Abstract
The netrin axon guidance genes have previously been implicated in fertility in C. elegans and in vertebrates. Here we show that adult Drosophila lacking both netrin genes, NetA and NetB, have fertility defects in both sexes together with an inability to fly and reduced viability. NetAB females produce fertilized eggs at a much lower rate than wild type. Oocyte development and ovarian innervation are unaffected in NetAB females, and the reproductive tract appears normal. A small gene, hog, that resides in an intron of NetB does not contribute to the NetAB phenotype. Restoring endogenous NetB expression rescues egg-laying, but additional genetic manipulations, such as restoration of netrin midline expression and inhibition of cell death have no effect on fertility. NetAB males induce reduced egg-laying in wild type females and display mirror movements of their wings during courtship. Measurement of courtship parameters revealed no difference compared to wild type males. Transgenic manipulations failed to rescue male fertility and mirror movements. Additional genetic manipulations, such as removal of the enabled gene, a known suppressor of the NetAB embryonic CNS phenotype, did not improve the behavioral defects. The ability to fly was rescued by inhibition of neuronal cell death and pan-neural NetA expression. Based on our results we hypothesize that the adult fertility defects of NetAB mutants are due to ovulation defects in females and a failure to properly transfer sperm proteins in males, and are likely to involve multiple neural circuits.
Introduction
Netrin is a diffusible laminin-like protein, characterized originally in the function of guiding axons to the source of Netrin expression [1,2]. Since discovery, the Netrins have been observed performing diverse functions ranging from neurite growth, angiogenesis and carcinogenosis to cell survival (reviewed in 3–5). Characterizing Netrin functions in different contexts has led to insights in our understanding of how Netrin and Netrin receptors function.
Fertility is a complex result of the processes of meiosis, mating, zygote formation and offspring production. The C. elegans Netrin homolog, unc-6, is required for normal egg laying function; mutants can be rescued by exogenous serotonin indicating a neural basis for the phenotype [6]. The primary defect appears to be a failure of the HSN neuron to innervate the vulval muscles, leading to a failure to expel eggs [3,7]. unc-6 is also required for normal vulval structure including guiding the invasion of the gonad anchor cell, which leads to the formation of the vulval lumen [3,8,9]. unc-6 is required for migration of the distal tip cell of the gonad [3,10], which could potentially affect gamete production, but this has not been demonstrated.
In mammals, hormones under central nervous system (CNS) control regulate many aspects of reproduction. Ovulation is triggered by gonadotropin releasing hormone (GnRH) via luteinizing and follicle stimulating hormones. The migration and axonal projections of the GnRH secreting neurons are disrupted in Netrin-1 mutants [11,12]. Netrin-1 acts as a chemoattractant for migrating GnRH neurons in the chick [13], and also stimulates subsequent neurite outgrowth but may not affect neurite guidance [14]. Netrin-1 mutants display perinatal lethality, so effects on fertility await tissue specific knockout analysis [15]. However, given the essential role of GnRH in fertility [16], and that disrupted GnRH neuron migration is thought to underlie the sex hormone defects in Kallmann Syndrome [17], it seems likely that Netrin-1 will play a significant role in the mammalian reproductive axis.
Netrin-1 is expressed in the follicle of mature pig ovaries and has been proposed to modulate follicular function, most likely via angiogenic effects [18,19]. However, sympathetic nerves directly innervate components of the ovary, so it is possible that Netrin-1 could be modulating neuronal signaling. Increased activity of the sympathetic nerves can promote polycystic ovary syndrome, a major cause of infertility [20,21].
We have developed a fly line that lacks both Drosophila Netrin genes, NetA and NetB, that survives to adulthood and can be maintained as homozygotes [22]. In the course of characterizing the adult phenotypes of NetAB flies, we eliminated a role for a NetB intronic gene, hog, in the NetAB mutant phenotype. NetAB flies display complex behavioral defects, and in this paper we analyze the origin of these defects with a focus on significantly reduced fertility of both sexes. Unlike C. elegans unc-6 mutants, we see no obvious structural or connectivity defects in the reproductive tract or ovaries, suggesting a CNS origin potentially similar to the defects in mammalian Netrin-1 mutants. NetAB males show statistically significant reductions in the number of eggs laid by their female partners, even when the partner is wild type. We found that the egg-laying phenotype requires NetB, and all adult phenotypes appear to be independent of the well-known role for Netrins at the CNS midline. The ability to fly can be rescued and appears to rely on neuronal survival and not positional information. The observed phenotypes may therefore be a combination of defects in the central and peripheral nervous systems as well as muscles.
Results
Generation of a viable NetAB mutant
The two Drosophila Netrin genes are adjacent to each other on the X chromosome, most likely the product of a tandem duplication within the arthropod lineage [23,24]. Deletion of both genes is usually required to observe phenotypes, and the smallest deletion available in flies, NetAB MB23, deletes only NetA, NetB, and the intervening sequence [25]. The NetAB MB23 chromosome is semi-lethal as determined by the presence of the occasional hemizygous adult male. We observed that duplications for the NetAB region failed to rescue lethality suggesting the presence of additional mutations. Using chromosomal deletions and duplications, additional mutations were mapped to cytological intervals 13F-14B and 14F-15A. The portion of the chromosome containing these regions (proximal to NetAB) was replaced by recombination with a mapping chromosome (g if f; Figure 1A), generating an adult viable NetAB stock (first described in [22]).
Figure 1. Genomic structure of the NetAB locus and encoded products.
(A) Schematic view of the NetAB chromosome indicating approximate positions of background mutations believed to be enhancing or suppressing viability of the NetAB deletion. The approximate region of the chromosome exchanged by recombination is indicated by gray shading. (B) Diagram illustrating the location of the hog gene within the NetB gene, as well as the position of the KG03586 transposon near the 5’ end of the hog gene. Filled boxes are exons and diagonal lines represent splicing to the mature gene products. (C) Predicted protein product of the hog gene aligned to homologous genes from other Drosophila species. Conserved residues are boxed. The consensus sequence for an FHA domain is shown underneath (pfam00498; cd00060). Identity of additional genes: Ds1: Drosophila simulans GD15843; Dy1: Drosophila yakuba GE16495; De1: Drosophila erecta GG17709; Da1: Drosophila ananassae GF19383; Dm2 = Drosophila melanogaster CG34323/IP18436p.
NetAB mutants display thorax morphology defects, as has been observed in the Netrin receptor mutant, frazzled [26]. The thoraces appear split into two halves with an invagination of varying depth separating the two sides. The area of normal cuticle (darker in color with bristles present) is frequently reduced leaving plain lighter colored cuticle present. The reduction of cuticle with bristles, as well as the overall volume of the thorax is usually asymmetric and occasionally the wing is also absent. The rate of defects is 3.7% (n=373) compared to 0.32% in OregonR (n=619) and 0.35% in w - not iso (n=285). Flies with thorax defects were found to be entirely sterile so were excluded from all analyses except viability. Further analysis of the recombinant chromosome using chromosomal duplications suggests that there is a mutation enhancing viability of the NetAB stock that is tightly linked to the white locus at 3B6; the nearby Notch gene does not appear to be responsible as it enhances NetAB phenotypes (M. Alavi and T.K., unpublished observations [27]). The new stock, NetAB ∆GN, is referred to as NetAB throughout the paper for simplicity.
Viability defects
In addition to maintaining NetAB as a homozygous stock, we also maintained the chromosome as a heterozygote over the FM7 balancer. We noticed that NetAB males appeared less often than expected; when NetAB males are crossed to NetAB/FM7 females, only 35.6% of adult offspring are NetAB mutants whereas 50% are expected (p = 0.00016, n = 343, Chi Square test). NetAB mutants therefore have viability defects that we attempted to rescue through targeted NetA or NetB expression and through down-regulation of other genes. We first utilized a chromosome in which NetA is deleted and NetB has a carboxy terminal myc epitope tag added by homologous recombination (NetA ∆ NetB myc [25]). We found that NetA ∆ NetB myc rescues viability (p=0.0016, n = 162, Chi Square test, Table 1). Midline expression of both NetA and NetB has been shown to rescue the embryonic CNS phenotype [23,24], so we used the sim-GAL4 and rho-GAL4 drivers and UAS-NetA and UAS-NetB to test for rescue of viability. Only midline expression of NetB under control of the sim promoter rescued viability (p=0.000018, n = 256, Chi Square test, Table 1). We recently identified pan-neuronal expression of NetB as capable of rescuing embryonic CNS phenotypes by inhibition of apoptotic signaling [22], so we tested the pan-neuronal drivers elav-GAL4 and sca-GAL4 in combination with NetA, NetB and the caspase inhibitor p35, but saw no rescue of viability (Table 1). We additionally blocked cell death using the H99 deletion that removes the pro-apoptotic genes grim, rpr and hid [28,29]. We also expressed NetB in subsets of neurons linked to fertility (see below) using ilp7-GAL4 and tdc2-GAL4 [30,31] without effect. Finally, we attempted to increase midline glia function by transgenic RNAi knockdown of the Pten phosphatase, a negative regulator of EGFR signaling (and also implicated in fertility [32]). EGFR signaling is critical to midline glia function [33,34], but observed no effect on overall viability (Table 1).
