometry. The surface expression of the α2 and β1 integrin subunits was quantified using a Coulter FACS Scan flow cytometer following treatment of cells with α2 or β1 integrin-specific FITC-conjugated antibodies. Shown is a representative histogram of four independent experiments.

Despite the modest change in α2 integrin expression, shRNA mediated knock-down significantly diminished the ability of α2 integrin shRNA cells to bind to or migrate towards collagen I (Figure 2, A and B) consistent with our previous studies using α2 integrin neutralizing antibody [21]. Similarly, α2 integrin over-expressing cells acquired the ability to bind to and migrate towards collagen I relative to vector control cells (Figure 2, C and D). To confirm that the changes in collagen attachment and migration were a direct result of the modulation of α2 integrin expression, the surface expression of multiple integrin subunits, including α1, α3, α5, α6, and αvβ3, was evaluated by flow cytometry (supplemental Figure 1 A–G). The data show that only integrin α2β1 expression was altered following α2 modulation demonstrating that the changes in collagen I-directed attachment and migration were due to the engineered changes in α2 integrin. Consistent with these findings, altering the expression of α2 integrin did not significantly interfere with the ability of PCa cells to attach to fibronectin indicating that α2 modulation did not affect the expression or activity of other integrins. Taken together, the data show that α2β1 promotes the attachment and motility of human PCa cells in vitro suggesting a possible mechanism for the preferential invasion of PCa cells within the skeleton.

Figure 2. α2 integrin knock-down suppresses whereas α2 integrin over-expression increases collagen I-stimulated attachment and migration.

Figure 2

Open in a new tab

A, C) In vitro attachment assay. 1 × 104 fluorescently labeled cells were plated in triplicate to a 96 well plate that had been coated with 10 µg/ml protein. After 1 hour, the cells were washed and fluorescence measured. The percent specific binding was calculated by subtracting non-specific binding to plastic or control protein BSA. Shown is the mean ± the standard deviation of four separate experiments, p<0.05 by t-test. B, D) In vitro migration assay. 2.5 × 104 PCa cells in serum-free medium were plated to 3 mm tissue culture inserts and placed in wells containing 0 or 10 µg/ml collagen I. Following a 48 hour incubation, migrating cells were stained and the total number of migrating cells per five high power fields was quantified under 20× magnification. The data is presented as the mean ± standard deviation of duplicate well from a representative experiment, p<0.05 by t-test.

Blocking α2 integrin reduces PCa establishment within the bone

To determine whether α2β1 expression mediates PCa bone metastasis, α2 over-expressing or knock-down PCa cells were injected into the tibia of male SCID mice. When implanted into the bone, both control shRNA-transduced and α2 shRNA-transduced LNCaPcol cells produced radiologic and histologic bone lesions with equal incidence (100% in each case). However, mice injected with α2 integrin knock-down cells displayed a 3.2-fold or 69% decrease in osseous tumor burden, as measured by bioluminescence imaging, compared to control shRNA transduced cells (Figure 3A and supplemental Figure 2). The decrease in tumor burden following α2β1 knock-down was likely not a result of decreased PCa cell growth in that α2 shRNA-transduced cells were found to have equivalent attachment-dependent growth rates compared to control shRNA-transduced cells on plastic or collagen I (supplemental Figure 3) consistent with our published report [21]. The over-expression of α2 integrin in low-metastatic LNCaP cells increased intra-osseous tumor burden by 20% compared to vector control cells without affecting tumor incidence; however, this change was not statistically significant (Figure 3B). Taken together, these data suggest that α2β1 expression is necessary for the formation of PCa bone lesions but is not itself sufficient to confer this ability to low-tumorigenic LNCaP cells.

Figure 3. Blocking α2integrin reduces PCa establishment within the bone.

