Skip to main content
NCBI home page
Hippokratia logoLink to Hippokratia
. 2012 Jul-Sep;16(3):217–220.

Association of tumor necrosis factor-α gene polymorphism (-308) and obstructive sleep apnea-hypopnea syndrome

P Almpanidou 1, G Hadjigeorgiou 1, K Gourgoulianis 2, A Papadimitriou 1
PMCID: PMC3738726  PMID: 23935286

Abstract

Background and Aim:Elevated serum tumor necrosis factor-α (TNF-α) concentra­tion and a polymorphism of the TNF-α gene at the position –308 in the promoter region are associated with obstructive sleep apnea-hypopnea syndrome (OSAHS). We aimed to determine the association of this polymorphism with OSAHS in Greek patients.

Patients and Methods:A blood sample was obtained from 220 patients clinicaly diagnosed with OSAHS and 319 normal controls. TNF-α genotype was determined from nucleus-containing cells from whole blood using a PCR method.

Results: The results demonstrated that the distribution of alleles was significantly dif­ferent when comparing the OSAHS patients group to the healthy controls. The appearance of AA (p=0.04) and AG (p<0.001) genotypes was significantly greater in OSAHS patients (8.6% and 32.7%, respectively) compared to the healthy control group (4.4% and 26.3%, respectively). Correspondingly, the appearance of the GG genotype was significantly lower in OSAHS patients compared to healthy controls (53.6% vs 69.3%). The A and G allele appeared at a frequency of 27.5% and 72.5% respectively in the OSAHS groups, and 17.6% and 82.4% in the control group respectively.

Conclusions: The distribution of genotypes and alleles of the single nucleotide polymorphism of TNF-α (-308) of OSAHS patients varies from healthy controls.

Keywords: genetics, TNF-α, sleep apnea

Obstructive sleep apnea-hypopnea syndrome (OSAHS) was first described in the scientific literature by Broadbent1 in 1877 and since, the pathogenesis of the condition has been well described2. OSAHS affects 2-4% of middle-aged adults3,4. Anatomic predisposing factors to OSAHS include the upper airway anatomy5, lung volume6 and neck girth7, whilst gains in abdominal circumference over adult life is closely associated with sleep disordered breathing severity8. Furthermore, the pathogenesis of OSAHS could be contributed to physiological traits such as upper airway motor control9, ventilatory control stability and coordination10,11 and respiratory arousal threshold12.

Patients with OSAHS have been reported to have increased circulating TNF-α concentration in the morning13 and immediately after the first episode of obstructive apnea14. Furthermore, ex vivo lipopolysaccharide stimulation of human whole blood cell culture resulted in a greater TNF-α production in the blood derived from individuals that were homozygous for TNF -308G compared to blood derived from individuals that were heterozygous15. Increased production of TNF-α has been reported to be associated with a TNF-α gene polymorphism, consisting of a guanine (G allele)– adenine (A allele) interchange at the –308 position in the promoter region15,16. The aim of the current study was to determine the association of the G→A TNF-α polymorphism with OSAHS in Greek patients.

Materials and methods

Patients

Two hundred and twenty OSAHS patients and 319 healthy controls mathced for age, race and gender participated in this study. All patients were regional residents and had visited the Lung Clinic of the University Hospital of Larissa, during a 3-year period (2003-2006). A questionnaire reviewing sleep habits, symptoms, and medica­tions was completed before the night of the polysomnography. Daytime sleepiness was evaluated using the Epworth Sleepiness Scale (ESS). Measurements of body weight and height were done the night of the sleep study. Their condition was confirmed clinicaly by overnight polysomnography at the Sleep Centre of University Hospital of Larissa according to the apnea-hypopnea index (AHI). Controls were individuals living in the same geographical area and had been referred to the Lung Clinic by their physician to undergo an overnight polysomnography but where asymptomatic of OSAHS. Subject characteristics and AHI are presented in Table 1.