Table 1. Viability is rescued in NetAB mutants by midline NetB expression and endogenous Netrin expression.
| Genotype | Rescue? | p value | Replicates |
|---|---|---|---|
| NetA(-)NetBmyc | Yes | 0.0016 | |
| NetAB; Y-dd4 | No | 0.0400 | |
| NetAB; elav::NetB | No | 0.1478 | 1 |
| NetAB; ilp7::NetB | No | 1 | |
| NetAB; rho::NetB | No | 2 | |
| NetAB; sca::NetB | No | 1 | |
| NetAB; sim::NetB | Yes | 0.000018 | |
| NetAB; tdc2::NetB | No | 0.0192 | |
| NetAB; elav::NetA | No | 2 | |
| NetAB; rho::NetA | No | 2 | |
| NetAB; sca::NetA | No | 2 | |
| NetAB; sim::NetA | No | 1 | |
| NetAB; elav::p35 | No | 0.3411 | 1 |
| NetAB; sca::p35 | No | ||
| NetAB; sim::p35 | No | 0.4570 | |
| NetAB; rho::p35 | No | ||
| NetAB; H99 | No | 2 | |
| NetAB; sim::ptenRNAi | No | ||
| NetAB; rho::ptenRNAi | No | 1 | |
| NetAB; elavGAL4 | No | ||
| NetAB; simGAL4 | No | 0.7421 |
Females heterozygous for NetAB were crossed to stocks so as to generate F1 NetAB males of the genotype listed and the number of adult NetAB males that emerged was recorded. The proportion of males was compared to that of control crosses, and Chi square analysis was performed on those crosses that produced more than the expected number of NetAB mutants (p value for these crosses only is shown). After Bonferroni Correction, significance is set at p < 0.0023 in comparison to NetAB within a Chi Square Analysis. Italics and bold font denote a statistically significant difference from NetAB.
Identification and analysis of hog, a third gene within the NetAB deletion
During analysis of the NetAB genomic locus, we noticed a small gene, CG32595, lying within a large intron of NetB (Figure 1B). We have named the gene hog, and the gene encodes a predicted forkhead associated domain, a binding site for phosphopeptides with a preference for phospho-threonine [35]. The hog mRNA pattern reflects that of NetB, with the addition of maternal deposition in the egg. A transposon, KG03586, inserted near the transcriptional start of hog was excised to generate two alleles lacking hog expression. Both alleles resulted in lack of hog mRNA, but like the parent KG03586 insertion, NetB mRNA expression was unaffected. All hog alleles are viable. The possibility that hog might contribute to the adult phenotypes described in this paper led us to include hog alleles in our analysis.
Egg laying defects in NetAB mutants
The homozygous NetAB stock was initially quite difficult to maintain. To understand why, we examined egg laying rate and egg viability in single females mated with a NetAB male (Figure 2). NetAB mutants, but not hog mutants, have significant reductions in both the number of eggs laid (p=0.0001, Tukey HSD, Figure 2A), and the percentage of eggs that hatched into larvae within 24 hours (p=0.0001, Tukey HSD, Figure 2B). These results suggest that hog does not contribute to the fertility defects observed in NetAB mutants. Embryos derived from NetAB mothers display similar axonal phenotypes to previously characterized NetAB mutants suggesting some eggs fail to hatch due to neuronal defects.
Figure 2. NetAB mutants, but not hog mutants, display an egg laying defect and a defect in egg viability.

(A) Mean number of eggs laid per female averaged over 7 days with a single male of same genotype in individual chambers. Egg laying in NetAB is significantly reduced compared to wild type (p=0.0001, Tukey HSD within a repeated-measures ANOVA), but not in hog (p=0.68). (B) Percentage of eggs hatched after 24 hours is significantly reduced in NetAB compared to wild type (p=0.0001, Tukey HSD within a one-way ANOVA), but again, not in hog (p=0.69). Arcsine transformation was performed on percentage of eggs hatched to satisfy assumptions of analysis of variance (not shown). Data shown in bar graphs are means ± s.e.m. wild type (n=11), hog (n=10), NetAB (n=10).
hog, but not NetAB is required for centripetal follicle cell migration
To understand the egg-laying phenotype of the NetAB flies, we examined oocyte development within the ovary. Oocyte development follows a stereotyped developmental program in which germline stem cells give rise to 16 cystocytes, one of which will become the oocyte [36]. The other 15 cystocytes develop into nurse cells that will deposit mRNAs and proteins into the oocyte that are required for egg development after fertilization [37,38]. At stage 10 of oogenesis somatic follicle cells migrate between the oocyte and the nurse cells, in a process termed centripetal migration [39,40]. The end result is a straight boundary between the oocyte and nurse cells (Figure 3A). Ovaries from females lacking NetAB or hog display subtle defects in the boundary with nurse cell nuclei found outside the follicle cells (Figure 3B) or protruding through the squamous follicular cells (Figure 3C). The phenotype appears to be solely due to the hog gene as NetAB mutants are statistically indistinguishable from hog mutants (p = 0.84, Figure 3C, D). The nurse cell phenotype has only been observed in stage 10-11 eggs in the ovary, suggesting that either this phenotype corrects itself later, or these eggs are eliminated from the population by reabsorption by the mother. It seems unlikely that this nurse cell migration defect has any consequences to the development of the egg.
Figure 3. hog and NetAB mutants display nuclear positioning defects within ovaries.
(A–C) Ovaries were stained with DAPI and analyzed with fluorescent microscopy to analyze nuclear position. (A) Wild type stage 10-11 eggs typically have a sharp boundary between the nurse cells and the developing oocyte (arrow). (B) hog mutants sometimes display nurse cell migration defects wherein a nurse cell lingers across this boundary (arrow). (C) NetAB mutants also display this nurse cell migration defect (arrow). (D) Mean percentage of stage 10-11 eggs that display nurse cell migration defects (*, p=0.007; **, p=0.0016; n.s. p=0.076). Hog heterozygotes fail to display nurse cell migration defects. Arcsine transformation was performed on percentage of eggs to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m. hog/wild type (n=10), hog (n=12), NetAB (n=11), hog/NetAB (n=10).
hog is required for normal eggshell formation
We used the 22c10 antibody to analyze ovary innervation of NetAB mutants (below) and noticed that a high level of non-specific background labeling frequently occurs. This labeling is restricted to the eggs and occurs in both hog and NetAB stocks giving the eggs a “hairy” appearance in the dissecting microscope (Figure S1B, C). This staining is not neuronal and resembles background expression seen when antibodies are used at too high of concentrations or when a blocking step is omitted. We counted the number of eggs within each ovary that displayed 22c10 antibody labeling and found the ectopic label was present in both hog and NetAB mutants at a much greater rate than in wild type (p=0.028, p=0.0006, respectively, Tukey HSD, Figure S1D). The number of labeled eggs was not statistically different between the hog and NetAB genotypes, so we conclude that the phenotype is specifically due to hog. The Drosophila eggshell consists of five layers formed by somatic follicle cells [41]. We hypothesize that hog is required for a subtle aspect of egg-shell formation that when disrupted allows ectopic binding of 22c10. A summary of hog defects is provided in Table 2.
Table 2. Summary of hog and NetAB oogenesis defects.
| Genotype | Eggs laid | Hatched | Nurse cell defect | 22c10 labeled |
|---|---|---|---|---|
| wild type | 49.2 | 83.3% | 0% | 17.7% |
| Hog | 44.9 | 71.3% | 7.0% | 59.7% |
| NetAB | 8.7 | 20.4% | 13.3% | 78.6% |
Column 1 lists the genotype quantified. Column 2 is the number of eggs laid by each genotype as the mean total number of eggs laid per female per day. Column 3 is the mean percentage of eggs that hatched after 24 hours. Column 4 lists the mean percentage of stage 10-11 eggs displaying a nurse cell migration defect in ovo. For this column, hog heterozygotes were used as the wild type control. Column 5 is the mean percentage of eggs labeled with 22c10 antibody in ovo. Italics and bold font indicate statistically significant differences from wild type.
Morphology and innervation of the NetAB reproductive tract
As the NetAB fertility defects did not appear to result from disruptions to oocyte development, we assessed dissected female reproductive tracts with light microscopy and could not distinguish any differences compared to wild type. Ovarian innervation was examined using the 22c10 antibody, and despite extensive comparisons we were unable to discern any differences in the pattern between wild type and mutant (Figure 4A, B). Prior studies have used the anti-HRP antibody [42], and we found that 22c10 labels the same nerve fibers and additional nerves that travel up the outside of the ovary from the base toward the apex (Figure 4C). We named these nerves the extra-ovarian nerves. These extra-ovarian nerves are present in both wild type and NetAB mutants, and we hypothesize that they help control contractions of the smooth ovarian muscles, which also continue up toward the apex [42,43].
Figure 4. Ovaries are innervated in NetAB mutants.