Figure 3

Open in a new tab

A) Intratibial injection. Control shRNA-transduced or α2 integrin shRNA-transduced LNCaPcol-luc cells (5×105 cells/50 µl) were directly injected into the right proximal tibia of anesthetized male SCID mice. Tumors were allowed to grow for 9 weeks. Tumor burden was measured using bioluminescent imaging following the injection of luciferin. The data are presented as mean number of photons/sec ± the standard error, 12 mice/group. *p<0.05 compared to control shRNA transduced cells by t-test. B) Intratibial injection. LNCaP-luc empty vector-transduced or LNCaP-luc α2 cDNA-transduced cells were injected as described in A. The data are presented as mean number of photons/sec ± the standard error, 12 mice/group. C) Intracardiac injection. Control shRNA-transduced or α2 integrin shRNA-transduced LNCaPcol-luc cells were injected into the left cardiac ventricle (2×105 cells/0.1 ml) to establish bone metastases. Tumor burden was measured after 9 weeks using bioluminescent imaging following the injection of luciferin. Shown is the mean number of photons/sec ± the standard error of hepatic or skeletal metastases.

We have previously published that collagen I binding to α2β1 increased the activation of RhoC GTPase which may facilitate PCa cell dissemination to the skeleton where collagen I is in abundance [17]. To assess the role of α2β1 expression on PCa cell dissemination, α2 integrin knock-down or control cells were injected into the left cardiac ventricle of SCID mice to allow systemic delivery of tumor cells. The data show that the intracardiac injection of control shRNA cells produced metastases within the liver and/or mandible in 73% (8/11) of the mice. In contrast, mice injected with α2 knock-down cells developed metastases at these sites in only 9% (1/11) of the mice, p=0.0075 compared to control shRNA injected mice by Fisher’s exact test. Consistent with the results obtained following intratibial injection, animals injected with α2 knock-down cells had reduced tumor burden compared to control shRNA injected mice (Figure 3C, supplemental Figure 4), p<0.15. Collectively, these data support that α2β1 integrin is necessary but not sufficient for the establishment of PCa metastases within the bone.

Integrin α2β1 expression correlates with skeletal metastasis in PCa patients

To investigate the clinical significance of α2β1 expression in PCa skeletal metastasis, the Oncomine cDNA microarray repository was explored for differences in α2 integrin gene expression among PCa metastases. Results from two separate studies demonstrated an increase in the expression of α2 integrin within PCa skeletal metastases compared to PCa soft tissue lesions, particularly lymph node metastases (Figure 4A) [30,31]. Further, the expression of α2 integrin message was either equivalent or greater than that expressed within PCa primary lesions suggesting that α2 integrin may have a mechanistic role in promoting PCa metastasis to the skeleton (Figure 4A). To examine whether α2 integrin correlates with PCa skeletal metastasis in human patients, the protein expression of α2 β1 integrin was evaluated retrospectively in tissue microarrays (TMAs) constructed from prostatic tissues including non-neoplastic prostate, benign prostatic hyperplasia (BPH), primary PCa, and PCa soft tissue and bone metastases. For each core, the staining intensity (absent, weak, or strong) and the percent of cells expressing α2β1 were determined by a genito-urinary research pathologist. A composite expression index was also calculated which was equal to the product of the staining intensity and percent expression in each core. The data show that the mean α2β1 expression index was increased in PCa skeletal metastases compared to either PCa primary lesions or soft tissue metastases of the liver or lymph node (Figure 4B, Supplemental Figure 5) consistent with the Oncomine data. Analysis of α2β1 staining intensity alone revealed that bone metastases had the highest percent of strong staining samples compared to soft tissue metastases, particularly lymph node metastases (Figure 4C). Using a cumulative logistic model to model the intensity scores between tissue types, lymph node metastases had odds of weaker staining 2.3 times that of bone metastases [Wald confidence limits (1.02, 5.22), p-value, 0.042]. Taken together, these data show that α2 integrin is frequently over-expressed in PCa skeletal metastases compared to soft tissue metastases.

Figure 4. Integrin α2β1expression correlates with skeletal metastasis in PCa patients.

Figure 4

Open in a new tab

A) α2 RNA expression within human PCa metastases. The ONCOMINE gene microarray database [25] was explored for differences in α2 integrin mRNA expression between human PCa soft tissue or skeletal metastases. See inset image for graph key. B & C) Analysis of α2 integrin protein expression in prostatic tissues. Tissue microarrays constructed from samples of non-neoplastic prostate tissue, BPH, primary PCa lesions, and soft tissue and skeletal metastases were stained for α2 integrin expression using routine immunohistochemistry as outlined in the Methods section. B) Plot of the mean ± the 95% confidence limits of α2 integrin expression index vs. tissue type. C) Plot of α2 integrin staining intensity from Figure 4B. Shown is the percent of positive cores with each intensity - absent, weak, or strong. Wald chi-square p<0.042 bone vs. lymph node metastasis.