Table 1. Demographics and clinical characteristics of OSAHS patients and controls.

graphic file with name hippokratia-16-218-i001.jpg

Open in a new tab

M = male

F = female

ΑΗΙ = apnea-hypopnea index (arbitrary units)

ΒΜΙ = body mass index (kg/m2)

* t-test

** χ2

A single blood sample was collected from all individuals at 8 a.m. and was analysed for the TNF-α (-308) gene polymorphism.

Sleep study

Overnight polysomnography was recorded in all patients by a computerized system (Alice 4 Diagnostic Device OBS/G7829, Respironics) The AHI score was calculated as the number of apneas recorded per hour of sleep. AHI was defined as the total number of obstructive apneas (cessation of airflow for at least 10 s) and hypopneas (decrease of the airflow signal amplitude by at least 50% accompanied by oxyhemo­globin desaturation of at least 4% or by an arousal) per hour of sleep. OSAS was de­fined as the combination of an AHI of 5 or more events/h with daytime sleepiness. Patients with an AHI score >5 were considered OSAHS.

Genotyping

DNA was extracted from whole blood using the method described by Sambrook18, and the quality of DNA was confirmed by electrophoresis in agarose gel. The promoter region of the human TNF-α gene polymorphism (-308) was amplified using PCR with forward and fluorescent tagged reverse primers19 5'AGGCAATAGGTTTTGAOGGCCAT 3' and 5- TCCTCCCTGCTCCGATTCCG 3' in order to amplify a DNA fragment of 107 bp containing the variable nucleotide. This polymorphism consists of a guanine (G) to adenine (A) interchange. For restriction digestion, Ncol was added to samples. Digestion confirmed two alleles. G/G genotype gives two fragments of 87 bp and 20 bp, A/A genotype a single 107 bp fragment, and G/A genotype gives 107 bp, 87 bp and 20 bp.

Statistical analysis

Statistical analysis of the quantitative measures (age, BMI, and AHI) was conducted with a student's t-test. Statistical analysis of the qualitative measures (sex, hypertension, diabetes and number of smokers) was conducted by the use of the χ2 statistical test. Any correlation between the genotype and alleles was investigated with the χ2 statistical test, whereas the investigation of the presence of equilibrium was conducted with the exact χ2 test. Regression analysis was used in order to control for various factors (eg sex, age, etc) to calculate the odds ratio. All results are presented as mean (%) unless otherwise stated.

Results

According to the present study, OSAHS was present predominantly in males, with of male to female ratio of 9:1 (Table1). OSAHS patients have a BMI of 31.4 ± 5.24 kg•m2 compared to 29.6 ± 4.2 kg•m2 in the healthy controls (p<0.001), whereas almost 50% of the patient group were smokers compared to 35.5% of the healthy controls, a difference that was highly statistically significant (p<0.001, Table1).

Approximately 40% of the patients were hypertensive in comparison to only 14% of the healthy controls (p<0.001, Table1).

The distribution of the genotypes and the alleles of the TNF-α gene are presented in Τable 2. The TNF-α (-308 A/G) genotype distribution varied significantly between the patient and control groups as 8.6% of the OSAHS patients were AA homozygote's compared to the 4.1% of the control group (p=0.04). In addition, more OSAHS patients were heterozygote's compared to the control group (37.7% vs 24.8% respectively, p< 0.001) (Table 2 ).

Table 2. Polymorphism frequency in OSAHS patients and healthy controls.

graphic file with name hippokratia-16-219-i001.jpg

Open in a new tab

a Pearson χ2 analysis, ΑΑ vs AG/GG

b Pearson χ2 analysis ΑΑ/AG vs GG

c controlled for age, sex, diabetes mellitus, hypertension, smoking BMI with the use of regression analysis

The AA genotype and the A allele appeared more frequently in OSAHS patients com­pared to the controls (27.5% vs 17.5%, respectively; p=0.002), whereas the G allele appeared less frequently in the OSAHS patient group compared to the control group (72.5% vs 82.5%, respectively, p=0.002).