(A) Wild type ovary base. Each oviduct (arrowhead) and ovary is well innervated (arrows). (B) NetAB ovary base is also innervated (arrows). Arrowhead indicates one oviduct. (C) Wild type showing innervation toward the apex of the ovary (extra-ovarian nerves, arrows). Arrowhead indicates one oviduct. Note: The extra-ovarian innervation pattern is also present in NetAB mutants (not shown). Scale bars represent 10 micrometers.
Transgenic rescue of NetAB egg-laying defects
We attempted to rescue the egg-laying defect through targeted expression of NetA or NetB and downregulation of candidate genes potentially involved in Netrin pathways. We mated NetAB females carrying different transgenes to wild type males. Adding back one copy of NetB was sufficient to rescue NetAB (NetA ∆ NetB myc, p=0.046 compared to NetAB, n.s. when compared to outcrossed WT, Tukey HSD, Figure 5A). NetA ∆ NetB myc displayed the same pattern of egg-laying over a week as wild type and NetAB (Figure 5B). NetA and NetB are interchangeable in most functional assays such as midline or muscle expression, but only NetB can promote neuronal survival when expressed in neurons [22]. We were unable to rescue egg-laying by NetB expression at the CNS midline, pan-neuronally or in subsets of neurons linked to fertility (ilp7, Tdc2) [30,31] or by manipulating the insulin signaling pathway with Pten RNA interference [32] (Figure 5A). We also could not rescue by removing one copy of the enabled (ena) gene, a manipulation that rescues the embryonic CNS defects of NetAB [44]. Our results with the NetA ∆ NetB myc genotype demonstrate that Netrin function is required in females for normal egg-laying, but our failure to rescue the phenotype by targeted Netrin expression suggests that the distribution of cells requiring Netrin is likely to be highly complex. We also examined how many eggs hatched in the transgenic phenotypes as an additional control (Figure 5C). As expected, paternal rescue (the presence of a wild type X chromosome from the father) increases the number of hatching offspring to levels statistically indistinguishable from wild type females, and only one genotype negatively affected hatching rates.
Figure 5. NetAB egg laying defect is rescued by one copy of endogenous NetBmyc expression but not other manipulations.
(A) Mean eggs laid per female per day, averaged over 7 days with a wild type male. During the course of the work our wild type stock OreRS developed an egg-laying defect, so we used OreRS outcrossed to a derivative of the isogenic w - Exelixis stock as wild type “outcrossed WT”. NetAB is significantly different from wild type (p=0.00015, Tukey HSD within a repeated-measures ANOVA, *). NetA ∆ NetB myc rescues egg-laying (p=0.046 compared to NetAB, **, not significantly different from wild type, Tukey HSD within a repeated-measures ANOVA). Rescue was not observed with any other transgenic combination; all transgenic notation indicates one copy of each transgene (n ≥ 10 in all genotypes except NetAB; slit::NetB, n=8, NetAB; elav::p35, n=7, NetAB; simGAL4, n=5, NetAB; rho::p35, n=9). (B) Mean eggs laid per day follows similar patterns in wild type, NetA ∆ NetB myc, and NetAB mutants. Number of eggs laid per female tends to be low during first 24 hrs of introduction with male and also tends to decrease by the end of 7 days of laying. Data shown in graphs are means ± s.e.m. (C) Percentage of eggs hatched for each of the genotypes tested. Expression of NetB under control of slit-GAL4 decreases percentage of eggs fertilized (p=0.0012, Tukey HSD within a one-way ANOVA, n ≥ 10 in all genotypes except NetAB; slit::NetB, n=8, NetAB; elav::p35, n=7, NetAB; simGAL4, n=5, NetAB; rho::p35, n=9). Arcsine transformation was performed on percentage of eggs hatched to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m.
Courtship defects
To further understand the NetAB male fertility defects, we characterized in detail several courtship parameters (Figure 6, Table 3). Wild type male Drosophila court females with a stereotyped series of behaviors including approaching the females, tapping with a leg, species-specific wing vibrations “singing”, tasting and attempted copulation [45–48]. Two common assessments of courtship efficacy are latency to initiate courtship and courtship index (CI), a measure of the amount of time spent courting [49]. We found that neither latency nor CI was significantly different in NetAB males (Figure 6A, B). However, during observation, we discovered that rather than vibrating a single wing for the female, the NetAB male would often vibrate both wings simultaneously. Similar “mirror movements” have been observed in Netrin receptor mutant humans and mice [50,51]. The number of mirror movements was found to be significantly increased in NetAB mutants (p=0.012, Tukey HSD, Figure 6C, Table 3), but none of the genetic manipulations tested, including those known to rescue midline axon guidance [23,24,32], were successful in rescuing this phenotype. Additionally, we found that the severity of the mirror movement defects significantly correlated with all other defects, except total number of attempts (Table 4). The embryonic CNS axon phenotype of NetAB is quite variable [23–25], and it would be predicted that behavioral abnormalities of individuals would vary as well. The correlation observed between different courtship defects is evidence for this hypothesis.
Figure 6. Courtship parameters are unaffected in NetAB mutants but male behavior is altered.
(A) Latency to initiate courtship (the time for the first courtship specific behavior to occur) is unaffected in NetAB mutants. All transgenic notation indicates one copy of each transgene. Data shown in bar graph are means ± s.e.m. (B) Courtship index (amount of time spent by the male courting) is unaffected in NetAB mutants. All transgenic notation indicates one copy of each transgene. Arcsine transformation was performed to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m. (C) NetAB mutants display mirror movements during courtship behavior. This phenotype was not rescued by any manipulation attempted, including endogenous NetBmyc expression in the NetAB mutant. All transgenic notation indicates one copy of each transgene (w-not iso compared to NetAB, p=0.012, Tukey HSD within a one-way ANOVA). Arcsine transformation was performed on percentage of mirror movements to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m. n ≥ 9 in all genotypes except NetAB; UASptenRNAi, n=4 and 938 NetAB, n=5.
Table 3. NetAB males display mirror movements during courtship.
| Genotype | Latency | CI | Flies failing to court | Total attempts | Mirror mvt | Head end | No female | n |
|---|---|---|---|---|---|---|---|---|
| w- not iso | 244.1±63.4 | 0.629±.092 | 0% | 5.3±2.5 | 0±10.9% | 22.0±10.7% | 3.0±4.5% | 10 |
| NetAB | 126.1±63.4 | 0.517±0.097 | 10% | 8.2±2.5 | 53.5±11.5% | 17.3±11.3% | 10.3±4.8% | 10 |
| NetA(-) NetBmyc | 196.5±60.5 | 0.567±0.097 | 18% | 5.1±2.4 | 78.6±11.5% | 63.6±11.3% | 4.4±4.8% | 11 |
| NetAB; ena | 236.2±66.9 | 0.793±0.118 | 33% | 7.4±2.7 | 66.1±14.1% | 55.4±13.8% | 0±5.9% | 9 |
| NetAB; elav::NetA | 164.2±55.5 | 0.616±0.083 | 7% | 14.6±2.2 | 36.3±9.8% | 36.8±7.8% | 0±4.2% | 13 |
| NetAB; sim::NetA | 191.2±55.6 | 0.720±0.092 | 23% | 6.8±2.2 | 84.5±10.9% | 83.4±10.7% | 13.8±4.5% | 13 |
| NetAB; rho::NetA | 155.0±43.8 | 0.639±0.066 | 10% | 11.0±1.7 | 42.8±7.9% | 21.4±7.8% | 4.4±3.3% | 21 |
| NetAB; UASdNetA | 65.9±57.9 | 0.527±0.084 | 0% | 15.3±2.3 | 72.1±10.0% | 12.7±9.8% | 3.9±4.1% | 12 |
| NetAB; elav::NetB | 298.5±53.5 | 0.588±0.091 | 27% | 6.9±2.1 | 54.3±10.7% | 15.0±8.6% | 11.9±4.6% | 14 |
| NetAB; sca::NetB | 63.8±57.9 | 0.584±0.084 | 0% | 16.7±2.3 | 45.0±10.0% | 15.2±9.8% | 1.6±4.1% | 12 |
| NetAB; sim::NetB | 127.5±60.5 | 0.734±0.092 | 9% | 9.4±2.4 | 68.4±10.9% | 39.2±10.7% | 0±4.5% | 11 |
| NetAB; rho::NetB | 235.7±63.3 | 0.805±0.096 | 9% | 16.8±2.5 | 39.5±11.3% | 16.9±9.0% | 13.3±4.8% | 10 |
| NetAB; elav::p35 | 152.9±63.4 | 0.669±0.097 | 10% | 5.1±2.5 | 83.6±11.5% | 77.9±11.3% | 10.3±4.8% | 10 |
| NetAB; rho::p35 | 33.6±66.9 | 0.576±0.097 | 0% | 5.0±2.7 | 60.7±11.5% | 57.7±11.3% | 2.5±4.8% | 9 |
| NetAB; elav::ptenRNAi | 97.2±66.9 | 0.627±0.097 | 0% | 11.0±2.7 | 74.1±11.5% | 42.0±11.3% | 0.9±4.8% | 9 |
| NetAB; sim::ptenRNAi | 167.8±66.9 | 0.690±0.102 | 11% | 9.8±2.7 | 91.7±12.2% | 46.6±12.0% | 1.0±5.1% | 9 |
| NetAB; rho::ptenRNAi | 141.9±60.5 | 0.825±0.092 | 9% | 15.0±2.4 | 35.3±10.9% | 19.1±10.7% | 4.3±4.5% | 11 |
| NetAB; UASptenRNAi | 190.4±89.7 | 0.623±0.145 | 20% | 13.0±4.0 | 39.3±17.3% | 43.8±16.9% | 1.8±7.2% | 4 |
| NetAB; 5409 | 283.3±57.9 | 0.550±0.102 | 33% | 5.5±2.3 | 67.4±12.2% | 11.7±12.0% | 10.8±5.1% | 12 |
| NetAB; 938 | 170±89.7 | 0.491±0.130 | 0% | 9.6±3.6 | 60.9±15.4% | 13.0±15.2% | 10.0±6.4% | 5 |
The table lists the means of courtship parameters by genotype. Netrin mutants display deficits in symmetrical mirror movements during courtship (Mirror mvt), but not in the latency to initiate courtship (Latency), or in courtship index (CI; amount of time spent by the male courting), the total number of attempts at matings, percentage of attempts at the head end of the female, or the percentage of attempts without the female in the immediate vicinity of the male. Some transgenic manipulations resulted in an increase in these measures. Italics and bold font denote significant differences from wild type. Arcsine transformation was performed on CI, Mirror mvt, Head end, and No female to satisfy assumptions of analysis of variance (not shown). Data shown are means ± s.e.m. 938 and 5409 refer to the Bloomington Stock Center numbers for X chromosome duplications.