Our analysis of α2β1 integrin expression on prostatic tissues further revealed that α2β1 protein was highly expressed within normal and benign prostatic hyperplasia samples to a level equivalent to skeletal metastases (Figure 4B & C). The data show that α2β1 expression was decreased in primary PCa lesions compared to normal and benign tissues and was further diminished in PCa soft tissue metastases of the lymph node. The expression of α2β1 within skeletal metastases was increased relative PCa primary lesions and soft tissue metastases back to levels found in non-neoplastic prostate tissue. These data support that integrin α2β1 may have different roles during PCa development and progression that are dependent on the tumor microenvironment.

Discussion

Studies of men with PCa who have a rising PSA, despite androgen deprivation therapy, but no radiographic evidence of metastases indicate that nearly one half of patients will develop skeletal metastases within two years, whereas greater than 80% of all men who die of PCa will be found to have metastatic disease within the skeleton at autopsy [3,4]. Although our knowledge of PCa biology has increased significantly, the mechanism(s) that promote PCa metastasis to the skeleton remain unclear. We and others have published several lines of evidence which suggest that colonization of the skeleton is promoted by collagen type I, the most abundant protein within the bone. Specifically, we have shown that PCa cells selected for collagen I binding become more invasive in vitro and acquire the capacity to grow within the bone compared to non-collagen binding parental cells [21]. In the present study, we demonstrate that the collagen I receptor, α2β1, is necessary but not sufficient for the establishment of PCa metastases within the bone. We further document that α2β1 integrin is frequently over-expressed in PCa skeletal metastases compared to soft tissue metastases suggesting that α2β1 is needed for the efficient metastasis of PCa cells to the skeleton.

Our hypothesis that α2β1 facilitates skeletal metastasis is supported by published evidence which shows that collagen I/α2β1 promote an invasive phenotype in multiple cell types. For example, both intact collagen I and collagen-derived fragments, such as the trimeric form of the carboxyl propeptide, were shown to be potent chemotactic factors for tumor cells and endothelial cells in in vitro migration assays [32,33]. We and others have further shown that integrin α2β1 directs the in vitro attachment to and migration towards collagen I in multiple cancer types including prostate carcinoma, ovarian carcinoma, pancreatic adenocarcinoma, rhabdomyosarcoma, and osteosarcoma [34–36,21,37,38]. Consistent with these observations, the over-expression of α2 integrin accelerated the experimental metastasis of melanoma and rhabdomyosarcoma cells [34,39] whereas α2β1 blockade using neutralizing antibodies reduced tumor dissemination to the liver or lymph node in animal models of melanoma, gastric cancer, and colon cancer [40,41,39]. Our analysis of PCa skeletal metastasis support and extend these observations by demonstrating that α2β1 integrin is necessary but not sufficient for the establishment of PCa metastases within the skeleton.

Whether α2β1 promotes PCa skeletal metastasis in human patients has yet to be proven, however, our TMA data which showed that α2β1 was elevated in osseous vs. visceral metastases of men who died of PCa suggests a role for α2β1 in PCa bone metastasis. These data are consistent with a recent published study of α2β1 protein expression in primary PCa tissues which showed that the percent of α2β1 positive cells in the primary tumor was associated with local invasion and bone metastasis [42]. Further, α2β1 integrin has been identified as a marker of both prostate stem cells and PCa stem cells/tumor initiating cells [43,44]. Correspondingly, the percentage of stem cell-like PCa cells within the prostate was found to have a prognostic impact on the risk of skeletal metastasis [42]. However, a recently published Oncomine survey found that α2β1 expression decreased progressively in PCa primary lesions and metastases compared to non-neoplastic tissue suggesting that α2β1 is a metastasis suppressor in PCa [45]. Although our data support that α2β1 facilitates metastasis in PCa, it is possible that the expression of α2β1 is decreased in primary PCa compared to normal prostate tissue. Immunohistochemical analysis of α2β1 expression in prostatectomy samples and metastases by Bankhoff et al, as well as our own studies, demonstrated that α2β1 expression was decreased in primary lesions vs. normal tissues but was increased in metastases vs. the primary lesion [46]. These observations suggest that α2β1 expression is biphasic during PCa development and progression [47]. It is therefore plausible that during tumor development, α2β1 expression may be reduced in primary PCa cells to promote dissemination but the integrin is re-expressed in circulating tumor cells or is induced in disseminated tumor cells by collagen-rich environments such as the bone to promote metastasis.

