Skip to main content
Endocrinology logoLink to Endocrinology
. 2013 Apr 1;154(6):2200–2207. doi: 10.1210/en.2012-2230

A 5′-Flanking Region of Gonadotropin-Regulated Testicular RNA Helicase (GRTH/DDX25) Gene Directs Its Cell-Specific Androgen-Regulated Gene Expression in Testicular Germ Cells

Raghuveer Kavarthapu 1,*, Chon-Hwa Tsai-Morris 1,*, Masato Fukushima 1, James Pickel 1, Maria L Dufau 1,✉
PMCID: PMC3740490  PMID: 23546600

Abstract

Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is a posttranscriptional regulator of genes that are essential for spermatid elongation and completion of spermatogenesis. It also prevents Leydig cells (LCs) from gonadotropin overstimulation of androgen production. In transgenic (Tg) mice carrying deletions of the GRTH 5′-flanking regions, we previously demonstrated that the −1085 bp to ATG contains the elements for basal and androgen-induced LC-specific expression. No expression in germ cells (GCs) was found with sequences extended up to −3.6 kb. To define regulatory regions of GRTH required for expression in GC, Tg mice were generated with 5′-flanking sequence 6.4 kb (6.4Kb-Tg) and/or deletion using green fluorescent protein (GFP) as reporter gene in the present study. GFP was expressed in all lines. Immunohistochemistry analysis showed that 6.4Kb-Tg directed GFP expression in both GCs and LCs. Deletion of the sequence −205 bp to −3.6 kb (6.4Kb/del-Tg) directs GFP expression only in meiotic and haploid GCs. This indicated that the distal region −6.4 kb/−3.6 kb is required for GRTH cell-specific expression in GC. Also, it inhibits the expression of GRTH in LC directed by the 205-bp promoter, an effect that is neutralized by the −3.6-kb/−205-bp sequence. Androgen receptor antagonist, flutamide treatment prevents GFP/GRTH expression in Tg lines, demonstrating in vivo direct and indirect effects of endogenous androgen on LCs and GCs, respectively. Our studies have generated and characterized Tg lines that can be used to define requirements for cell-specific expression of the GRTH gene and to further advance our knowledge on the regulation of GRTH by androgen in GCs.


Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is a testis-specific member of the DEAD-box protein family, which is essential for completion of spermatogenesis. GRTH is a multifunctional enzyme present in Leydig cells (LCs) and germ cells (GCs) (spermatocytes, round and elongated spermatids) (1–4). In addition to its intrinsic RNA helicase activity, GRTH is a shuttling protein that exports mRNAs from the nucleus to cytoplasm through a chromosome region maintenance-1 protein-dependent pathway. As a component of messenger RNA ribonuclear protein particles, GRTH participates in the transport of specific mRNAs to cytoplasmic sites (chromatoid body of round spermatids) presumably for storage of mRNAs before their translation at specific times during spermatogenesis. It also associates with actively translated polyribosomes, where it may regulate translational initiation of target genes (5, 6). This helicase is a negative regulator of apoptosis, most notably in pachytene spermatocytes, through its association with pro- and antiapoptotic mRNAs, and its regulatory functions of the death receptor and nuclear factor-κB pathways (7). GRTH knockout mice are sterile and lack sperm due to the failure of round spermatids to elongate, resulting in complete arrest at step 8 of spermiogenesis (8). GRTH is regulated by LH through androgen at the transcriptional and translational levels in LCs and GCs of the testis, where its expression is both cell and stage specific (2, 9). It displays a novel negative autocrine control of the androgen production in LCs by preventing overstimulation of the gonadotropin-induced androgen pathway through enhanced degradation of steroidogenic acute regulatory protein (10).

The 20-kb mouse GRTH gene contains 12 coding exons, and all but one of its conserved helicase motifs are contained within single exons. GRTH is a TATA-less gene with multiple transcriptional start sites and GC-rich sequences at the promoter located within −205/+63 bp of the gene. The basal transcriptional activity of the TATA-less GRTH gene is driven by GC-rich specificity protein, Sp1/Sp3 in the promoter region (−205/+63 bp) (11). Androgen regulates GRTH in LC through its cognate receptor at a nonconsensus androgen response element (ARE) half-site, which resides at −827 (ARE2) relative to the GRTH translational start site via short range chromosomal looping between androgen receptor (AR)/ARE2 and the core transcriptional machinery at the promoter (12).