Table 4. Increase in defects in mirror movements correlates with defects in other courtship measures, except total attempts.
| Mean | St. dev. | Latency | Total attempts | No female | Head end | Mirror mvt | CI | |
|---|---|---|---|---|---|---|---|---|
| Latency | 109.0158 | 133.9864 | 1.000000 | -0.260789 | -0.055797 | -0.084951 | -0.231999 | -0.072996 |
| Total attempts | 11.2158 | 8.3350 | -0.260789 | 1.000000 | -0.097480 | -0.224753 | -0.012573 | 0.066986 |
| No female | 0.0531 | 0.1443 | -0.055797 | -0.09748 | 1.000000 | 0.240627 | 0.227319 | 0.173985 |
| Head end | 0.3415 | 0.3384 | -0.084951 | -0.224753 | 0.240627 | 1.000000 | 0.382957 | 0.138039 |
| Mirror mvt | 0.5644 | 0.3866 | -0.231999 | -0.012573 | 0.227319 | 0.382957 | 1.000000 | 0.291351 |
| CI | 0.6383 | 0.2877 | -0.072996 | 0.066986 | 0.173985 | 0.138039 | 0.291351 | 1.000000 |
Correlation matrix showing associations between various courtship parameters measured in all genotypes. Italics and bold font note significant correlations.
Flight defects
The mirror movements occurring during courtship prompted us to examine the normal use of wings in NetAB flies. NetAB mutants are unable to fly, perhaps due to flight muscle innervation defects as the wings are frequently held out at an angle and droop slightly or alternatively, due to bilateral coordination problems. However, flight can be rescued by pan-neuronal expression of NetA (p=0.0000, Two-tailed Fischer Exact Test, Table 5) or by blocking apoptosis with pan-neural expression of the p35 caspase inhibitor (p=0.0006, Table 5). As pan-neural NetA expression increases midline crossing defects in the CNS, and NetA has not been observed to be neurotrophic, and can actually be pro-apoptotic in some contexts [22], we are unsure how to interpret these results. It is clear that the mechanisms underlying the flight defects are fundamentally different from those involved in courtship.
Table 5. Flight is rescued by pan-neuronal expression of NetA, but not NetB, and by pan-neuronal expression of p35.
| Genotype | N | Fly | p value |
|---|---|---|---|
| w-not iso | 36 | 36 | 0.0000 |
| NetAB | 17 | 0 | |
| NetAB; elav::NetA | 61 | 40 | 0.0000 |
| NetAB; elav::NetB | 14 | 1 | 1.0000 |
| NetAB; elav::p35 | 61 | 11 | 0.0006 |
| NetAB; elavGAL4 | 37 | 2 | 0.4932 |
| NetAB; rho::NetA | 22 | 3 | 0.2326 |
| NetAB; sca::NetA | 2 | 2 | 0.3333 |
| NetAB; sca::NetB | 34 | 6 | 0.246 |
| NetAB; UASdNetA | 14 | 4 | 0.0978 |
| NetAB; UASdNetB | 38 | 1 | 1.0000 |
| NetAB; UASp35 | 13 | 1 | 1.0000 |
Flies of each genotype were tested for their ability to fly; “n” is the number tested and “Fly” is the number that flew. After Bonferroni Correction, significance is set at p < 0.0042 in comparison to NetAB within a two-tailed Fischer Exact Test. Italics and bold font denote significance.
Both sexes contribute to the NetAB egg laying defects
To further understand how the Netrins might be affecting egg-laying ability, the role of the NetAB genotype in pairwise combinations with wild type flies was examined. Surprisingly, when wild type females were mated to NetAB males, there was a significant reduction in the number of eggs laid compared to wild type males (p=0.0246, Student’s T-test, Figure 7). Although uncoordination of the males might decrease courting success and egg laying, we did not observe differences in courtship (see below). It is therefore possible that NetAB male sperm composition is altered affecting fecundity [52]. NetAB males also had a decreased number of eggs hatching from wild type mothers (Figure 7B), even though all of the eggs should be wild type or heterozygous for NetAB. When NetAB females were mated to NetAB or wild type males the reduction in egg-laying observed was not quite significant (p=0.058, Student’s t-test, Figure 7C). We suspect this could be due to a floor effect (the data cannot take on lower values) as NetAB females frequently fail to lay eggs altogether on any given day. As expected, paternal rescue (the presence of a wild type X chromosome from the father) increases the number of eggs hatching from NetAB mothers (p=0.030, Tukey HSD within a one-way ANOVA, Figure 7D). If unsuccessful fertilization is the cause of the reduced egg-laying, then more eggs should be laid with time. Time course experiments during one week indicate that this is not the case as the number of eggs laid plateaus after 24 hours (Figure 5B), a pattern that resembles wild type flies albeit with greater numbers. In summary, NetAB females lay significantly less eggs than wild type and NetAB males contribute significantly to reduced egg-laying, even in wild type females.
Figure 7. Number of eggs laid by females is decreased by the presence of NetAB males compared to wild type males.
(A) Mean number of eggs laid is significantly decreased in wild type females when the male is NetAB (p = 0.0246, Student’s t-test). (B) The percentage of eggs hatched is significantly decreased when the male is NetAB in both wild type females (p = 0.026, Tukey HSD within a one-way ANOVA). (C) When the mated female is NetAB, the difference between wild type and NetAB males on the mean number of eggs laid is borderline significant (p=0.058, Student’s T-test). (D) The percentage of eggs hatched when the mated female is NetAB is still significantly reduced when the male is also NetAB (p = 0.030, Tukey HSD within a one-way ANOVA). Arcsine transformation was performed on percentage of eggs hatched to satisfy assumptions of analysis of variance (not shown). Data shown in bar graphs are means ± s.e.m. wild type/wild type (n=11), wild type/NetAB (n=9), NetAB/wild type (n=8), NetAB/NetAB (n=10).
Discussion
This work characterizes the adult phenotypes of mutants lacking both the Drosophila Netrin genes. We have previously reported locomotor and negative geotaxis defects in NetAB mutants that can be rescued in part by inhibition of apoptotic signaling or pan-neural expression of NetB [22]. In this study we focus on the fertility defects of NetAB mutants and also describe viability and flight phenotypes. Our results indicate that the Netrins are highly pleiotropic genes affecting multiple systems as have been observed in other species [3].
We identified and exclude a role for the hog gene in NetAB phenotypes. The location of hog within the NetB gene appears to be purely the result of chance, as homologues of hog in other Drosophila species are not located within NetB. The non-specific binding of the 22c10 antibody to hog mutant eggs suggests that hog is required for eggshell formation, but in a very subtle manner as egg viability is unaffected.
Flying requires advanced coordination between the two sides of the body, so it is not surprising that it is affected in NetAB mutants. The defects observed could be due to failure to innervate flight muscles [53] or failures in interneuron connectivity in the CNS [54]. Rescue of flight by pan-neural expression of the caspase inhibitor p35 indicates a neural origin for the phenotype. Flight was also rescued by pan-neural expression of NetA, which was surprising as we have previously demonstrated that pan-neural expression of NetA increases axon guidance errors in the embryonic CNS [22]. Nevertheless, pan-neural NetA expression can rescue the locomotor defects of NetAB flies suggesting that NetA expression may have a context dependent beneficial effect in a brain region controlling both behaviors such as the central complex [55,56].
NetAB males also display hyper-coordination of wing movements during the singing phase of courtship behavior. This behavior is strikingly similar to the mirror movements observed in human and mouse DCC Netrin receptor mutants [50,51]. This phenotype was resistant to rescue by all the manipulations attempted, including restoration of one copy of endogenous NetB and midline NetA expression, suggesting that the behavior relies on the localized expression of NetA at a non-midline location. Alternatively, the behavior may rely on both NetA and NetB in independent roles.