Our results show that patients with the AA genotype had an OR of 2.5 compared to the AG/GG genotypes (p=0.0012), which decreased if only 1 A allele was present (OR=1.8, p=0.001) and when comparing the presence of the A allele to the G allele (OR=1.7, p=0.001, Table 3). The results persisted when our data was controlled for age, sex, diabetes mellitus, hypertension, smoking and BMI, with the exception of the presence of 2 AA alleles (p=0.109). When controlling for all parameters mentioned above, with the exception of hypertension, the presence of the A allele, either alone or when 2 alleles were carried, the OR ranged from 1.9 to 2.8 (Table 3).

Table 3. Odds Ratio of the genotype effect in the OSAHS patients group for each allele and for the carriers of one or two alleles.

graphic file with name hippokratia-16-219-i002.jpg

Open in a new tab

* controlled for age, sex, diabetes mellitus, hypertension, smoking BMI with the use of regression analysis

Discussion

The demographic/clinical findings of this study support the evidence of previous studies in that OSAHS patients have a statistically significant greater BMI when com­pared to healthy controls13,20, and furthermore, OSAHS appears to be more frequent among smokers compared to non-smokers21. In addition, the results presented the positive correlation between the incidence of OSAHS and hypertension. Malhorta and White22 reported that males had a 2-3 times increased risk of developing OSAHS compared to females. In the current study the greater percentage of patients was male. Indeed, out of 220 patients only 10% (n=22) were female, indicating that males have a 9 times greater risk of presenting with OSAHS compared to females.

In the literature there is no clear consensus regarding whether OSAHS is hereditary23, however it has been shown that OSAHS may be caused by an inherited respiratory instability in sleep24.

Riha et al25 reported that the genotypes AA, AG and GG appeared in 7%, 43% and 51% respectively in OSAHS patients, whereas in the control group the distribution was 4%, 27% and 69% for the AA, AG and GG genotypes respectively. In the present study, the frequency of the A allele presentation was 27.5 %, almost identical to the findings of Riha et al (28%), and was by virtue mirrored in the frequency of presentation of the G allele (72.5% in the present study vs 72% in the study published by Riha et al25). Regression analysis of our results confirmed the correlation between the TNF-α gene polymorphism (-308) and the presence of OSAHS in our patient group (Table 2).

Our findings suggest that OSAHS patients with an AA homozygote genotype have a 2.5 times greater chance of presenting with OSAHS compared to individuals with an AG genotype. In addition, the chance of developing OSAHS appears to be independ­ent from other factors such as age, sex, diabetes mellitus, hypertension, smoking and BMI.

Regression analysis of our results showed that the (-308) TNF-α gene polymorphism affected mostly those who were not hypertensive (Table 3), indicating that hypertension in the presence of the (-308) TNF-α polymorphism may have a positive effect on the appearance of OSAHS. This result is in contradiction to the available literature regarding the correlation of hypertension with OSAHS26. Therefore further studies are required to confirm if there is an inverse correlation between OSAHS and hypertension in the presence of the (-308) TNF-α gene polymorphism.

The single nucleotide polymorphism G/A -308 of the TNF-α gene appears to cor­relate with other pathologies as well, i.e. the age of onset of Alzheimer's27, Crohn's disease28, pulmonary cancer29, T-cell large granular lymphocyte leukemia30, and the time of intensive unit stay after repair from an aortic aneurism31. In contrast, no cor­relation was observed between the increased presence of the A allele of the TNF-α (-308) gene and pathologies such as rheumatoid arthritis32, malignant melanoma33, chronic immune thrombocytopenic purpura34, bronchiolitis obliterans syndrome or survival after lung transplant35 or chronic obstructive pulmonary disease36.