Our previous findings using transgenic (Tg) mice carrying sequential deletions of 5′-flanking sequences of the GRTH gene defined a 5′ region adjacent to the ATG codon required for cell-specific expression of the GRTH gene in LCs (9). The 1085-bp 5′-untranslated region to the ATG of GRTH gene was found to contain the necessary elements to direct green fluorescent protein (GFP) basal and androgen-induced GFP expression in LCs (9, 12) and the 205-bp promoter constitutively directed expression to LCs (9). No expression was found in GCs in Tg mice carrying the 5′ sequence extended up to 3.6 kb, 5′ to the ATG codon, whereas in these mice, expression was only found in LCs (9). Because the −6.4-kb region of the GRTH gene is followed upstream by the coding sequences of the uridine synthetase gene, which are unlikely to direct GRTH expression to GCs, we concentrated our studies to regions within the 5′-flanking −6.4-kb sequence of the GRTH gene to localized sequences responsible for GRTH expression in GCs.

To further define regulatory regions of GRTH gene required for differential expression in GCs and LCs, we generated Tg mice carrying the 6.4-kb 5′-flanking sequence (6.4 kb) and deletion of −3.6 kb to −205 bp (6.4Kb-del) to the promoter with GFP as the reporter gene. We demonstrated that expression of GRTH in testicular cells is differentially regulated by its 5′-flanking sequence and that the distal sequence directs gene expression to GCs. These studies also reveal an indirect androgen regulation on the GRTH expression in GCs.

Materials and Methods

Plasmid constructs

The nucleotides covering the transgene of −6400 to −3472/−205 to +63 bp (6.4Kb/del-Tg) tailed with XhoI/SalI were generated by the strategy of direct DNA synthesis (GeneScript Corp, Piscataway, New Jersey) and subsequently subcloned into XhoI/SalI site of pEGFP-1 vector. Full length of 6.4-kb transgene (6.4Kb-Tg) was generated by ligating 3.6-kb BamHI restriction digested fragment (−3630/+63 bp) of previous established transgene p−3600/+63 GFP (9) to the 6.4Kb/del-Tg (above) after removal of 510 bp of BamHI fragment (−3630/−3472 to −205/+63 bp). Sequences in both transgenes were verified by DNA sequencing.

Generation of GRTH Tg mice

DNA fragments were first isolated by restriction digestion of fusion constructs to produce respective transgene fragments: 8.5 kb of Xho1/NarI fragment for GRTH 6.4Kb-Tg and 4.2 kb of XhoI/AfI2 fragment for GRTH 6.4Kb/del-Tg. Tg mice were generated by microinjection of respective purified fragment into fertilized eggs in Transgenic Core Facility of National Institute Mental Health, National Institutes of Health. Mice carrying GRTH-EGFP fusion genes were identified by PCR-based screening to produce 420-bp fragment (Forward, −18 bp of 5′-flanking region of mouse GRTH gene [GAGCGGAGACCGCAGCTATGGCG] and Reverse, +420 of pEGFP-1 [CTTGTAGTTGCCGTCGTCC TTGAAGA]), and 200-bp fragment (Forward, +4125 of GFP [GTGGATAACCGTATTACC] and Reverse, −6262 bp [CTTGCACTACCATGCT CAG]) using isolated mouse tail DNA. Four separate mouse lines created out of these 2 lines (GRTH-Tg) with similar high levels of transgene expression were used as founders and maintained in C57/BL6 mouse strain. Animals were housed in pathogen-free and temperature- and light-controlled conditions (22°C), with an alternating light-dark cycle with 14 hours of light and 10 hours of darkness. All of the animal studies were approved by National Institute of Child Health and Human Development Animal Care and Use Committee.

Animal treatment

Adult male Tg mice (6.4Kb-Tg and 6.4Kb/del-Tg) were treated with 0.5 mg of AR antagonist 2-methyl-N-[4-nitro-3-(trifluoromethyl)-phenyl] propanamide (flutamide) in 1,2-propanediol (Sigma-Aldrich, St. Louis, Missouri). This therapy was proven effective to obliterate the action of endogenous circulating testosterone in mice (9, 12). The treated animals were given 2 sc injections of flutamide with a 12-hour interval for 3 days. Animals were killed by asphyxiation with CO2 and decapitated after flutamide or vehicle (controls) treatment. Testes were removed for histological and Western blot analyses.