NetAB females lay fewer eggs than wild type. The origin of this phenotype does not appear to be in oocyte or ovarian development. Ovulation is regulated at multiple levels including octopaminergic neurons innervating the reproductive tract [57], secretory cells in the spermathecae and parovaria glands [58] as well as cell populations in the CNS [43,59,60]. Disruption to any one or more of these systems could be sufficient to produce the reduced egg-laying seen in NetAB mutants. Drosophila females display a post-mating switch in which increased egg-laying and decreased mating receptivity is triggered by proteins in the male semen [61]. The neuronal circuits stimulated by these proteins [62,63] could also be disrupted in NetAB mutants. Our transgenic manipulations focused on the classical roles for Netrins at the CNS midline as well as more recent roles as neuronal survival factors. None of these manipulations restored egg-laying, so we cannot discern whether there is a local disruption of signaling in the reproductive tract or a broader disruption of multiple cell populations (including non-neural tissues). We have occasionally observed females in which an egg has been released from each ovary simultaneously, and these eggs appear jammed at the confluence of the common oviduct. We therefore favor the hypothesis that ovulation is disrupted by the NetAB mutations.
NetAB males induce reduced egg-laying in the females they mate with. Viable offspring are produced demonstrating that mating is successful, but the normal post-mating increase in egg-laying may be diminished or absent. This suggests that transfer of sperm proteins or seminal fluid (SSFT) may be disrupted. SSFT requires a male specific neural circuit [64], and the transfer of sperm can be genetically separated from seminal protein/fluid transfer by feminizing a small subset of cholinergic neurons [65]. Netrin mutations may be affecting one or more of these neural subsets with a deleterious effect on SSFT.
This discussion of the phenotypes observed has focused on the classical roles of Netrins in cell migration, neural connectivity and also survival. It is quite possible that the Netrins could be modulating neuronal activity in the adult animal, as the Netrin receptor DCC has been shown to modulate synaptic strength in mice [66]. As noted above, altered activity in ovarian nerves is associated with infertility in humans [21].
To address the function of the Netrins in these fertility defects, there are many possible future directions. Promoter fragments fused to GAL4 for both NetA and NetB are now available [67,68] and testing the ability of NetA or NetB driven by these lines to rescue the defects in NetAB flies would likely allow the site of Netrin action to be identified. The anatomy of surrounding nerves and tissues could then be examined. Localization of the Netrin proteins in pupal and adult tissues using antibody reagents would also assist in analyzing Netrin function [69]. Functional assays of oviduct contraction would allow ovulation to be examined directly and also the role of sperm proteins to be tested [42]. Finally, the fra Netrin receptor can produce homozygous adults that could be tested for similar defects.
Conclusions
The Drosophila Netrin genes are required in both male and female flies for optimum fertility. NetAB mutants also display decreased viability, a failure to fly, and males exhibit hyper-coordination of wings during courtship. All behaviors are rescued by restoring one copy of endogenous NetB. Flight is surprisingly restored by pan-neuronal expression of NetA, but not NetB. The control of egg-laying may reside in multiple tissues or there is a very specific requirement that is not addressed by the drivers used in this study. Future work identifying the precise positional and temporal requirements for the Netrins will provide insight into how the Netrins function in egg-laying and other adult phenotypes.
Materials and Methods
Genetics
The following wild type strains were used for analysis: Oregon R (OreR), OreRS, w - not iso, and OreRS outcrossed to w - not iso (Outcrossed WT) (w - not iso is a healthier derivative of the Exelixis isogenic w stock). During the course of these egg laying experiments OreRS developed an egg-laying defect (compare Figure 5A to Figure 2A). We therefore outcrossed OreRS to w - not iso, and this rescued the OreRS egg laying defect (“Outcrossed WT”, Figure 4A). The NetAB MB23 deletion was obtained from B. Dickson and the presence of the NetAB deletion repeatedly confirmed by PCR, using the primers 5’ TAGCCGGTCAGTAATTTACC 3’ and 5’ TGAAGGATACGTCTACTACTGAG 3’. The NetAB MB23 stock (a deletion encompassing NetA, NetB, and hog) was recombined with g if f to generate the adult viable line used in this study. Recombination resulted in a single hemizygous Netrin deletion mutant male that proved fertile. A stock was developed from this male by backcrossing to NP5/FM7 females and selecting the appropriate progeny. We named the stock NetAB ∆GN, but refer to the stock as NetAB from here on for simplicity. For fertility and antibody labeling: Oregon R, NetAB, hogB were used. Strains for nurse cell nuclear phenotypes: hog/w-not iso, hogB, hogB/NetAB, NetAB. The KG03586 transposon and transposase stocks were obtained from the Bloomington Drosophila stock center. Excision of the KG03586 insertion was by standard techniques. Additional stocks used were obtained from the Bloomington stock Center or the labs listed in the acknowledgments. Stocks used or generated in this study: NetAB/FM7, NetAB/FM7; UAS-dNetA, NetAB/FM7; UAS-dNetB, NetAB/FM7; UAS-ptenRNAi, NetAB/FM7; UAS-p35, NetAB/FM7; UAS-CD8-GFP, NetAB/FM7; elav-GAL4, NetAB/FM7; slit-GAL4, NetAB/FM7; sim-GAL4, NetAB/FM7; sca-GAL4, NetAB/FM7; rho-GAL4, NetAB/FM7; ilp7-GAL4, ena 23 /CyOWgβ, H99/TM3, NetA Δ NetB myc. X chromosome duplications used (Bloomington Stock Center identification numbers): 901, 936, 938, 1527, 5409, 5594, 6251, 9144, 30235, 30236, 30237, 30260, 30261.
Immunohistochemistry
Embryonic immunohistochemistry was performed as described in [70]. For ovarian immunohistochemistry, ovaries from each female were dissected in 1X PBS after the fertility assay had been performed. Ovaries were immediately fixed in 4% paraformaldehyde 2X PBS solution or 1:10 37% formaldehyde 1X PBS solution for 45 mins. (Note: no difference was found between fixatives.) Ovaries were rinsed with 1X PBS 0.1% Triton solution (PT) and blocked with 10% NGS PT solution for 15 mins prior to antibody label. 22c10 monoclonal antibody was applied overnight at 4 degrees C. Ovaries were again washed with PT solution and blocked for 15 mins prior to anti-mouse-HRP secondary antibody. Secondary antibody was applied overnight at 4 degrees C. After wash in PT, DAB solution was applied for 30 mins. Ovaries were immersed in 70% glycerol and analyzed under light. Only eggs visible from the position of the ovary on the slide were counted. Therefore, numbers reported represent a sample of the total egg numbers. Statistical analysis was performed using a Tukey HSD within a one-way ANOVA. Arcsine transformation was performed to satisfy the assumptions of analysis. Data shown in bar graphs are means ± s.e.m.
Nurse cell nuclear phenotypes
Cell nucleus labeling was performed using DAPI stain on ovaries. Females of each genotype and wild type males were placed in cages together with grape agar and a small amount of yeast for three to four days from day of birth in a 25 degree C humidity-controlled environmental chamber. On the final day, ovaries from females of each genotype were dissected intact in 1X PBS. Ovaries were immediately fixed in 1:10 37% formaldehyde 1X PBS solution for 45 mins. Formaldehyde solution was rinsed with 1X PBS, and then ovaries were placed in 1X PBS with 0.1% Triton detergent. Ovaries were then mechanically disrupted to facilitate stain penetration. Ovaries were placed in DAPI 1:1000 1X PBS solution for 2 mins. Egg stage was assessed under fluorescent microscopy using the stages outlined by [71], and the total number of eggs at each stage (only stages 10-14) was recorded. Experimenters were blind to genotype during recording. Nurse cell migration defects were defined as any nurse cell crossing the boundary between the nurse cells and the developing egg at stage 10 or 11. Percentage of nurse cell defects is reported as a percentage of the total number of eggs at stage 10 and 11 in each fly. Statistical analysis was performed using a Tukey HSD within a one-way ANOVA. Arcsine transformation was performed to satisfy the assumptions of analysis. Data shown in bar graphs are means ± s.e.m.
Viability
A reference cross of NetAB/Y (X) NetAB/FM7 was performed, and the number of offspring of each gender and genotype was counted. The proportion of each genotype arising from this cross was used to generate the expected genotypic values for Chi Square analysis. A statistical increase from this expected number of NetAB offspring was considered a rescue. If the Chi Square test resulted in significance, false positive results due to changes in the sex-ration were additionally ruled out. Each cross had a minimum of 5 flies of each gender, but the number of parentals varied. Some crosses were replicated as indicated by Tables 1 and 2. The Bonferroni Correction was applied to set statistical significance at p < 0.0023 for this assay. Flies were examined for anatomical defects of the thorax, and were scored as defective if any disruption to the normal pattern was present including central invaginations, asymmetry between the two sides of the thorax and missing wings. The number of thorax defects was recorded for wild type and NetAB strains.