A permissive microenvironment is required for successful metastasis (reviewed in [48]). The extracellular matrix is a major component of the microenvironment and may promote tumor development and progression. For example, the presence of a fibrotic, reactive stroma in primary lesions was shown to be associated with shortened biochemical-free recurrence in men with PCa [49]. In human breast cancer, women with high breast density, characterized by enriched stromal collagen I, were at increased risk for local recurrence [50] where patients with fibrotic foci of the breast had a higher risk of developing bone and lymph node metastasis [51]. In preclinical models, the over-expression of collagen I in MMTV transgenic mice accelerated mammary tumor initiation and progression compared to MMTV wild-type mice whereas the induction of fibrosis in the lung through the expression of TGFβ1 was found to enhance the experimental metastasis of indolent mammary tumor cells [52,53]. Collectively, the data show that a collagen-rich, fibrotic environment contributes to tumor initiation and metastasis.

In summary, we demonstrated that α2β1 integrin mediates PCa migration towards collagen I and that its expression is necessary but not sufficient for the establishment of PCa metastases within the bone. We further document that α2β1 is frequently over-expressed in PCa skeletal metastases compared to soft tissue metastases from PCa patients. These data support a model in which collagen I/α2β1 promote a metastatic phenotype in PCa cells to mediate the preferential metastasis of PCa cells to the skeleton. These studies provide a strong rationale for the development of α2β1 as a therapeutic target for the treatment of PCa skeletal metastases and thus have the potential to reduce both the incidence and mortality associated with metastatic PCa.

Supplementary Material

1
2
3
4
5
6

Acknowledgements

We would like to thank the patients and their families who were willing to participate in the Prostate Cancer Donor Program at the University of Washington. We would also like to acknowledge Dr. Celestia Higano, Martine Roudier, Lawrence True, Paul Lange, Bruce Montgomery, Peter Nelson, and Robert Vessella. The Prostate Cancer Donor Program is supported by the Pacific Northwest Prostate Cancer SPORE (P50CA97186), the PO1 NIH grant (PO1CA085859), and the Richard M. LUCAS Foundation.

Supported in part by grants from the Department of Defense (PC094375) to CLH and the National Institutes of Health (UL1RR024986).