Immunohistochemistry

Immunohistochemistry was performed to localize the GFP expression in testicular sections of male Tg mice. Testes from adult Tg animals were fixed in 4% paraformaldehyde and embedded in paraffin. Serial sections were incubated with 1:1000 dilution of rabbit anti-GFP antibody (Abcam, Cambridge, Massachusetts) (see Supplemental Table 1, published on The Endocrine Society's Journals Online web site at http://endo.endojournals.org) and developed with horseradish peroxidase polymer conjugated to the secondary antibody (Invitrogen, Frederick, Maryland). Antigen retrieval was performed using Tris-EDTA buffer (pH 9.0) before primary antibody incubation step. The immunocomplex was visualized with diaminobenzidine as chromagen and hydrogen peroxide as substrate to produce brown color. The sections were counterstained with hematoxylin. In a parallel study, periodic acid/Schiff reagent was used for acrosome determination. Sections of seminiferous tubules (STs) were staged according to the method of Leblond and Clermont (13). The intensity of GFP immunosignals in individual testicular cells was quantitated from at least 50 cells of 3 different STs using Image Pro software (Media Cybernetics, Inc, Rockville, Maryland) and normalized by IgG.

Western blot analysis

Protein extracts from Tg mice testis were prepared by homogenization in radioimmunoprecipitation assay lysis buffer (Upstate, Temecula, California) containing protease inhibitor cocktail (Roche Applied Sciences, Indianapolis, Indiana). The protein lysates were centrifuged at 1500g for 10 minutes. The supernatant was collected, and protein concentration was determined by the Bradford assay (Bio-Rad Laboratories, Hercules, California). The protein extracts (50 μg) were separated using 4%–12% Bis-Tris gel (Invitrogen) and transferred onto nitrocellulose membrane. The membrane was blocked with 5% skimmed milk powder in phosphate buffer saline and then later incubated either with specific rabbit anti-GFP antibody (Abcam) or β-actin antibody (Sigma-Aldrich). Immunosignals were detected by a supersignal chemiluminescence system (Pierce, Rockford, Illinois).

Sequence analysis

The putative binding elements for transcription factors within the 6.4-kb 5′-flanking region of GRTH gene were identified by MatInspector Professional from Genomatrix software (http://www.genomatrix.de) using a matrix core identity of 1.0 and an optimized matrix similarity of 1.0 as search criteria.

Statistical analysis

Data are presented as the mean ± SE of 3 independent experiments performed in triplicate. The significance of the differences between groups was determined by Tukey's multiple comparison test (1-way ANOVA analysis) using the Prism software program (GraphPad Software, Inc, San Diego, California).

Results

Western blot analysis of testicular lysates from independent Tg mice lines carrying 6.4 kb (Figure 1, top panel, lanes 1 and 2) or 6.4Kb/del (−6.4 kb/−3.6 kb to −205/+63 bp; Figure 1, top panel, lanes 3 and 4) of GRTH gene showed the presence of the reporter gene (GFP) expression in the testis. Wild-type mouse testis extract without GFP expression was used as the negative control (Figure 1, top panel, lane 5). COS1 cells transiently transfected with pEGFP plasmid were used as the positive control in the study (Figure 1, right panel, lane 6). This study confirmed the presence of GFP reporter gene expression in different lines of Tg mice carrying GRTH 5′-flanking region. Quantitation of the signal normalized by β-actin is shown below the Western gel image.

Figure 1.

Figure 1.

Western blot analysis of GRTH 5′-flanking sequence directed GFP expression in the testis of Tg mice. WT, wild type; ND, non-detectable. β-Actin used as loading control. 6349 and 6394 are 6.4Kb-Tg lines and 7195 and 7495 are 6.4Kb/del-Tg lines. (Lower panel) Relative density of bands (GFP expression) from 3 independent experiments in each group normalized with β-actin. No significant difference was observed among experimental groups.