Behavioral Assays
NetAB flies with thorax defects (partial absence of thorax or deformity) were found to be entirely sterile so were excluded from all analyses except viability. All statistical analyses were performed with Statistica Software (Statsoft), or Excel (Microsoft) for Chi Square. Significance was set at p < 0.05. Data shown in all bar graphs are means ± s.e.m.
Fertility
Fertility was assessed by counting the number of eggs laid by each female in individual mating chambers for 7 days. Wild type males and females of each genotype were collected, separated on day of birth by gender, and placed in a 60% humidity-controlled incubator at 18 degrees C for 3 days on Jazz mix (sugar/yeast) to age. On the third day, each female was placed with one male in each individual mating chamber and placed on grape agar with a dab of yeast in a 25 degree incubator at 50% humidity. The grape agar/yeast was changed daily, and eggs were counted for 7 consecutive days. After eggs were counted, each agar plate was kept at 25 degrees C for another 24 hours to count how many of those hatched. For the first assay comparing wild type (OreR), hog, and NetAB females, males were of the same genotype as the females. Numbers of eggs laid and hatched under this condition were then compared to females of each genotype mated to individual wild type (OreR) males. For all transgenic analyses of egg laying, male was wild type. Data for chambers in which either member of the single pair died before the end of the 7 days was discarded. Time of collection was recorded, but not reported here. Statistical analysis was performed using a Tukey HSD within a repeated-measures ANOVA for number of eggs laid or a Student’s T-test for the comparison the contribution to number of eggs laid with wild type males and NetAB males. For percentage of eggs hatched, statistical analysis was performed using a Tukey HSD within a one-way ANOVA. Arcsine transformation was performed to satisfy assumptions of the analysis of variance.
Courtship
Courtship was assessed in hand-built, individual courtship chambers, constructed by Brian Kenton, Mechanical Engineering Department, UNR. Generally, this courtship assay was modeled after [49]. The courtship device was manufactured from two sheets of Plexiglas. Chambers were drilled into one sheet, while the other served as a trap door and transparent cover through which to video. Each chamber measured approximately 11mm in diameter and 5mm deep. 350 µL grape agar was placed in the bottom of the chamber prior to assay, limiting the vertical space to about two fly heights. One male was placed in the chamber via a mouth pipette and allowed to acclimate for 5mins. During acclimation of the male, a wild type (Oregon R) female was anesthetized under CO2, then decapitated and allowed to return to a standing position. The decapitated female was then placed with the male, and video recording began immediately. Each video session lasted 10 mins (600 secs) and was later analyzed for the following criteria: 1) latency to initiate courtship (defined as the time from female introduction until the first courtship attempt), 2) courtship index, (total time spent courting/(total time – latency), (CI), 3) the percentage of males that failed to initiate courtship in the 10 min trial period (no attempts), 4) number of times male attempted courtship (total attempts), 5) the percentage of total attempts where the male vibrated both wings simultaneously (mirror movements), 6) the percentage of total attempts where the male was at the head of the female (head end), and 7) the percentage of total attempts where the female was absent from the immediate vicinity (no female). Mirror movements, head end, and no female, were not mutually exclusive categories, but each could only be scored once per attempt. If a male failed to initiate courtship during the allotted 10 mins, he was given a courtship latency score of 601 secs. These males were excluded from analysis of CI, mirror movements, head end, and no female. Statistical analysis was performed using a Tukey HSD within a one-way ANOVA. Arcsine transformation was performed to satisfy assumptions of analysis of variance on CI, mirror movements, head end, and no female. A correlation matrix was performed to assess possible correlations among the measurements. 3 flies were excluded from analysis due to data entry errors. Experimenter was blind to the genotype during analysis.
Flight
Flying ability was assessed by dropping individual flies from their vials onto the lab bench. Each fly that escaped by flight was recorded in the affirmative for flying ability. We compared the observed number of fliers verses non-fliers of each genotype to the expected number of fliers verses non-fliers observed in NetAB (0 of 17) using a two-tailed Fischer Exact test. Bonferroni correction was applied to set statistical significance at p < 0.0042 for this assay.
Supporting Information
NetAB and hog mutants display ectopic antibody labeling phenotypes in the developing eggs. (A) Wild type ovaries. 22c10 antibody normally labels axons of nerves, and fails to label developing eggs in the ovary. (B) In hog mutants, 22c10 antibody non-specifically labels inside most of the eggs, penetrating in hair-like tracts. (C) NetAB mutants display ectopic 22c10 label similar to hog mutants in developing eggs. (D) Mean percentage of ovarian eggs ectopically labeled. hog and NetAB mutants are significantly different from wild type (*, p=0.028, **, p=0.0006 respectively, Tukey HSD within a one-way ANOVA). Arcsine transformation was performed on percentage of eggs hatched to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m. wild type (n=11), hog (n=10), NetAB (n=10).
(TIF)
Acknowledgments
We thank B. Kenton for the manufacture of the courtship chamber, A. Ejima for courtship protocols and advice, R. Lehmann for advice on oocyte staging, and M. Forrister and V. Pravosudov for help with statistical analysis. We thank B. Dickson, M. Brankatschk, B. Altenhein, E. Giniger, M. Seeger and A. DiAntonio for stocks and reagents. We thank A. Bousum, D. Tailor and S. Hugdal for advice and technical assistance, A. Keene and E. Justice for comments on the manuscript. Antibodies were obtained from the Developmental Studies Hybridoma Bank (DHSB) developed under the auspices of the NICHD and maintained by the University of Iowa.
Funding Statement
This project was supported by grants from the National Science Foundation IOS-1052555, National Center for Research Resources (P20RR016464, 5P20RR024210) and the National Institute of General Medical Sciences (8 P20 GM103554) from the National Institutes of Health (TK). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Hedgecock EM, Culotti JG, Hall DG (1990) The unc-5, unc-6 and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans. Neuron 4: 61-85. doi:10.1016/0896-6273(90)90444-K. PubMed: 2310575. [DOI] [PubMed] [Google Scholar]
- 2. Serafini T, Kennedy TE, Galko MJ, Mirzayan C, Jessell TM, Tessier-Lavigne M (1994) The netrins define a family of axon outgrowth-promoting proteins homologous to C. elegans UNC-6. Cell 78: 409-424. doi:10.1016/0092-8674(94)90420-0. PubMed: 8062384. [DOI] [PubMed] [Google Scholar]
- 3. Wing Sun Lai K, Correla JP, Kennedy TE (2011); Netrins (2011) versatile extracellular cues with diverse functions. Development 138: 2153-2169 doi:10.1242/dev.044529. PubMed: 21558366. [DOI] [PubMed]
- 4. Ko SY, Dass CR, Nurgali K (2012) Netrin-1 in the developing enteric nervous system and colorectal cancer. Trends Mol Med 18: 544-554. doi:10.1016/j.molmed.2012.07.001. PubMed: 22920895. [DOI] [PubMed] [Google Scholar]
- 5. Larrieu-Lahargue F, Thomas KR, Li DY (2012) Netrin ligands and receptors: lessons from neurons to the endothelium. Trends Cardiovasc Med 22: 44-47. doi:10.1016/j.tcm.2012.06.010. PubMed: 22841834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Trent C, Tsuing N, Horvitz HR (1983) Egg laying defective mutants of the nematode Caenorhabditis elegans. Genetics 104: 619-647. PubMed: 11813735. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Asakura T, Ogura K, Goshima Y (2007) UNC-6 expression by the vulval precursor cells of Caenorhabditis elegans is required for the complex axon guidance of the HSN neurons. Dev Biol 304: 800-810. doi:10.1016/j.ydbio.2007.01.028. PubMed: 17320069. [DOI] [PubMed] [Google Scholar]