A potential limitation of the present study was the fact that we did not take into consideration whether relatives existed within or between the patient and control groups. Due to the above, we were unable to investigate whether our results could be influenced by familial factors. The strengths of the present study are the number of people included in the patient and control groups and that all participants underwent a sleep study.

In conclusion, the present study has investigated for the first time a single nucleotide polymorphism of pre-inflammatory cytokines in a Greek population TNF-α (-308G/A). Furthermore, we demonstrated that the A allele correlates directly and independently to the incidence of OSAHS in Caucasians.

Conflict of interest

The authors declare no conflicts of interest.

References

  • 1.Broadbent WH. Cheyne-Stokes respiration in cerebral hemorrhage. Lancet. 1877;3:303–309. [Google Scholar]
  • 2.White DP. The pathogenesis of obstructive sleep apnea: Advances in the past 100 years. Am. J. Respir. Cell Mol. Biol. 2006;34:1–6. doi: 10.1165/rcmb.2005-0317OE. [DOI] [PubMed] [Google Scholar]
  • 3.Stradling JR, Crosby JH. Predictors and prevalence of obstructive sleep apnea and snoring in 1001 middle aged men. Thorax. 1991;46:85–90. doi: 10.1136/thx.46.2.85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Young T, Palta M, Dempsey J, Skatrud J, Weber S, Bard S. The occurrence of sleep-disordered breathing among middle-aged adults. N Engl Med. 1993;328:1230–1235. doi: 10.1056/NEJM199304293281704. [DOI] [PubMed] [Google Scholar]
  • 5.Isono S, Remmers JE, Tanaka A, Sho Y, Sato J, Nishino T. Anatomy of pharynx in patients with obstructive sleep apnea and in normal subjects. J Appl Physiol. 1997;82:1319–1326. doi: 10.1152/jappl.1997.82.4.1319. [DOI] [PubMed] [Google Scholar]
  • 6.Heinzer RC, Stanchina ML, Malhotra A, Fogel RB, Patel SR, Jordan AS, et al. Lung volume and continuous positive airway pressure requirement in obstructive sleep apnea. Am J Respir Crit Care Med. 2005;172:114–117. doi: 10.1164/rccm.200404-552OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hoffstein V, Szalai JP. Predictive value of clinical features in diagnosing obstructive sleep apnea. Sleep. 1993;16:18–22. [PubMed] [Google Scholar]
  • 8.Carmelli D, Swan GE, Bliwise DL. Relationship of 30-year changes in obesity to sleep-disordered breathing in the Western Collaborative Group Study. Obes Res. 2000;8:632–637. doi: 10.1038/oby.2000.81. [DOI] [PubMed] [Google Scholar]
  • 9.Mezzanotte WS, Tangel DJ, White DP. Waking genioglossal electromyogram in sleep apnea patients versus normal controls (a neuromuscular compensatory mechanism) J Clin Invest. 1992;89:1571–1579. doi: 10.1172/JCI115751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Warner G, Shatrud J, Dempsey J. Effect of hypoxia-induced periodic breathing on upper airway obstruction during sleep. J Appl Physiol. 1987;62:2201–2211. doi: 10.1152/jappl.1987.62.6.2201. [DOI] [PubMed] [Google Scholar]
  • 11.Hudgel DW, Harasick T. Fluctuation in timing of upper airway and chest wall inspiratory muscle activity in obstructive sleep apnea. J Appl Physiol. 1990;69:443–450. doi: 10.1152/jappl.1990.69.2.443. [DOI] [PubMed] [Google Scholar]
  • 12.Gleeson K, Zwillich CW, White DP. The influence of increasing ventilatory effort on arousal from sleep. Am Rev Respir Dis. 1990;142:295–300. doi: 10.1164/ajrccm/142.2.295. [DOI] [PubMed] [Google Scholar]
  • 13.Vgontzas AN, Papanicolaou DA, Bixler EO, Hopper K, Lotsikas A, Lin HM, et al. Sleep apnea and daytime sleepiness and fatigue: relation to visceral obesity, insulin resistance and hypercytokinemia. J Clin Endocrinol Metab. 2000;85:1151–1158. doi: 10.1210/jcem.85.3.6484. [DOI] [PubMed] [Google Scholar]
  • 14.Alberti A, Sarchielli P, Gallinella E, Floridi A, Floridi A, Mazzotta G, et al. Plasma cytokine levels in patients with obstructive sleep apnea syndrome: a preliminary study. J Sleep Res. 2003;12:305–311. doi: 10.1111/j.1365-2869.2003.00361.x. [DOI] [PubMed] [Google Scholar]
  • 15.Kroeger K, Steer J, Joyce D, Abraham L. Effects of stimulus and cell type on the expression of the -308 tumor necrosis factor promoter polymorphism. Cytokine. 2000;12:110–119. doi: 10.1006/cyto.1999.0529. [DOI] [PubMed] [Google Scholar]
  • 16.Louis E, Franchimont D, Piron A, Gevaert Y, Schaaf-Lafontaine N, Roland S, et al. Tumor necrosis factor (TNF-a) gene polymorphism influences TNF-a production in lipopolysaccharide (LPS)- stimulated whole blood cell culture in healthy humans. Clin Exp Immunol. 1998;113:401–406. doi: 10.1046/j.1365-2249.1998.00662.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Partinen M, Gislason T. Basic nordic sleep questionnaire (BNSQ): a quantitated measure of subjective sleep complaints. J Sleep Res. 1995;4:150–155. doi: 10.1111/j.1365-2869.1995.tb00205.x. [DOI] [PubMed] [Google Scholar]
  • 18.Sambrook J, Fritsch E, Maniatis T. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor. 1989 [Google Scholar]
  • 19.Wilson AG, di Giovine FS, Blakemore AI, Duf GW. Single base polymorphism in the human tumor necrosis factor alpha (TNF-α) gene detectable by NcoI restriction of PCR product. Hum Mol Genet. 1992;1:353. doi: 10.1093/hmg/1.5.353. [DOI] [PubMed] [Google Scholar]
  • 20.Vgontzas A, Papanicolaou D, Bixler E, Kales A, Tyson K, Chrousos G. Elevation of Plasma Cytokines in Disorders of Excessive Daytime Sleepiness: Role of Sleep Disturbance and Obesity. J Clin Endocrinol Metab. 1997;82:1313–1316. doi: 10.1210/jcem.82.5.3950. [DOI] [PubMed] [Google Scholar]
  • 21.Young T, Wetter D. Smoking as a risk factor for sleep apneas. Am J Respir Crit Care Med. 1994;149:A397. [Google Scholar]
  • 22.Malhotra A, White D. Obstructive sleep apnoea. Lancet. 2002;360:237–245. doi: 10.1016/S0140-6736(02)09464-3. [DOI] [PubMed] [Google Scholar]
  • 23.Redline S, Tishler PV. The genetics of sleep apnea. Sleep Med Rev. 2000;6:583–602. doi: 10.1053/smrv.2000.0120. [DOI] [PubMed] [Google Scholar]
  • 24.Lavie P, Rubin A. Effects of nasal occlusion on respiration in sleep. Evidence of inheritability of sleep apnea proneness. Acta Otolaryngol. 1984;97:127–130. doi: 10.3109/00016488409130972. [DOI] [PubMed] [Google Scholar]
  • 25.Riha RL, Brander P, Vennelle M, McArdle N, Kerr SM, Anderson NH, et al. Tumor necrosis factor-a (-308) gene polymorphism in obstructive sleep apnoea-hypopnoea syndrome. Eur Resprir J. 2005;26:673–678. doi: 10.1183/09031936.05.00130804. [DOI] [PubMed] [Google Scholar]
  • 26.Sultan Q, Al-Abri M, Al-Hashmi K. Obstructive sleep apnoea/hypopnoea syndrome and hypertension. Univ Med J. 2008;8:266–274. [PMC free article] [PubMed] [Google Scholar]
  • 27.Alvarez V, Mata IF, González P, Lahoz CH, Martínez C, Peña J, et al. Association between the TNFalpha-308 A/G polymorphism and the onset-age of Alzheimer disease. Am J Med Genet. 2002;114:574–577. doi: 10.1002/ajmg.10515. [DOI] [PubMed] [Google Scholar]
  • 28.Sashio H, Tamura K, Ito R, Yamamoto Y, Bamba H, Kosaka T, et al. Polymorphisms of the TNF gene and the TNF receptor super family member 1B gene are associated with susceptibility to ulcerative colitis and Crohn's disease, respectively. Immunogenetics. 2002;53:1020–1027. doi: 10.1007/s00251-001-0423-7. [DOI] [PubMed] [Google Scholar]
  • 29.Shih CM, Lee YL, Chiou HL, Chen W, Chang GC, Chou MC, et al. Association of TNF-alpha polymorphism with susceptibility to and severity of non-small cell lung cancer. Lung Cancer. 2006;52:15–20. doi: 10.1016/j.lungcan.2005.11.011. [DOI] [PubMed] [Google Scholar]
  • 30.Nearman ZP, Wlodarski M, Jankowska AM, Howe E, Narvaez Y, Ball E, et al. Immunogenetic factors determining the evolution of T-cell large granular lymphocyte leukaemia and associated cytopenias. Br J Haematol. 2007;136:237–248. doi: 10.1111/j.1365-2141.2006.06429.x. [DOI] [PubMed] [Google Scholar]
  • 31.Bown M, Horsburgh T, Nicholson M, Bell P, Sayers R. Cytokine gene polymorphisms and the inflammatory response to abdominal aortic aneurysm repair. Br J Surg. 2003;90:1085–1092. doi: 10.1002/bjs.4176. [DOI] [PubMed] [Google Scholar]
  • 32.Lee YH, Ji JD, Song GG. Tumor necrosis factor-alpha promoter -308 A/G polymorphism and rheumatoid arthritis susceptibility: a metaanalysis. J Rheumatol. 2007;34:43–49. [PubMed] [Google Scholar]
  • 33.Nikolova PN, Pawelec GP, Mihailova SM, Ivanova MI, Myhailova AP, Baltadjieva DN, et al. Association of cytokine gene polymorphisms with malignant melanoma in Caucasian population. Cancer Immunol Immunother. 2007;56:371–379. doi: 10.1007/s00262-006-0193-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Satoh T, Pandey JP, Okazaki Y, Yasuoka H, Kawakami Y, Ikeda Y, et al. Single nucleotide polymorphisms of the inflammatory cytokine genes in adults with chronic immune thrombocytopenic purpura. Br J Haematol. 2004;12:796–801. doi: 10.1111/j.1365-2141.2004.04843.x. [DOI] [PubMed] [Google Scholar]
  • 35.Snyder LD, Hartwig MG, Ganous T, Davis RD, Herczyk WF, Reinsmoen NL, et al. Cytokine gene polymorphisms are not associated with bronchiolitis obliterans syndrome or survival after lung transplant. J Heart Lung Transplant. 2006;25:1330–1335. doi: 10.1016/j.healun.2006.07.001. [DOI] [PubMed] [Google Scholar]
  • 36.Seifart C, Dempfle A, Plagens A, Seifart U, Clostermann U, Müller B, et al. TNF-alpha-, TNF-beta-, IL-6-, and IL-10-promoter polymorphisms in patients with chronic obstructive pulmonary disease. Tissue Antigens. 2005;65:93–100. doi: 10.1111/j.1399-0039.2005.00343.x. [DOI] [PubMed] [Google Scholar]

Articles from Hippokratia are provided here courtesy of Hippokratio General Hospital of Thessaloniki

RESOURCES