Immunohistochemical analysis further revealed that the 6.4-kb transgene-directed reporter GFP expression in both interstitial LCs and GCs present in the STs of 6.4Kb-Tg mice (Figure 2, top panel). Deletion of −3.6 kb/−205 bp within the 6.4-kb 5′-flanking region of GRTH gene in the 6.4Kb/del-Tg mice showed that the distal of −6.4 kb/-3.6 kb sequence direct GFP expression exclusively in GCs, and it is completely absent in the LC (Figure 2, lower panel). These results revealed that 5′ distal sequences to −3.6 kb play an important role to drive GRTH gene expression in GCs.

Figure 2.

Figure 2.

5′-flanking sequences of GRTH gene required for GC-specific expression. Immunohistochemistry analysis of the GFP expression directed by 6.4 kb or −3.6 kb/−205 bp (6.4Kb/del). Representative micrographs showed specific staining (brown color) visualized in the testicular compartment. IgG, negative control; scale bar, 50 μm.

To determine the cellular expression patterns of GRTH protein in the STs during GCs development in both 6.4Kb-Tg and 6.4Kb/del-Tg mice, a detailed analysis of immunostaining present in different type of GCs during the spermatogenic cycle was performed. GFP expression was found in most of the different stages of spermatogenic cycle in both 6.4Kb-Tg (Figure 3A) and 6.4Kb/del-Tg (−6.4 kb/−3.6 kb) mice (Figure 3B). GFP immunosignal was present in spermatocytes, round spermatids, and elongated spermatids. Expression of GFP in spermatocytes include those entering metaphase of meiosis (stage XII). However, the intensity of immunosignals was significantly higher in spermatocytes and round spermatids of 6.4Kb/del-Tg mice compared with 6.4Kb-Tg mice (Figure 3C) in most stages of the spermatogenic cycle. No significant difference in immunosignal was observed in elongated spermatids between 6.4Kb-Tg mice and 6.4Kb/del-Tg mice except for stages II/III, IV, and XII (Figure 3C). In these 6.4Kb-Tg mice, stronger signals were noted in round spermatids and elongating spermatids compared with spermatocytes. Immunostaining signals were apparent in pachytene spermatocytes at stages IX–X, diplotene spermatocytes at stage XI, and cells entering metaphase of the meiosis (Figure 3, A and B). In the case of 6.4Kb/del-Tg mice, GFP staining appears to be evenly distributed in the spermatocytes, round and elongating spermatids from stages II to XII. GFP staining was absent in spermatogonia and Sertoli cells of both 6.4Kb- and 6.4Kb/del-Tg mice. GFP expression was present in the interstitial cells of 6.4Kb-Tg but absent from the 6.4Kb/del-Tg throughout the GCs development (Figure 3A compared with Figure 3B). GFP signals were measured in each specific GC type during different stages of spermatogenesis using Image Pro software. Specific signals were obtained by subtracting IgG signals (negative control) and presented in bar graphs (Figure 3C).

Figure 3.

Figure 3.

Immunohistochemical analysis of the GFP expression directed by −6.4 kb (A) or −6.4/−3.6 kb (B) of 5′-flanking sequences of mouse GRTH during spermatogenic cycle. (C) Quantitative analysis of GFP immunosignals in individual testicular cells in 6.4Kb-Tg and 6.4Kb/Del-Tg mice during spermatogenic cycle. Immunosignals (A and B) were noted as brown color. IgG was used as the negative control at the lower panel of each micrographs. II–XII, stages of the spermatogenic cycle in the mouse testis; P, pachytene spermatocyte; Z, zygotene; L, leptotene; D, diplotene; RS, round spermatid; SC, Sertoli cells; SM, spermatocytes in the metaphase of meiosis; ES, elongated spermatids; scale bar, 50 μm. (C) Immunosignal intensities in different cell types were quantified as OD using Image Pro software and normalized by IgG negative control (I–III). Results are mean ± SE of 3 independent experiments performed in triplicate. *P < .05 between 6.4Kb-Tg and 6.4Kb/del-Tg.