- 8. Estes KA, Hanna-Rose W (2009) The anchor cell initiates dorsal lumen formation during C. elegans vulval tubulogenesis. Dev Biol 328: 297-304. doi:10.1016/j.ydbio.2009.01.034. PubMed: 19389356. [DOI] [PubMed] [Google Scholar]
- 9. Ziel JW, Hagedorn EJ, Audhya A, Sherwood DR (2009) UNC-6 (netrin) orients the invasive membrane of the anchor cell in C. elegans. Nat Cell Biol 11: 183-189. doi:10.1038/ncb1825. PubMed: 19098902. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Merz DC, Zheng H, Killeen MT, Krizus A, Culotti JG (2001) Multiple signaling mechanisms of the UNC-6/netrin receptors UNC-5 and UNC-40/DCC in vivo . Genetics 158: 1071-1080. PubMed: 11454756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Deiner MS, Sretavan DW (1999) Altered midline axon pathways and ectopic neurons in the developing hypothalamus of Netrin-1- and DCC-deficient mice. J Neurosci 19: 9900-9912. PubMed: 10559399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Schwarting GA, Raitcheva D, Bless EP, Ackerman SL, Tobet S (2004) Netrin 1-mediated chemoattraction regulates the migratory pathway of LHRH neurons. Eur J Neurosci 19: 11-20. doi:10.1111/j.1460-9568.2004.03094.x. PubMed: 14750959. [DOI] [PubMed] [Google Scholar]
- 13. Murakami S, Ohki-Hamazaki H, Watanabe K, Ikenaka K, Ono K (2010) Netrin 1 provides a chemoattractive cue for the ventral migration of GnRH neurons in the chick forebrain. J Comp Neurol 518: 2019-2034. doi:10.1002/cne.22319. PubMed: 20394056. [DOI] [PubMed] [Google Scholar]
- 14. Low VF, Fiorini Z, Fisher L, Jasoni CL (2012) Netrin-1 stimulates developing GnRH neurons to extend neuritis to the median eminence in a calcium-dependent manner. PLOS ONE 7: e46999. doi:10.1371/journal.pone.0046999. PubMed: 23056554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R et al. (1996) Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 87: 1001-1014. doi:10.1016/S0092-8674(00)81795-X. PubMed: 8978605. [DOI] [PubMed] [Google Scholar]
- 16. Bliss SP, Navratil AM, Xie J, Roberson MS (2010) GnRH signaling, the gonadotrope and endocrine control of fertility. Front Neuroendocrinol 31: 322-340. doi:10.1016/j.yfrne.2010.04.002. PubMed: 20451543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Cariboni A, Pimpinelli F, Colamarino S, Zaninetti R, Piccolella M et al. (2004) The product of the X-linked Kallmann’s syndrome gene (KAL1) affects the migratory activity of gonadotropin-releasing hormone (GnRH)-producing neurons. Hum Mol Genet 13: 2718-2791. [DOI] [PubMed] [Google Scholar]
- 18. Maeda A, Matsuda F, Goto Y, Cheng Y, Gonda H et al. (2008) Molecular cloning of a porcine (Sus scrofa) apoptosis inhibitory ligand, netrin-1, and its receptor, p53RDL1. J Reprod Dev 54: 275-280. doi:10.1262/jrd.20044. PubMed: 18497489. [DOI] [PubMed] [Google Scholar]
- 19. Basini G, Cortimiglia C, Baioni L, Bussolati S, Grolli S et al. (2011) The axonal guidance factor netrin-1 as a potential modulator of swine follicular function. Mol Cell Endocrinol 331: 41-48. doi:10.1016/j.mce.2010.08.001. PubMed: 20696210. [DOI] [PubMed] [Google Scholar]
- 20. Lara HE, Dorfman M, Venegas M, Luza SM, Luna SL et al. (2002) Changes in sympathetic nerve activity of the mammalian ovary during a normal estrous cycle and in polycystic ovary syndrome: studies on norepinephrine release. Microsc Res Tech 59: 495-502. doi:10.1002/jemt.10229. PubMed: 12467025. [DOI] [PubMed] [Google Scholar]
- 21. Sverrisdóttir YB, Mogren T, Kataoka J, Janson PO, Stener-Victorin E (2008) Is polycystic ovary syndrome associated with high sympathetic nerve activity and size at birth? Am J Physiol Endocrinol Metab 294: E576-E581. doi:10.1152/ajpendo.00725.2007. PubMed: 18198350. [DOI] [PubMed] [Google Scholar]
- 22. Newquist G, Drennan JM, Lamanuzzi M, Walker K, Clemens JC, Kidd T (2013) Blocking apoptotic signaling rescues axon guidance in Netrin mutants. Cell Rep 3: 595-605. doi:10.1016/j.celrep.2013.02.017. PubMed: 23499445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Mitchell KJ, Doyle JA, Serafini T, Kennedy TE, Tessier-Lavigne M et al. (1996) Genetic analysis of netrin genes in Drosophila: Netrins guide CNS commissural axons and peripheral motor axons. Neuron 17: 203-215. doi:10.1016/S0896-6273(00)80153-1. PubMed: 8780645. [DOI] [PubMed] [Google Scholar]
- 24. Harris R, Sabatelli M, Seeger MA (1996) Guidance cues at the Drosophila CNS midline: identification and characterization of two Drosophila Netrin/UNC-6 homologs. Neuron 17: 217-228. doi:10.1016/S0896-6273(00)80154-3. PubMed: 8780646. [DOI] [PubMed] [Google Scholar]
- 25. Brankatschk M, Dickson BJ (2006) Netrins guide commissural axons at short range. Nat Neurosci 9: 188-194. doi:10.1038/nn1625. PubMed: 16429137. [DOI] [PubMed] [Google Scholar]
- 26. Dorsten JN, VanBerkum MF (2008) Frazzled cytoplasmic P-motifs are differentially required for axon pathway formation in the Drosophila embryonic CNS. Int J Dev Neurosci 26: 753-761. doi:10.1016/j.ijdevneu.2008.07.004. PubMed: 18674607. [DOI] [PubMed] [Google Scholar]
- 27. Kuzina I, Song JK, Giniger E (2011) How Notch establishes longitudinal axon connections between successive segments of the Drosophila CNS. Development 138: 1839-1849. doi:10.1242/dev.062471. PubMed: 21447553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. White K, Grether ME, Abrams JM, Young L, Farrell K, Steller H (1994) Genetic control of programmed cell death in Drosophila. Science 264: 677-683. doi:10.1126/science.8171319. PubMed: 8171319. [DOI] [PubMed] [Google Scholar]
- 29. Grether ME, Abrams JM, Agapite J, White K, Steller H (1995) The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes Dev 9: 1694-1708. doi:10.1101/gad.9.14.1694. PubMed: 7622034. [DOI] [PubMed] [Google Scholar]
- 30. Yang CH, Belawat P, Hafen R, Jan LY, Jan JN (2008) Drosophila egg-laying site selection as a system to study simple decision-making processes. Science 319: 1679-1683. doi:10.1126/science.1151842. PubMed: 18356529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Cole SH, Carney GE, McClung CA, Willard SS, Taylor BJ, Hirsh J (2005) Two functional but noncomplementing Drosophila tyrosine decarboxylase genes. J Biol Chem 280: 14948-14955. doi:10.1074/jbc.M414197200. PubMed: 15691831. [DOI] [PubMed] [Google Scholar]
- 32. Arik AJ, Rasgon JL, Quicke KM, Riehle MA (2009) Manipulating insulin signaling to enhance mosquito reproduction. BMC Physiol 9: 15. doi:10.1186/1472-6793-9-15. PubMed: 19695103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Scholz H, Sadlowski E, Klaes A, Klämbt C (1997) Control of midline glia development in the embryonic Drosophila CNS. Mech Dev 64: 137-151. doi:10.1016/S0925-4773(97)90017-4. PubMed: 9232604. [DOI] [PubMed] [Google Scholar]
- 34. Stemerdink C, Jacobs JR (1997) Argos and Spitz group genes function to regulate midline glial cell number in Drosophila embryos. Development 124: 3787-3796. PubMed: 9367434. [DOI] [PubMed] [Google Scholar]
- 35. Mahajan A, Yuan C, Lee H, Chen ES, Wu PY, Tsai MD (2008) Structure and function of the phosphothreonine-specific FHA domain. Sci Signal 1: e12 PubMed: 19109241. [DOI] [PubMed] [Google Scholar]
- 36. Bastock R, St Johnston D (2008) Drosophila oogenesis. Curr Biol 18: 1082-1087. doi:10.1016/j.cub.2008.09.011. PubMed: 19081037. [DOI] [PubMed] [Google Scholar]
- 37. Kugler JM, Lasko P (2009) Localization, anchoring and translational control of oskar, gurken, bicoid and nanos mRNA during Drosophila oogenesis. Fly 3: 15-28. doi:10.4161/fly.3.1.7751. PubMed: 19182536. [DOI] [PubMed] [Google Scholar]
- 38. Tadros W, Lipshitz HD (2009) The maternal-to-zygotic transition: a play in two acts. Development 136: 3033-3042. doi:10.1242/dev.033183. PubMed: 19700615. [DOI] [PubMed] [Google Scholar]
- 39. Dobens L, Jaeger A, Peterson JS, Raftery LA (2005) Bunched sets a boundary for Notch signaling to pattern anterior eggshell structures during Drosophila oogenesis. Dev Biol 287: 425-437. doi:10.1016/j.ydbio.2005.09.019. PubMed: 16223477. [DOI] [PubMed] [Google Scholar]
- 40. Levine B, Hackney JF, Bergen A, Dobens L, Truesdale A, Dobens L (2010) Opposing interactions between Drosophila Cut and C/EBP encoded by Slow Border Cells direct apical constriction and epithelial invagination. Dev Biol 344: 196-209. doi:10.1016/j.ydbio.2010.04.030. PubMed: 20450903. [DOI] [PubMed] [Google Scholar]
- 41. Cavaliere V, Bernardi F, Romani P, Duchi S, Gargiulo G (1998) Building up the Drosophila eggshell: First of all the eggshell genes must be transcribed. Dev Dyn 237: 2061-2072. PubMed: 18651659. [DOI] [PubMed] [Google Scholar]
- 42. Middleton CA, Nongthomba U, Parry K, Sweeney ST, Sparrow JC, Elliott CJ (2006) Neuromuscular organization and aminergic modulation of contractions in the Drosophila ovary. BMC Biol 4: 17. doi:10.1186/1741-7007-4-17. PubMed: 16768790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Rodríguez-Valentín R, López-González I, Jorquera R, Labarca P, Zurita M, Reynaud E (2006) Oviduct contraction in Drosophila is modulated by a neural network that is both, octopaminergic and glutamergic. J Cell Physiol 209: 183-198. doi:10.1002/jcp.20722. PubMed: 16826564. [DOI] [PubMed] [Google Scholar]
- 44. Forsthoefel DJ, Liebl EC, Kolodziej PA, Seeger MA (2005) The Abelson tyrosine kinase, the Trio GEF, and Enabled interact with the Netrin receptor Frazzled in Drosophila . Development 132: 1983-1994. doi:10.1242/dev.01736. PubMed: 15790972. [DOI] [PubMed] [Google Scholar]
- 45. Shorey HH (1962) Nature of the sound produced by Drosophila melanogaster during courtship. Science 137: 677-678. doi:10.1126/science.137.3531.677. PubMed: 17770950. [DOI] [PubMed] [Google Scholar]
- 46. Hotta Y, Benzer S (1972) Mapping of behavior in Drosophila mosaics. Nature 240: 527-535. doi:10.1038/240527a0. PubMed: 4568399. [DOI] [PubMed] [Google Scholar]
- 47. Yu Q, Colot HV, Kyriacou CP, Hall JC, Rosbash M (1987) Behavior modification by in vitro mutagenesis of a variable region within the period gene of Drosophila. Nature 326: 765-769. doi:10.1038/326765a0. PubMed: 3106823. [DOI] [PubMed] [Google Scholar]
- 48. Dickson BJ (2008) Wired for sex: the neurobiology of Drosophila mating decisions. Science 322: 904-909. doi:10.1126/science.1159276. PubMed: 18988843. [DOI] [PubMed] [Google Scholar]
- 49. Ejima A, Griffith LC (2007) Measurement of courtship behavior in Drosophila melanogaster. Cold Spring Harb Protoc 2007: pdb.prot4847. [DOI] [PubMed]
- 50. Finger JH, Bronson RT, Harris B, Johnson K, Przyborski SA, Ackerman SL (2002) The netrin 2 receptors Unc5h3 and DCC are necessary at multiple choice points for guidance of corticospinal tract axons. J Neurosci 22: 10346-10356. PubMed: 12451134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Srour M, Rivière JB, Pham JM, Dubé MP, Girard S et al. (2010) Mutations in DCC cause congenital mirror movements. Science 328: 592. doi:10.1126/science.1186463. PubMed: 20431009. [DOI] [PubMed] [Google Scholar]
- 52. Wolfner RF (2007) S.P.E.R.M. (seminal proteins (are) essential reproductive modulators): the view from Drosophila. Soc Reprod Fertil Suppl 65: 183-199. PubMed: 17644962. [PubMed] [Google Scholar]
- 53. Fernandes JJ, Keshishian H (2005) Motoneurons regulate myoblast proliferation and patterning in Drosophila. Dev Biol 277: 493-505. doi:10.1016/j.ydbio.2004.09.038. PubMed: 15617689. [DOI] [PubMed] [Google Scholar]
- 54. Nair S, Agrawal N, Hasan G (2007) Homeostasis of glutamate neurotransmission is altered in Drosophila inositol 1,4,5-trisphosphate receptor mutants. Invert Neurosci 7: 137-147. doi:10.1007/s10158-007-0048-0. PubMed: 17492321. [DOI] [PubMed] [Google Scholar]
- 55. Strauss R (2002) The central complex and the genetic dissection of locomotor behavior. Curr Opin Neurobiol 12: 633-638. doi:10.1016/S0959-4388(02)00385-9. PubMed: 12490252. [DOI] [PubMed] [Google Scholar]
- 56. Ilius M, Wolf R, Heisenberg M (2007) The central complex of Drosophila melanogaster is involved in flight control: studies on mutants and mosaics of the gene ellipsoid body open. J Neurogenet 21: 321-338. doi:10.1080/01677060701693503. PubMed: 18161592. [DOI] [PubMed] [Google Scholar]
- 57. Lee HG, Seong CS, Kim YC, Davis RL, Han KA (2003) Octopamine receptor OAMB is required for ovulation in Drosophila melanogaster. Dev Biol 264: 179-190. doi:10.1016/j.ydbio.2003.07.018. PubMed: 14623240. [DOI] [PubMed] [Google Scholar]
- 58. Sun J, Spradling AC (2013) Ovulation in Drosophila is controlled by secretory cells of the female reproductive tract. Elife 2: e00415. doi:10.7554/eLife.00415. PubMed: 23599892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Monastirioti M (2003) Distinct octopamine cell population residing in the CNS abdominal ganglion controls ovulation in Drosophila melanogaster. Dev Biol 264: 38-49. doi:10.1016/j.ydbio.2003.07.019. PubMed: 14623230. [DOI] [PubMed] [Google Scholar]
- 60. Saleem S, Schwedes CC, Ellis LL, Grady ST, Adams RL et al. (2012) Drosophila melanogaster p24 trafficking proteins have vital roles in development and reproduction. Mech Dev 129: 177-191. doi:10.1016/j.mod.2012.04.002. PubMed: 22554671. [DOI] [PubMed] [Google Scholar]
- 61. Avila FW, Sirot LK, LaFlamme BA, Rubinstein CD, Wolfner MF (2011) Insect seminal fluid proteins: identification and function. Annu Rev Entomol 56: 21-40. doi:10.1146/annurev-ento-120709-144823. PubMed: 20868282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Häsemeyer M, Yapici N, Heberlein U, Dickson BJ (2009) Sensory neurons in the Drosophila genital tract regulate female reproductive behavior. Neuron 61: 511-518. doi:10.1016/j.neuron.2009.01.009. PubMed: 19249272. [DOI] [PubMed] [Google Scholar]
- 63. Rezával C, Pavlou HJ, Dornan AJ, Chan YB, Kravitz EA, Goodwin SF (2012) Neural circuitry underlying Drosophila female postmating behavioral responses. Curr Biol 22: 1155-1165. doi:10.1016/j.cub.2012.04.062. PubMed: 22658598. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Tayler TD, Pacheco DA, Hergarden AC, Murthy M, Anderson DJ (2012) A neuropeptide circuit that coordinates sperm transfer and copulation duration in Drosophila. Proc Natl Acad Sci U S A 109: 20697-20702. doi:10.1073/pnas.1218246109. PubMed: 23197833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Acebes A, Grosjean Y, Everaerts C, Ferveur J-F (2004) Cholinergic control of synchronized seminal emissions in Drosophila. Curr Biol 14: 704-710. doi:10.1016/j.cub.2004.04.003. PubMed: 15084286. [DOI] [PubMed] [Google Scholar]
- 66. Horn KE, Glasgow SD, Gobert D, Bull S-J, Luk T et al. (2013) DCC expression by neurons regulates synaptic plasticity in the adult brain. Cell Rep 3: 173-185. doi:10.1016/j.celrep.2012.12.005. PubMed: 23291093. [DOI] [PubMed] [Google Scholar]
- 67. Jenett A, Rubin GM, Ngo T-TB, Shepherd D, Murphy C et al. (2012) A GAL4-driver line resource for Drosophila neurobiology. Cell Rep 2: 991-1001. doi:10.1016/j.celrep.2012.09.011. PubMed: 23063364. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Manning L, Heckscher ES, Purice MD, Roberts J, Bennett AL et al. (2012) A resource of manipulating gene expression and analyzing cis-regulatory modules in the Drosophila CNS. Cell Rep 2: 1002-1013. doi:10.1016/j.celrep.2012.09.009. PubMed: 23063363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Albrecht S, Altenhein B, Paululat A (2011) The transmembrane receptor Uncoordinated5 (Unc5) is essential for heart lumen formation in Drosophila melanogaster. Dev Biol 350: 89-100. doi:10.1016/j.ydbio.2010.11.016. PubMed: 21094637. [DOI] [PubMed] [Google Scholar]
- 70. Patel NH (1994) Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. Methods Cell Biol 44: 445-487. doi:10.1016/S0091-679X(08)60927-9. PubMed: 7707967. [DOI] [PubMed] [Google Scholar]
- 71. Spradling AC (1993) Developmental genetics of oogenesis. In: Bate M, Martinez Arias A. The development of Drosophila melanogaster. pp. 1-70. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
NetAB and hog mutants display ectopic antibody labeling phenotypes in the developing eggs. (A) Wild type ovaries. 22c10 antibody normally labels axons of nerves, and fails to label developing eggs in the ovary. (B) In hog mutants, 22c10 antibody non-specifically labels inside most of the eggs, penetrating in hair-like tracts. (C) NetAB mutants display ectopic 22c10 label similar to hog mutants in developing eggs. (D) Mean percentage of ovarian eggs ectopically labeled. hog and NetAB mutants are significantly different from wild type (*, p=0.028, **, p=0.0006 respectively, Tukey HSD within a one-way ANOVA). Arcsine transformation was performed on percentage of eggs hatched to satisfy assumptions of analysis of variance (not shown). Data shown in bar graph are means ± s.e.m. wild type (n=11), hog (n=10), NetAB (n=10).
(TIF)