References

  • 1.Cancer Facts and Figures. Atlanta: American Cancer Society; 2012. [Google Scholar]
  • 2.Hall CL, Kang S, MacDougald OA, Keller ET. Role of Wnts in prostate cancer bone metastases. J Cell Biochem. 2006;97(4):661–672. doi: 10.1002/jcb.20735. [DOI] [PubMed] [Google Scholar]
  • 3.Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, Gasser TC, Mihatsch MJ. Metastatic patterns of prostate cancer: an autopsy study of 1,589 patients. Hum Pathol. 2000;31(5):578–583. doi: 10.1053/hp.2000.6698. [DOI] [PubMed] [Google Scholar]
  • 4.Smith MR, Cook R, Lee KA, Nelson JB. Disease and host characteristics as predictors of time to first bone metastasis and death in men with progressive castration-resistant nonmetastatic prostate cancer. Cancer. 2011;117(10):2077–2085. doi: 10.1002/cncr.25762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Buckwalter JA, Glimcher MJ, Cooper RR, Recker R. Bone biology. I: Structure, blood supply, cells, matrix, and mineralization. Instr Course Lect. 1996;45:371–386. [PubMed] [Google Scholar]
  • 6.Felding-Habermann B. Integrin adhesion receptors in tumor metastasis. Clin Exp Metastasis. 2003;20(3):203–213. doi: 10.1023/a:1022983000355. [DOI] [PubMed] [Google Scholar]
  • 7.Leitinger B, Hohenester E. Mammalian collagen receptors. Matrix Biol. 2007;26(3):146–155. doi: 10.1016/j.matbio.2006.10.007. [DOI] [PubMed] [Google Scholar]
  • 8.Gullberg D, Gehlsen KR, Turner DC, Ahlen K, Zijenah LS, Barnes MJ, Rubin K. Analysis of alpha 1 beta 1, alpha 2 beta 1 and alpha 3 beta 1 integrins in cell--collagen interactions: identification of conformation dependent alpha 1 beta 1 binding sites in collagen type I. EMBO J. 1992;11(11):3865–3873. doi: 10.1002/j.1460-2075.1992.tb05479.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kern A, Eble J, Golbik R, Kuhn K. Interaction of type IV collagen with the isolated integrins alpha 1 beta 1 and alpha 2 beta 1. Eur J Biochem. 1993;215(1):151–159. doi: 10.1111/j.1432-1033.1993.tb18017.x. [DOI] [PubMed] [Google Scholar]
  • 10.Knight CG, Morton LF, Peachey AR, Tuckwell DS, Farndale RW, Barnes MJ. The collagen-binding A-domains of integrins alpha(1)beta(1) and alpha(2)beta(1) recognize the same specific amino acid sequence, GFOGER, in native (triple-helical) collagens. J Biol Chem. 2000;275(1):35–40. doi: 10.1074/jbc.275.1.35. [DOI] [PubMed] [Google Scholar]
  • 11.Miranti CK, Brugge JS. Sensing the environment: a historical perspective on integrin signal transduction. Nat Cell Biol. 2002;4(4):E83–E90. doi: 10.1038/ncb0402-e83. [DOI] [PubMed] [Google Scholar]
  • 12.Longhurst CM, Jennings LK. Integrin-mediated signal transduction. Cell Mol Life Sci. 1998;54(6):514–526. doi: 10.1007/s000180050180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Slack-Davis JK, Parsons JT. Emerging views of integrin signaling: implications for prostate cancer. J Cell Biochem. 2004;91(1):41–46. doi: 10.1002/jcb.10665. [DOI] [PubMed] [Google Scholar]
  • 14.Evers EE, van der Kammen RA, ten Klooster JP, Collard JG. Rho-like GTPases in tumor cell invasion. Methods Enzymol. 2000;325:403–415. doi: 10.1016/s0076-6879(00)25461-x. [DOI] [PubMed] [Google Scholar]
  • 15.Keely P, Parise L, Juliano R. Integrins and GTPases in tumour cell growth, motility and invasion. Trends Cell Biol. 1998;8(3):101–106. doi: 10.1016/s0962-8924(97)01219-1. [DOI] [PubMed] [Google Scholar]
  • 16.Price LS, Collard JG. Regulation of the cytoskeleton by Rho-family GTPases: implications for tumour cell invasion. Semin Cancer Biol. 2001;11(2):167–173. doi: 10.1006/scbi.2000.0367. [DOI] [PubMed] [Google Scholar]