In mice treated with AR antagonist flutamide, Western blot analysis showed complete loss of GFP expression in the 6.4Kb-Tg or minimally present in 6.4Kb/del-Tg mice testes when compared with the control group (Figure 4, 6.4Kb-Tg, lanes 1 and 2 vs 5 and 6; 6.4Kb/del-Tg, lanes 3 and 4 vs 7 and 8). Immunohistochemical analysis further revealed loss of GFP expression in both in GCs and LCs of 6.4Kb-Tg mice treated with flutamide compared with control mice (Figure 5A, top panel). Moreover, there was a significant reduction of immunosignals in the GCs of 6.4Kb/del-Tg mice (Figure 5A, lower panel). This is clearly evident from the quantification of the immunosignal (Figure 5B, top panel, in 6.4Kb-Tg, either LCs or GCs; lower panel, GCs only in 6.4Kb/del-Tg).

Figure 4.

Figure 4.

Western blot analysis of GFP expression in the testis of Tg mice treated with flutamide. (A) Western analysis. β-Actin used as loading control. 6349 and 6394 are 6.4Kb-Tg lines and 7195 and 7495 are 6.4Kb/del-Tg lines. Positive control, cell lysates containing EGFP. (B) Densitometry analysis. Relative densities of band from 3 independent experiments in each group and normalized to β-actin are presented as bar graphs. C, control; F, flutamide. Results are presented as percent of individual treatment relative to control sample. Mean ± SE of 3 independent experiments done in triplicates. Identical superscripts indicate statistical significance between experimental groups. *P < .001.

Figure 5.

Figure 5.

Immunohistochemical analysis of the GFP expression in 6.4Kb-Tg and 6.4Kb/del-Tg mice treated with flutamide. (A) Immunostaining signals were noted as brown color. IgG was used as the negative control at the lower panel of each micrographs. Scale bar, 50 μm. (B) Immunosignals in control and treated groups were quantified as OD and normalized with respect to IgG negative control. Flu, flutamide. Results are mean ± SE of 3 independent experiments performed in triplicate. *P < .05.

Discussion

The present study on Tg mice has defined a specific domain in the 5′-flanking region of the GRTH gene that differentially directs its expression to LCs and GCs of the testis. Unlike our previous reported studies of transgenes with fragments ranging from minimal promoter 205 bp to 3.6-kb 5′-flanking region, which directed GFP expression in LC only (9), deletion of −3.6 kb/−205 bp sequences distal to the promoter domain in the 6.4-kb 5′-flanking region of GRTH gene directed specific expression of GFP solely to GCs. The Tg mice carrying the full-length 6.4-kb 5′-flanking region of the GRTH gene (−6.4 kb/+63 bp) revealed the reporter gene GFP expression present in both testicular cell compartments. The AR antagonist flutamide abolished the expression of sequence directed GFP expression in both LCs and GCs. This suggested that in addition to androgen's direct action on the LCs, an indirect regulation of GRTH expression in GCs.

Although the −205/+65 bp (promoter) transgene alone could only induce the reporter gene expression in the LCs (9), GFP expression was noted only in GCs with the promoter directly linked to the upstream −6.4 kb/−3.6 kb sequence. It is likely that the presence of specific cis-element(s) located in these upstream region bound by a yet to be defined transcriptional factor(s) prevents the −205 bp directed LC expression. However, the inhibitory effect was not observed in the presence of −3.6 kb/−205 bp sequence in the Tg mice carrying the intact 6.4-kb sequences. This indicates that the inhibitory effect of the −6.4 kb/−3.6 kb is buffered by the presence of the intermediate sequence possibly through disrupting an inhibitory loop. Alternatively, the −3.6 kb/−205 bp sequence may be required in the context of the whole 5′-untranslated region to direct expression in LCs. It is reasonable to propose that 205 bp (promoter) transgene directs constitutively basal GRTH transcription/expression in LC (9), whereas the activation relies on the functional recently characterized ARE(s) at −827 bp (12), which is not present in the −205-bp transgene.

Sequences of relevance for GC-specific expression, derived from comparison of the −6.4 kb/−3.6 kb sequence with other 5′ regulatory sequences of male GC-specific genes using multiple alignment workshop (http://helixweb.nih.gov/multi-align/), revealed a striking similarity of at least 10 cluster sequences, which span through these GRTH sequences to premeiotic/meiotic and postmeiotic male GCs genes. These include the mouse phosphoglycerate kinase 2 gene (14), rat RT7 gene (15), spermatid-specific promoter of SP-10 gene (16), and mouse GC-specific mouse vasa homolog (mVH/Vasa) gene (17). We hypothesize that sequences that direct genes expression specifically in male GCs might be evolutionary conserved. Three putative binding sites with the highest conserved core elements (score = 1) for transcriptional factor(s) that are specific for GCs function were also identified within −6.4 kb/−3.6 kb but absent from its downstream −3.6-kb sequences by MatInspector (http://www.genomatrix.de). Transcription factors (TF) to those sites contain a zinc finger like domain. These include germ cell nuclear factor/retinoid receptor-related testis-associated receptor (GCNF/RTR), a specific nuclear factor (GCNF/RTR, nulceotides [nt]. −5270/−5252) (Figure 6), which is known to be expressed predominantly in developing GCs and required to direct gene expression in the postmeiotic phase of male GC (18). Also, testis-specific genes doublesex and mab-3 related transcription factor (Dmrt), (2 sites, nt. −6204/−6184, −4340/−4320)/ Dmrt7 known as Doublesex and mab-3 related transcription factor (1 site, nt. −3649/−3629) (Figure 6) are required for testicular differentiation. As is the case for GRTH, Dmrt-1 or Dmrt-7 null mice are infertile. Dmrt1 is required for GC migration, to enter meiosis, and survival of gonocytes. Dmrt7, which postnatally is testis specific and is not required for embryonic development, is essential of spermatogenesis beyond late pachytene stage (19). Conserved binding site for Dmrt1 (1 site) and Dmrt7 (2 sites) is also identified in the 5′-flanking region of heat shock protein, and phosphoglycerate kinase 2. GCNF binding sites are noted in the 5′-flanking sequence of the protamine 1 and 2 genes. Becausetranscriptional regulation of gene expression in spermatogenic cells must result from coordinated regulation of specific promoter/5′-flanking sequences and transcriptional factors expressed at specific stages of GC development, the information derived from in silico analysis of the gene sequence will serve as the initial approach to explore and elucidate the molecular mechanism of cell-specific GRTH expression.

Figure 6.

Figure 6.

Transcriptional factors binding sites predicted in −6.4 kb/−3.6 kb 5′-flanking sequence of GRTH gene. Location of the putative TF binding sites specifically associated with GC genes found in the −6.4 kb/−3.6 kb region of the GRTH sequence are indicated. r, reverse compliment.

The loss of GFP expression in both LCs and GCs directed by the 5′ 6.4-kb sequences in Tg mice after flutamide treatment provides the intrinsic physiological evidence of androgen action in the LCs indicated in our previous studies (9, 12). Of much interest are our findings on the endogenous androgen action specifically targeting transcription in GCs using the AR antagonist, flutamide (Figures 4 and 5). These have revealed an indirect action of androgen on GRTH expression in the GCs of mice carrying only GC-specific 5′-flanking sequences (−6.4 kb/−3.6 kb), where minimal GFP signals were detected after flutamide treatment. We hypothesize that this regulation is mediated by not yet identified transcriptional factor(s) with impact on GRTH transcription via a cross talk through the Sertoli cells, which are known to possess ARs, absent in GCs. Such regulation could be indirectly induced upstream by an androgen/AR-responsive gene from Sertoli cells such as transcription factor reproductive homeobox on chromosome X 5 or other(s) (20–23). These could induce transcription of a coactivator or transcription factor(s) or cause posttranscriptional modification that in turn impact on transfactor activation/binding to DNA sites of the GRTH gene (ie, Dmrt1/7, GCNF/RTR, or others) and induce its transcription (Figure 7). We could also speculate that these factor(s) might participate by binding to the unique sites predicted in the −6.4 kb/−3.6 kb sequences (ie, Dmrt1/7 and GCFN/RTR).

Figure 7.

Figure 7.