  • 17.Hall CL, Dubyk CW, Riesenberger TA, Shein D, Keller ET, van Golen KL. Type I collagen receptor (alpha2beta1) signaling promotes prostate cancer invasion through RhoC GTPase. Neoplasia. 2008;10(8):797–803. doi: 10.1593/neo.08380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kostenuik PJ, Sanchez-Sweatman O, Orr FW, Singh G. Bone cell matrix promotes the adhesion of human prostatic carcinoma cells via the alpha 2 beta 1 integrin. Clin Exp Metastasis. 1996;14(1):19–26. doi: 10.1007/BF00157682. [DOI] [PubMed] [Google Scholar]
  • 19.Kostenuik PJ, Singh G, Orr FW. Transforming growth factor beta upregulates the integrin-mediated adhesion of human prostatic carcinoma cells to type I collagen. Clin Exp Metastasis. 1997;15(1):41–52. doi: 10.1023/a:1018484323210. [DOI] [PubMed] [Google Scholar]
  • 20.Knerr K, Ackermann K, Neidhart T, Pyerin W. Bone metastasis: Osteoblasts affect growth and adhesion regulons in prostate tumor cells and provoke osteomimicry. Int J Cancer. 2004;111(1):152–159. doi: 10.1002/ijc.20223. [DOI] [PubMed] [Google Scholar]
  • 21.Hall CL, Dai J, van Golen KL, Keller ET, Long MW. Type I Collagen Receptor ({alpha}2{beta}1) Signaling Promotes the Growth of Human Prostate Cancer Cells within the Bone. Cancer Res. 2006;66(17):8648–8654. doi: 10.1158/0008-5472.CAN-06-1544. [DOI] [PubMed] [Google Scholar]
  • 22.Dai J, Hall CL, Escara-Wilke J, Mizokami A, Keller JM, Keller ET. Prostate cancer induces bone metastasis through Wnt-induced bone morphogenetic protein-dependent and independent mechanisms. Cancer Res. 2008;68(14):5785–5794. doi: 10.1158/0008-5472.CAN-07-6541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sun YX, Schneider A, Jung Y, Wang J, Dai J, Cook K, Osman NI, Koh-Paige AJ, Shim H, Pienta KJ, Keller ET, McCauley LK, Taichman RS. Skeletal localization and neutralization of the SDF-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and growth in osseous sites in vivo. J Bone Miner Res. 2005;20(2):318–329. doi: 10.1359/JBMR.041109. [DOI] [PubMed] [Google Scholar]
  • 24.Zhang J, Lu Y, Dai J, Yao Z, Kitazawa R, Kitazawa S, Zhao X, Hall DE, Pienta KJ, Keller ET. In vivo real-time imaging of TGF-beta-induced transcriptional activation of the RANK ligand gene promoter in intraosseous prostate cancer. Prostate. 2004;59(4):360–369. doi: 10.1002/pros.20019. [DOI] [PubMed] [Google Scholar]
  • 25.Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM. ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia. 2004;6(1):1–6. doi: 10.1016/s1476-5586(04)80047-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Roudier MP, True LD, Higano CS, Vesselle H, Ellis W, Lange P, Vessella RL. Phenotypic heterogeneity of end-stage prostate carcinoma metastatic to bone. Hum Pathol. 2003;34(7):646–653. doi: 10.1016/s0046-8177(03)00190-4. [DOI] [PubMed] [Google Scholar]
  • 27.Zhang X, Morrissey C, Sun S, Ketchandji M, Nelson PS, True LD, Vakar-Lopez F, Vessella RL, Plymate SR. Androgen receptor variants occur frequently in castration resistant prostate cancer metastases. PLoS One. 2011;6(11):e27970. doi: 10.1371/journal.pone.0027970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hall CL, Daignault SD, Shah RB, Pienta KJ, Keller ET. Dickkopf-1 expression increases early in prostate cancer development and decreases during progression from primary tumor to metastasis. Prostate. 2008;68(13):1396–1404. doi: 10.1002/pros.20805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yu J, Cao Q, Mehra R, Laxman B, Tomlins SA, Creighton CJ, Dhanasekaran SM, Shen R, Chen G, Morris DS, Marquez VE, Shah RB, Ghosh D, Varambally S, Chinnaiyan AM. Integrative genomics analysis reveals silencing of beta-adrenergic signaling by polycomb in prostate cancer. Cancer Cell. 2007;12(5):419–431. doi: 10.1016/j.ccr.2007.10.016. [DOI] [PubMed] [Google Scholar]
  • 30.LaTulippe E, Satagopan J, Smith A, Scher H, Scardino P, Reuter V, Gerald WL. Comprehensive gene expression analysis of prostate cancer reveals distinct transcriptional programs associated with metastatic disease. Cancer Res. 2002;62(15):4499–4506. [PubMed] [Google Scholar]
  • 31.Tamura K, Furihata M, Tsunoda T, Ashida S, Takata R, Obara W, Yoshioka H, Daigo Y, Nasu Y, Kumon H, Konaka H, Namiki M, Tozawa K, Kohri K, Tanji N, Yokoyama M, Shimazui T, Akaza H, Mizutani Y, Miki T, Fujioka T, Shuin T, Nakamura Y, Nakagawa H. Molecular features of hormone-refractory prostate cancer cells by genome-wide gene expression profiles. Cancer Res. 2007;67(11):5117–5125. doi: 10.1158/0008-5472.CAN-06-4040. [DOI] [PubMed] [Google Scholar]
  • 32.Mundy GR, DeMartino S, Rowe DW. Collagen and collagen-derived fragments are chemotactic for tumor cells. J Clin Invest. 1981;68(4):1102–1105. doi: 10.1172/JCI110334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Palmieri D, Camardella L, Ulivi V, Guasco G, Manduca P. Trimer carboxyl propeptide of collagen I produced by mature osteoblasts is chemotactic for endothelial cells. J Biol Chem. 2000;275(42):32658–32663. doi: 10.1074/jbc.M002698200. [DOI] [PubMed] [Google Scholar]
  • 34.Chan BM, Matsuura N, Takada Y, Zetter BR, Hemler ME. In vitro and in vivo consequences of VLA-2 expression on rhabdomyosarcoma cells. Science. 1991;251(5001):1600–1602. doi: 10.1126/science.2011740. [DOI] [PubMed] [Google Scholar]
  • 35.Fishman DA, Kearns A, Chilukuri K, Bafetti LM, O'Toole EA, Georgacopoulos J, Ravosa MJ, Stack MS. Metastatic dissemination of human ovarian epithelial carcinoma is promoted by alpha2beta1-integrin-mediated interaction with type I collagen. Invasion Metastasis. 1998;18(1):15–26. doi: 10.1159/000024495. [DOI] [PubMed] [Google Scholar]
  • 36.Grzesiak JJ, Bouvet M. The alpha2beta1 integrin mediates the malignant phenotype on type I collagen in pancreatic cancer cell lines. Br J Cancer. 2006;94(9):1311–1319. doi: 10.1038/sj.bjc.6603088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Vihinen P, Riikonen T, Laine A, Heino J. Integrin alpha 2 beta 1 in tumorigenic human osteosarcoma cell lines regulates cell adhesion, migration, and invasion by interaction with type I collagen. Cell Growth Differ. 1996;7(4):439–447. [PubMed] [Google Scholar]
  • 38.Van Slambrouck S, Jenkins AR, Romero AE, Steelant WF. Reorganization of the integrin alpha2 subunit controls cell adhesion and cancer cell invasion in prostate cancer. Int J Oncol. 2009;34(6):1717–1726. doi: 10.3892/ijo_00000302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yoshimura KMK, Laird LS, Chia CY, Park JJ, Olino KL, Tsunedomi R, Harada T, Iizuka N, Hazama S, Kato Y, Keller JW, Thompson JM, Chang F, Romer LH, Jain A, Iacobuzio-Donahue C, Oka M, Pardoll DM, Schulick RD. Integrin alpha2 mediates selective metastasis to the liver. Cancer Res. 2009;69(18):7320–7328. doi: 10.1158/0008-5472.CAN-09-0315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.van der Bij GJ, Oosterling SJ, Bogels M, Bhoelan F, Fluitsma DM, Beelen RH, Meijer S, van Egmond M. Blocking alpha2 integrins on rat CC531s colon carcinoma cells prevents operation-induced augmentation of liver metastases outgrowth. Hepatology. 2008;47(2):532–543. doi: 10.1002/hep.22013. [DOI] [PubMed] [Google Scholar]
  • 41.Yamaguchi K, Ura H, Yasoshima T, Shishido T, Denno R, Hirata K. Establishment and characterization of a human gastric carcinoma cell line that is highly metastatic to lymph nodes. J Exp Clin Cancer Res. 2000;19(1):113–120. [PubMed] [Google Scholar]
  • 42.Colombel M, Eaton CL, Hamdy F, Ricci E, van der Pluijm G, Cecchini M, Mege-Lechevallier F, Clezardin P, Thalmann G. Increased expression of putative cancer stem cell markers in primary prostate cancer is associated with progression of bone metastases. Prostate. 2012;72:713–720. doi: 10.1002/pros.21473. [DOI] [PubMed] [Google Scholar]
  • 43.Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res. 2005;65(23):10946–10951. doi: 10.1158/0008-5472.CAN-05-2018. [DOI] [PubMed] [Google Scholar]
  • 44.Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression. J Cell Sci. 2001;114(Pt 21):3865–3872. doi: 10.1242/jcs.114.21.3865. [DOI] [PubMed] [Google Scholar]
  • 45.Ramirez NE, Zhang Z, Madamanchi A, Boyd KL, O'Rear LD, Nashabi A, Li Z, Dupont WD, Zijlstra A, Zutter MM. The alpha(2)beta(1) integrin is a metastasis suppressor in mouse models and human cancer. J Clin Invest. 2011;121(1):226–237. doi: 10.1172/JCI42328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bonkhoff H, Stein U, Remberger K. Differential expression of alpha 6 and alpha 2 very late antigen integrins in the normal, hyperplastic, and neoplastic prostate: simultaneous demonstration of cell surface receptors and their extracellular ligands. Hum Pathol. 1993;24(3):243–248. doi: 10.1016/0046-8177(93)90033-d. [DOI] [PubMed] [Google Scholar]
  • 47.Eaton CL, Colombel M, van der Pluijm G, Cecchini M, Wetterwald A, Lippitt J, Rehman I, Hamdy F, Thalman G. Evaluation of the frequency of putative prostate cancer stem cells in primary and metastatic prostate cancer. Prostate. 2010;70(8):875–882. doi: 10.1002/pros.21121. [DOI] [PubMed] [Google Scholar]
  • 48.Langley RR, Fidler IJ. The seed and soil hypothesis revisited--the role of tumor-stroma interactions in metastasis to different organs. Int J Cancer. 2011;128(11):2527–2535. doi: 10.1002/ijc.26031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Ayala G, Tuxhorn JA, Wheeler TM, Frolov A, Scardino PT, Ohori M, Wheeler M, Spitler J, Rowley DR. Reactive stroma as a predictor of biochemical-free recurrence in prostate cancer. Clin Cancer Res. 2003;9(13):4792–4801. [PubMed] [Google Scholar]
  • 50.Park CC, Rembert J, Chew K, Moore D, Kerlikowske K. High mammographic breast density is independent predictor of local but not distant recurrence after lumpectomy and radiotherapy for invasive breast cancer. Int J Radiat Oncol Biol Phys. 2009;73(1):75–79. doi: 10.1016/j.ijrobp.2008.04.007. [DOI] [PubMed] [Google Scholar]
  • 51.Hasebe T, Sasaki S, Imoto S, Mukai K, Yokose T, Ochiai A. Prognostic Significance of Fibrotic Focus in Invasive Ductal Carcinoma of the Breast: A Prospective Observational Study. Mod Pathol. 2002;15(5):502–516. doi: 10.1038/modpathol.3880555. [DOI] [PubMed] [Google Scholar]
  • 52.Barkan D, El Touny LH, Michalowski AM, Smith JA, Chu I, Davis AS, Webster JD, Hoover S, Simpson RM, Gauldie J, Green JE. Metastatic growth from dormant cells induced by a col-I-enriched fibrotic environment. Cancer Res. 2010;70(14):5706–5716. doi: 10.1158/0008-5472.CAN-09-2356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Provenzano PP, Inman DR, Eliceiri KW, Knittel JG, Yan L, Rueden CT, White JG, Keely PJ. Collagen density promotes mammary tumor initiation and progression. BMC Med. 2008;6:11. doi: 10.1186/1741-7015-6-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS494211-supplement-1.pdf (52.4KB, pdf)
2
NIHMS494211-supplement-2.pdf (65.9KB, pdf)
3
NIHMS494211-supplement-3.pdf (165.7KB, pdf)
4
NIHMS494211-supplement-4.pdf (17.2KB, pdf)
5
NIHMS494211-supplement-5.pdf (142.1KB, pdf)
6
NIHMS494211-supplement-6.pdf (362.9KB, pdf)

RESOURCES