Summary diagram of 5′-flanking sequence of GRTH gene that directs its cell-specific expression in testicular cells and direct/indirect actions of androgen on GRTH transcription at cellular compartments. Androgen (A) produced from LCs binds to AR and subsequently interacts with ARE2 (−828/−833) to direct GRTH gene expression in LCs (12). Paracrine activation by androgen from LC induces A/AR-responsive gene(s) expression in Sertoli cells such as transcription factor reproductive homeobox on chromosome X 5 or others to be identified. These in turn may activate downstream targets that directly or indirectly induce GRTH transcription through TF binding to 5′ elements located in the distal (−3600/−6450 bp) 5′-flanking region of the gene (ie, Dmrt1/7, GCNF/RTR, or others).

These studies on the cellular localization of the GFP immunoreactive protein in the STs of the adult mouse testis have clearly demonstrated a cell type-specific expression during spermatogenic cycle directed by 2.8-kb sequences upstream to −3.6-kb 5′-flanking the GRTH gene. This is confirmed by the identical expression pattern observed in the intact 6.4-kb 5′-flanking sequences, although the intensity of the signal is lower than with the 3.6-kb deleted transgene. Similar to our previous studies on endogenous GRTH expression in the rat, in this Tg mice study, expression is present in all stages of spermatogenic cycle, including pachytene and leptotene spermatocytes and also round and elongated spermatids. Spermatocytes entering the metaphase of meiotic division (stage XII) are also strongly associated with GFP immunoreactive staining. No expression of GFP protein was found in spermatogonia and Sertoli cells. Future studies are required to determine the mechanisms that trigger GRTH gene expression in the GCs during spermatogenesis, which may involve interactions with yet to be defined regulated proteins. The regulation of GRTH transcription/expression by androgens in GCs indicates that this helicase has a central role in androgen-dependent spermatogenesis. These models are of value to elucidate the intrinsic indirect regulatory actions of androgen in GCs.

Acknowledgments

We thank Mr Daniel Abebe for his expert assistance with the animal work.

This work was supported by the National Institutes of Health Intramural Research Program through the Eunice Kennedy Shriver National Institute of Child Health and Human Development.

Disclosure Summary: The authors have nothing to disclose.

For editorial see page 1967

Abbreviations:
AR
androgen receptor
ARE
androgen response element
flutamide
2-methyl-N-[4-nitro-3-(trifluoromethyl)-phenyl] propanamide
Dmrt
doublesex and mab-3 related transcription factor
GC
germ cell
GCNF/RTR
germ cell nuclear factor/retinoid receptor-related testis-associated receptor
GFP
green fluorescent protein
GRTH
gonadotropin-regulated testicular RNA helicase
LC
Leydig cell
ST
seminiferous tubule
TF
transcription factor
Tg
transgenic.

References

  • 1. Dufau ML, Tsai-Morris CH. Gonadotropin-regulated testicular helicase (GRTH/DDX25): an essential regulator of spermatogenesis. Trends Endocrinol Metab. 2007;18:314–320 [DOI] [PubMed] [Google Scholar]
  • 2. Sheng Y, Tsai-Morris CH, Dufau ML. Cell-specific and hormone-regulated expression of gonadotropin-regulated testicular RNA helicase gene (GRTH/Ddx25) resulting from alternative utilization of translation initiation codons in the rat testis. J Biol Chem. 2003;278:27796–27803 [DOI] [PubMed] [Google Scholar]
  • 3. Tang PZ, Tsai-Morris CH, Dufau ML. A novel gonadotropin-regulated testicular RNA helicase. A new member of the dead-box family. J Biol Chem. 1999;274:37932–37940 [DOI] [PubMed] [Google Scholar]
  • 4. Tsai-Morris CH, Sheng Y, Gutti RK, Tang PZ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25): a multifunctional protein essential for spermatogenesis. J Androl. 2010;31:45–52 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Sato H, Tsai-Morris CH, Dufau ML. Relevance of gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) in the structural integrity of the chromatoid body during spermatogenesis. Biochim Biophys Acta. 2010;1803:534–543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Sheng Y, Tsai-Morris CH, Gutti R, Maeda Y, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is a transport protein involved in gene-specific mRNA export and protein translation during spermatogenesis. J Biol Chem. 2006;281:35048–35056 [DOI] [PubMed] [Google Scholar]
  • 7. Gutti RK, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular helicase (DDX25), an essential regulator of spermatogenesis, prevents testicular germ cell apoptosis. J Biol Chem. 2008;283:17055–17064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Tsai-Morris CH, Sheng Y, Lee E, Lei KJ, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) is essential for spermatid development and completion of spermatogenesis. Proc Natl Acad Sci USA. 2004;101:6373–6378 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Tsai-Morris CH, Sheng Y, Gutti R, Li J, Pickel J, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25) gene: cell-specific expression and transcriptional regulation by androgen in transgenic mouse testis. J Cell Biochem. 2010;109:1142–1147 [DOI] [PubMed] [Google Scholar]
  • 10. Fukushima M, Villar J, Tsai-Morris CH, Dufau ML. Gonadotropin-regulated testicular RNA helicase (GRTH/DDX25), a negative regulator of luteinizing/chorionic gonadotropin hormone-induced steroidogenesis in Leydig cells: central role of steroidogenic acute regulatory protein (StAR). J Biol Chem. 2011;286:29932–29940 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Tsai-Morris CH, Lei S, Jiang Q, Sheng Y, Dufau ML. Genomic organization and transcriptional analysis of gonadotropin-regulated testicular RNA helicase–GRTH/DDX25 gene. Gene. 2004;331:83–94 [DOI] [PubMed] [Google Scholar]
  • 12. Villar J, Tsai-Morris CH, Dai L, Dufau ML. Androgen-induced activation of gonadotropin-regulated testicular RNA helicase (GRTH/Ddx25) transcription: essential role of a nonclassical androgen response element half-site. Mol Cell Biol. 2012;32:1566–1580 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Leblond CP, Clermont Y. Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann NY Acad Sci. 1952;55:548–573 [DOI] [PubMed] [Google Scholar]
  • 14. Robinson MO, McCarrey JR, Simon MI. Transcriptional regulatory regions of testis-specific PGK2 defined in transgenic mice. Proc Natl Acad Sci USA. 1989;86:8437–8441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. van der Hoorn FA, Tarnasky HA, Nordeen SK. A new rat gene RT7 is specifically expressed during spermatogenesis. Dev Biol. 1990;142:147–154 [DOI] [PubMed] [Google Scholar]
  • 16. Reddi PP, Shore AN, Shapiro JA, Anderson A, Stoler MH, Acharya KK. Spermatid-specific promoter of the SP-10 gene functions as an insulator in somatic cells. Dev Biol. 2003;262:173–182 [DOI] [PubMed] [Google Scholar]
  • 17. Tanaka SS, Toyooka Y, Akasu R, et al. The mouse homolog of Drosophila Vasa is required for the development of male germ cells. Genes Dev. 2000;14:841–853 [PMC free article] [PubMed] [Google Scholar]
  • 18. Rajkovic M, Iwen KA, Hofmann PJ, Harneit A, Weitzel JM. Functional cooperation between CREM and GCNF directs gene expression in haploid male germ cells. Nucleic Acids Res. 2010;38:2268–2278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hong CS, Park BY, Saint-Jeannet JP. The function of Dmrt genes in vertebrate development: it is not just about sex. Dev Biol. 2007;310:1–9 [DOI] [PubMed] [Google Scholar]
  • 20. Denolet E, De Gendt K, Allemeersch J, et al. The effect of a sertoli cell-selective knockout of the androgen receptor on testicular gene expression in prepubertal mice. Mol Endocrinol. 2006;20:321–334 [DOI] [PubMed] [Google Scholar]
  • 21. O'Shaughnessy PJ, Abel M, Charlton HM, Hu B, Johnston H, Baker PJ. Altered expression of genes involved in regulation of vitamin A metabolism, solute transportation, and cytoskeletal function in the androgen-insensitive tfm mouse testis. Endocrinology. 2007;148:2914–2924 [DOI] [PubMed] [Google Scholar]
  • 22. Zhou W, Wang G, Small CL, et al. Gene expression alterations by conditional knockout of androgen receptor in adult sertoli cells of Utp14b(jsd/jsd) (jsd) mice. Biol Reprod. 2010;83:759–766 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Hu Z, Dandekar D, O'Shaughnessy PJ, De Gendt K, Verhoeven G, Wilkinson MF. Androgen-induced Rhox homeobox genes modulate the expression of AR-regulated genes. Mol Endocrinol. 2010;24:60–75 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES