Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2013 Jul 31;110(33):13606–13611. doi: 10.1073/pnas.1310037110

Catalytic domain of plasmid pAD1 relaxase TraX defines a group of relaxases related to restriction endonucleases

María Victoria Francia a,1, Don B Clewell b,c, Fernando de la Cruz d, Gabriel Moncalián d
PMCID: PMC3746933  PMID: 23904483

Abstract

Plasmid pAD1 is a 60-kb conjugative element commonly found in clinical isolates of Enterococcus faecalis. The relaxase TraX and the primary origin of transfer oriT2 are located close to each other and have been shown to be essential for conjugation. The oriT2 site contains a large inverted repeat (where the nic site is located) adjacent to a series of short direct repeats. TraX does not show any of the typical relaxase sequence motifs but is the prototype of a unique family of relaxases (MOBC). The present study focuses on the genetic, biochemical, and structural analysis of TraX, whose 3D structure could be predicted by protein threading. The structure consists of two domains: (i) an N-terminal domain sharing the topology of the DNA binding domain of the MarR family of transcriptional regulators and (ii) a C-terminal catalytic domain related to the PD-(D/E)XK family of restriction endonucleases. Alignment of MOBC relaxase amino acid sequences pointed to several conserved polar amino acid residues (E28, D152, E170, E172, K176, R180, Y181, and Y203) that were mutated to alanine. Functional analysis of these mutants (in vivo DNA transfer and cleavage assays) revealed the importance of these residues for relaxase activity and suggests Y181 as a potential catalytic residue similarly to His-hydrophobe-His relaxases. We also show that TraX binds specifically to dsDNA containing the oriT2 direct repeat sequences, confirming their role in transfer specificity. The results provide insights into the catalytic mechanism of MOBC relaxases, which differs radically from that of His-hydrophobe-His relaxases.


Plasmid pAD1 is a conjugative sex-pheromone–responding plasmid originally identified in Enterococcus faecalis (1, 2). It is the prototype conjugative plasmid of the MOBC relaxase family (3). In the pheromone-mediated conjugative process, plasmid-free bacteria secrete multiple pheromones (small, hydrophobic, linear peptides) that induce a process in which specific plasmid-containing cells become activated by a particular pheromone for adherence to potential recipients and plasmid transfer functions (4–8). The related conjugative DNA processing machinery includes a specific relaxase that generates a nick in the strand of the plasmid to be transferred (9), which ultimately results in the acquisition of the plasmid by the recipient cell. When the recipient cells have acquired the plasmid, shutdown or masking of the corresponding endogenous pheromone takes place (10, 11). This serves to prevent self-induction caused by residual amounts of endogenous pheromone, thus ensuring that induction occurs only in the presence of recipient cells. So, although pheromone responding plasmids are highly transmissible among E. faecalis populations, plasmid transfer is highly regulated and induced only in the presence of sufficient pheromone concentrations that reflect the presence of nearby potential recipients.

The term relaxase is used to define proteins involved in initiation and termination of DNA conjugative transfer (12, 13). They recognize a specific sequence called nic located within the origin of transfer (oriT2 in the case of pAD1) and cleave it in a strand- and site-specific manner to initiate DNA transfer. Most known relaxases show two characteristic sequence motifs, motif I containing the catalytic Tyr residue (which covalently attaches to the 5′ end of the cleaved DNA) and motif III with the His-triad essential for relaxase activity (facilitating the cleavage reaction by activation of the catalytic Tyr). This His-triad has been used as a relaxase diagnostic signature (12).

Plasmid pAD1 relaxase, TraX, was identified (9) and shown to cleave within oriT2. It does not share overall homology with previously known relaxases. Together with MobC, from Enterobacter cloacae mobilizable plasmid CloDF13 (14), they form a unique group of relaxase family, known as MOBC (3), which contains invariant motifs unrelated to those of His-hydrophobe-His (HUH) relaxases. An in-frame deletion of such motifs (of pAD1) resulted in complete loss of relaxase activity, suggesting an important function, at or near an active site of the protein (9). MOBC contains relaxases belonging to two well differentiated clades, clade MOBC1 comprised of Gammaproteobacteria mobile genetic elements and clade MOBC2 composed of relaxases from Gram-positive bacteria. MobC_CloDF13 and TraX_pAD1 are the respective prototypes.

In this paper, we present data concerning the characterization of TraX, which include the identification of a relaxase domain essential for the catalytic activity of TraX. This characterization provides a catalytic model for the MOBC family of relaxases. Moreover, our study widens the general model of the DNA processing for bacterial conjugation.

Results

Identification of Two Structural Domains in TraX.

The TraX relaxase of plasmid pAD1 belongs to the MOBC relaxase family (3). Fig. 1 shows an alignment of some MOBC relaxase sequences. The conserved signature D-x6–17-E-x-E-(RL)-x2-K-x3-R-Y is apparent in the alignment, as shown in Fig. 1. This signature has no relationship with the invariant motifs in HUH relaxases (3). To further characterize this MOBC family of proteins, we carried out a structural prediction and modeling of TraX by the Protein Homology/analogY Recognition Engine (PHYRE) Web Server (15). Two structural domains within TraX were predicted, an N-terminal domain, between residues 1 and 90, and a C-terminal domain encompassing the 170 C-terminal residues (residues 132–261). The homology model of TraX N-terminal domain was directly obtained by submission of the full-length sequence of TraX. The structural prediction of TraX C-terminal domain was generated by Phyre2 One-to-one threading using the model of the C-terminal domain of CloDF13 MobC. MobC_CloDF13 is the only member of the MOBC family of relaxases biochemically characterized to date (3). Its C-terminal domain model was obtained by submission of MobC C-terminal sequence to Phyre2, as template. Both TraX domains were modeled at >90% confidence. The N-terminal domain shares the topology of the MarR family of transcriptional regulators, including a winged helix–turn–helix DNA binding motif (16, 17). TraX N-terminal domain is predicted to be formed by four helices (α2, α3, α4, and α5) and a two-strand β-sheet (β1 and β2) (Fig. 2). As in other winged-helix DNA-binding proteins, the loop adjacent to the HTH motif connects two antiparallel strands and forms like a wing that binds the DNA minor groove. Accordingly, the α4 helix would be responsible for the interaction with the DNA major groove. TraX C-terminal domain shares structural homology with the PD-(D/E)XK family of restriction endonucleases (REs; Fig. 2). This protein family (of which BamHI is the prototype) requires three conserved acidic residues (DEE) that coordinate two Mg2+ ions as cofactors to catalyze DNA hydrolysis (18, 19). The structural core of TraX catalytic C-terminal domain is predicted to be a central, three-stranded mixed β-sheet flanked by a α-helix in a topology β2, β3, α2–3, and β4. The acidic residues D152 at β2 and E170 and E172 at β3 appear in the same positions as the DEE active site residues of BamHI, suggesting a putative function for this domain as the TraX catalytic domain. Moreover, the conserved basic residues K176 and R180, both in α2, are located in a similar position as the RE residues that interact with the DNA molecule to be cleaved. To evaluate the functional importance of such residues along with other conserved amino acid residues in MOBC relaxases (alignment shown in Fig. 1), site-directed mutagenesis of the traX structural gene was performed. The amino acid residues selected for replacement are shown in Fig. 1, and all contain polar side chains. The selected residues were all changed to Ala, and four different approaches were applied to characterize the properties of the mutant proteins: (i) in vivo DNA transfer assays (overnight filter matings), (ii) in vivo nicking assays on supercoiled plasmid DNA containing pAD1 oriT or run-off assays (9), (iii) site-specific cleavage assays of oligonucleotides containing the pAD1 nick region, and (iv) DNA binding assays using DNA fragments containing pAD1 oriT (mobility shift assays).

Fig. 1.

Fig. 1.

Alignment of representative MOBC relaxases. (Upper) Sequence alignment of representative MOBC relaxases obtained with ClustalW. Accession numbers: MobC_CloDF13, CAB62410; MobC_PI, AAP70292; MobC_Y1, CAD58576; MobC_Y2, NP_995437; Orf8_pAM373, NP_072012; and TraX_pAD1, AAL59457. Color code: red on yellow, invariant amino acids; blue on blue, strongly conserved; black on green, similar; green on white, weakly similar; black on white, not conserved. The violet bar below the alignment indicates the region deleted in the in-frame traX deletion mutant resulting in a defective relaxase (9). The arrows refer to the conserved polar amino acid residues that were selected for site-directed mutagenesis. (Lower) Conserved sequence motif in MOBC relaxases. The height of each letter is proportional to the frequency of the amino acid residue. The logo was obtained by using WebLogo (36).

Fig. 2.

Fig. 2.

Modeled structure of the DNA-binding and catalytic domains of TraX. Ribbon representation of the structural prediction analysis of the N-terminal domain (Left) and the C-terminal domain (Right) of TraX bound to DNA. The secondary structure elements are numbered. Catalytic residues are shown as red sticks and the Mg+2 cations are represented as green spheres.

RE Motifs Are Required for in Vivo DNA Transfer.

The influence of the specific TraX mutations on conjugative pAD1 transfer was studied by complementation assays as described by Francia and Clewell in 2002 (9). In vivo complementation of plasmid pAM8130 (a traX in-frame deletion mutant of pAD1 showing undetectable relaxase activity) conjugation was analyzed in the presence of the TraX mutants cloned in the E. faecalis nonmobilizable vector pMSP3545Sp. The results of the complementation assays are shown in Table 1. Complementation of the different TraX mutants resulted in variable transfer frequencies that, in all cases, were reduced compared with WT TraX. Interestingly, mutation Y181A resulted in a protein incapable of complementation and thus nonfunctional (undetectable DNA transfer), indicating that Y181 is essential for TraX activity. On the contrary, the tra+ phenotype was almost fully recovered when TraXY203A mutant was analyzed (two orders of magnitude difference compared with WT TraX), indicating mutation Y203A is not essential in the conditions used for the experiment. DNA transfer was partially recovered with mutants TraX E28A, D152A, E170A, E172A, K176A, and R180A, but transfer values were severely reduced (>10,000-fold decrease), suggesting the functional importance of them all for relaxase activity. Complementation experiments of WT TraX pAD1 derivative plasmid, pAM307, showed none of the assayed relaxase mutants had a dominant-negative effect. However, at least a 100-fold decrease of the transfer frequency was observed when WT TraX was also expressed from the complementing plasmid, suggesting the necessity of a strictly controlled TraX expression for full DNA processing activity.

Table 1.

Conjugation frequencies of pAM8130 (encoding a defective relaxase) and pAM307 (encoding a WT relaxase) complemented with WT traX or the indicated mutants

Donor/plasmid in trans Transfer frequency
UV202 (pAM8130)
 WT traX 8.7 × 10−1
 E28A 8.5 × 10−5
 D152A 4.5 × 10−7
 E170A 3.2 × 10−6
 E172A 2.2 × 10−7
 K176A 1.4 × 10−6
 R180A 4.7 × 10−4
 Y181A <10−8
 Y203A 1 × 10−2
 Empty vector <10−8
UV202 (pAM307)
 WT traX 2 × 10−3
 E28A 9 × 10−1
 D152A ND
 E170A 1.14
 E172A 1.11
 K176A 1.05
 R180A 9.6 × 10−1
 Y181A 1.25
 Y203A 1.06 × 10−2
 Empty vector 1.25

Filter matings were conducted overnight using E. faecalis UV202 (rif, fus, recA−) as donors and E. faecalis OG1SS (str, spc, gel+) as the recipient, with selection for transconjugants on plates containing streptomycin and erythromycin. The transfer frequencies indicated for each derivative represent the average of at least two independent experiments and are expressed as the number of erythromycin-resistant transconjugants per donor cell.

nic-Cleavage Reaction Is Abolished in TraX Transfer Mutants.

To check the cleavage activity of the selected TraX mutants, run-off DNA synthesis analyses were performed in Escherichia coli cells cotransformed with pAD1 oriT and TraX derivatives containing plasmids upon IPTG induction (similarly as shown in ref. 9). As shown in Fig. 3, none of the TraX mutants supported detectable nicking activity in vivo, in contrast to WT TraX. This result highlights the essential role of these conserved residues.

Fig. 3.

Fig. 3.

Nicking ability of TraX and derivatives by runoff assays. E. coli BL21 cells containing pAM8151 (pAD1 oriT cloned into pSU18) and pET30b expressing TraX or its derivatives were preinduced with 1 mM IPTG and processed as described by Francia and Clewell (9). Lane 1, E28A; lane 2, WT TraX; lanes 3 to 9, D152A, E170A, E172A, K176A, R180A, Y181A, and Y203A. The “T” and “C” lanes indicate the corresponding sequencing reactions using the fmol sequencing kit, pAM8151 as template DNA, and the 32P-labeled runoff primer PE/5.2. The arrow on the left represents the location of the specific nick site within the pAD1 oriT sequence.

To check the in vitro cleavage ability of TraX and the selected mutants, their codifying genes were cloned into the pET30b expression vector (Table S1). To facilitate purification, these genes were expressed as His-tagged C-terminal fusion proteins. All proteins were partially purified in a one-step procedure by using affinity chromatography on Ni-columns. As most known relaxases reversely hydrolyze oligonucleotides containing the specific nick site in the presence of Mg+2 ions, WT TraX (or their corresponding mutants) site-specific cleavage activity was tested on oligonucleotides containing pAD1 nic (Table S2). Oligonucleotides containing the pAD1 nick region were incubated with TraX or the derivative mutants as described in Materials and Methods. Cleavage products could be separated from uncut oligonucleotides by electrophoresis in sequencing gels. TraX was unable to cut any oligonucleotide, suggesting that a different kind of substrate or additional pAD1 gene products are needed for TraX in vitro cleavage, in contrast to the results obtained for other relaxases (13). All these results taken together emphasize the wide differences in the biochemical behavior of TraX compared with previously characterized relaxases, like R388_TrwC (20), F_TraI (21), RP4_TraI (22), RSF1010_MobA (23), and pMV158_MobM (24).

TraX Binds the Double-Stranded Direct Repeat Region but Not the nic Region.

Because of the significant differences in TraX biochemical activities, we decided to ascertain its DNA binding sites, which could give the clue as to its biochemical properties. The DNA binding activity of TraX and its mutants (indicative of relaxosome formation ability) was assayed by gel mobility shift assays (Fig. 4). pAD1 oriT-containing fragments were labeled and incubated at 30 °C in binding buffer with purified TraX or mutant proteins. No Mg+2 is present in the assays, preventing DNA cleavage from interfering with binding. As a negative control, extracts corresponding to bacteria containing the empty expression vector pET30b were used. Poly(dI-dC) was added as nonspecific competitor DNA, and the reaction mixtures were subjected to 5% (wt/vol) polyacrylamide electrophoresis. Under these conditions, protein–DNA complexes remain bound and migrate through the gel slower than the corresponding free-DNA fragments. As shown in Fig. 4A, TraX was able to form complexes with both the entire oriT (oriT2) and the oriT-direct repeats containing DNA fragments (DR), but did not show similar complexes in the case of the inverted repeat DNA fragment where the nic site is located (IR), implying that the TraX relaxase specifically binds the oriT-direct repeats. The DNA binding activity of the TraX mutants is shown in Fig. 4B. Migration of the pAD1 oriT DNA fragments was shifted in the presence of all mutants (with the exception of mutant E28A), indicating that oriT-specific recognition and binding (and therefore relaxosome formation) was possible with all TraX mutants affecting the catalytic domain. DNA binding capability demonstrated for all these mutants also indicate that no point mutation introduced in TraX resulted in severe effects on protein secondary structure (that might have been responsible of the aforementioned DNA transfer results). In contrast to other relaxases, the TraX recognition and binding site at pAD1 oriT is more than 70 bp away from the nic site, which explains the negative results in the oligonucleotide cleavage assays shown earlier. The binding site for other well known relaxases is an inverted repeat adjacent to the nic (13), whereas for TraX appears to be a series of five direct repeats shown in Fig. 4A and Fig. S1.

Fig. 4.

Fig. 4.

Gel mobility-shift assays showing TraX or derivatives specific binding to oriT2 dsDNA. (A) Labeled dsDNA PCR fragments (lane 1) containing different oriT2 regions (as indicated at the top of the figure and below the corresponding gel shifts, oriT2, DR, IR) were incubated in the absence (lane 2) or presence (lane 3) of purified TraX. Empty vector (pET30b)-derived control protein extracts were used in lane 2. Free DNA forms and protein–DNA complexes are indicated. (B) Gel mobility-shift assays with labeled dsDNA PCR fragments containing oriT2 DR sequence. Lane 1, dsDNA; lane 2, dsDNA plus BL21(pET30b) control protein extract; lanes 3 to 11, dsDNA plus WT TraX, E28A, E170A, E172A, K176A, R180A, Y181A, Y203A, or D152A, respectively. Free DNA forms and protein–DNA complexes are indicated.

Discussion

In the work presented in this article, the pAD1 relaxase structure was modeled, showing to contain two structural domains. The C-terminal domain belongs to the PD-(D/E)XK family of REs. The acidic residues D152, E170, and E172 occur in a similar position as the DEE active site residues of BamHI, suggesting a role for them in the coordination of two Mg+2 cations that activate the nucleophilic attack of the phosphodiester bond at the nic site (18). Actually, site-directed mutagenesis of these residues in TraX_pAD1 abolished DNA transfer as well as in vivo nic cleavage. The basic residues K176 and R180 are also conserved in the BamHI-like REs. In fact, site-directed mutagenesis of both residues showed undetectable nicking activity and a drastic reduction in conjugative transfer. At the C-terminal end of β4, we find Y203, a conserved residue in the MOBC family of proteins (Figs. 1 and 2). This polar amino acid is near the active site. It could be involved in the conformation of the active site or the interaction with the DNA. TraX Y203A was not able to catalyze in vivo cleavage, although TraX Y203A mutant was able to catalyze DNA transfer in vivo. As the approach used to check cleavage in vivo relies on primer extension on relaxosome complexes isolated from cells, it might not be sensitive enough to detect a potential residual cleavage activity of TraX Y203A. A reduced cleavage efficiency showed by this mutant would contribute to its lower conjugation frequency (a 100-fold lower transfer frequency compared with WT TraX).

An interesting residue is Y181, in which a mutation to Ala abolished pAD1 conjugal transfer. By comparison with other known conjugative relaxases of the MOBF or MOBP systems, we predict that Y181 could be the catalytic tyrosine that remains covalently attached to the 5′ end of the nic site after cleavage. In fact, Y181 is essential for pAD1 conjugation (Table 1). Moreover, the relative locations of the acidic residues and the catalytic tyrosine are similar to the organization found in typical relaxases (i.e., HUH relaxases). HUH relaxases are related to rolling-circle replication proteins and a specific type of transposases. RE homologues have also been found to be involved in rolling-circle replication [Rep of plasmid pUA140 (25)] and transposition [TnsA transposase (26)]. Therefore, conjugative relaxases come from HUH replication proteins or REs. This structural similarity suggests an adaptive functional convergence of these two completely separate protein folds. However, no covalent protein–DNA intermediate could be found in CloDF13 (14), and no catalytic Tyr is required in the restriction enzymes in which the phosphodiester bond is cleaved by hydrolysis. The presence of a stable covalent intermediate has not been observed for other replication initiator proteins such as RepB (27) and gpII (28). However, later observations concluded that indeed there is a covalent complex in filamentous phage that dissociated rapidly unless gpII was inactivated (29). Thus, gpII possesses activities to form the covalent bond and to break it. RepB was also predicted to form an unstable covalent complex by the study on the chirality of phosphorothioate in the strand transfer reaction (30). Therefore, so far, all the characterized RCR replicases or conjugative relaxases require a covalent intermediate. This phosphotyrosine covalent complex is necessary to have the 5′ phosphate activated at the recipient cell so that the second reaction could be performed. We cannot envision how conjugative transfer could terminate without the relaxase being covalently bound to the DNA after the first cleavage reaction.

PD-(D/E)XK restriction enzymes have been found to have two metal ions at the active sites. BamHI active site contains two divalent cations at the active site that are separated by approximately 4 Å and are coordinated by Glu-77, Asp-94, and Glu-111 (31). PD-(D/E)XK nucleases hydrolyze the phosphodiester bond by direct inline nucleophile attack, resulting in the inversion of configuration at the phosphorous atom (32). When the location of the TraX conserved catalytic residues was compared with BamHI, we observed that they lay in the same spatial position. Thus, we propose the catalytic reaction to proceed in TraX as depicted in Fig. 5 by comparison with the BamHI catalytic model proposed in a previous work (31). According to this model, two divalent cations are also involved in the TraX reaction. The metal ion A is coordinated by E170, D152, and the carbonyl oxygen of I171, whereas the metal B could be bound by D152 and D138. Strikingly, when the position of the TraX Tyr181 was compared, we observed that the hydroxyl group is located where the attacking water is found in BamHI. We propose that no water is involved in the nucleophilic attack by TraX. Instead, the hydroxyl group of Y181 is perfectly positioned for the catalysis, resulting in a covalent bond between the phosphate group of the cleaved DNA bond and the Y181. In our model, E172 could be the general base that activates the hydroxyl group of Y181 by proton abstraction (Fig. 5).

Fig. 5.

Fig. 5.

Catalytic mechanism of BamHI, TraX, and TrwC. Schematic diagram illustrating the proposed catalytic mechanism for the DNA cleavage reaction performed by BamHI (Left), TraX (Center), or TrwC (Right) (Discussion).

When the purified mutant proteins were checked for dsDNA binding activity, we observed (Fig. 4B) that all mutant proteins were able to bind dsDNA, except mutant E28A. According to the prediction, all the conserved residues that were mutated are located in the ssDNA binding and catalytic domain of TraX, whereas the E28 is located in the N-terminal domain, explaining this difference. The N-terminal domain of TraX is predicted to have approximately 110 aa with a topology related to the DNA binding domain of MarR (16, 17). E28A occurs at the C-terminal end of α2 helix. The main interactions with the DNA are predicted to be in the N-terminal end of α4 and even α2 and the loop connecting β1 and β2 . However, the conserved Glu28 could be involved in the stabilization of the winged-helix DNA binding domain, and this is why this mutant is not able to bind the DR sequences. Consequently, TraX E28A was not able to promote conjugation in the complementation experiment. Interestingly we have found that the three systems most closely related to pAD1, namely pAM373, TX1341, and VRS11, are conserved in the nic region but not in the direct repeat region (Fig. S1). This conservation in the binding sites perfectly correlates with conservation in the protein domains. C-terminal domains are well conserved in the four systems, whereas the N-terminal domains and, more specifically, the DNA interacting α-helices, are quite different.

After nic-cleavage in the absence of recipient cells, typical HUH relaxases remain bound to both sides of the nic site and the 3′OH is not free. In the case of pAD1, TraX catalyses cleavage of the nic site in a process strictly controlled by the presence of pheromone (cAD1). In a previous work, we demonstrated that nic cleavage was only visible when cells were exposed to cAD1 (9). Also in this regard, preliminary experiments show that relaxase expression is detected only in the presence of cAD1. Therefore, there is evidence that pAD1 DNA processing for transfer is triggered when in close proximity to potential recipient cells (Fig. S2). Only then is enough pheromone sensed by the donor cells, which, in response, activate the plasmid mating specific functions, including the relaxase.

We have reported here that TraX is able to bind dsDNA fragments containing the full oriT2 region or just the region containing the five DRs, but not the nic region (Fig. 4A). Moreover, TraX-specific ssDNA binding was not observed. Thus, we think MOBC relaxases are not able to bind the double-stranded nic region unless the binding of the N-terminal winged-helix DNA binding domain to the DRs at oriT2 allows the creation of a partially melted region around the nic site. This domain could be necessary in these relaxases to recognize and cleave only one of the DNA strands, whereas dimeric REs without this second domain recognize and cleave both strands of a palindromic sequence. In fact, the RCR initiation protein RepB is also formed by a helix-turn-helix (HTH) DNA binding domain that recognizes three direct repeats and a HUH endonuclease domain to exert the specific ssDNA cleavage. Interestingly, although it has the catalytic Tyr and HUH motif, no covalent intermediate has been directly found in RepB, as previously discussed. After the binding of the N-terminal domain to the DR region, the RE-like binding domain would recognize and bind the ssDNA nic region catalyzing the hydrolysis of the nic site, which would initiate DNA transfer from donor to recipient (Fig. S2). Although there is no experimental evidence of TraX covalently bound to the 5′ end of the DNA to be transferred, we propose that, like in the other characterized conjugative systems, TraX will be transferred to the recipient cell by the T4SS piloting the DNA. Then, after one cycle of RCR, a TraX-catalyzed second cleavage reaction in the donor cell will create the free 3′OH to recircularize the plasmid in the recipient cell.

According to our results, not all the relaxases involved in plasmid conjugation converged into the same structural fold. MOBF, MOBP, MOBQ, and MOBV family showed the HUH fold (3, 33), but MOBC present the RE fold. We think the different fold mainly results from the different triggering mechanism. In HUH relaxases, conjugative transfer is triggered by the binding of the recipient cell to the donor cell. Until this cell-to-cell interaction occurs, the HUH relaxase is bound to the oriT, but the nic-cleavage and joining activities are in a tight equilibrium in such a way that the plasmid is not relaxed unless the conjugation signal is received. In the case of RE relaxases like pAD1_TraX, conjugation is triggered by the pheromones produced by the recipient cell and detected by the donor cell. When the pheromone has reached the donor cell, relaxase expression is induced along with its ability to introduce the nic-specific cleavage generating the plasmid relaxation and releasing a free 3′OH that is used by the cellular polymerase to produce by RCR the ssDNA strand that is transferred. Any reaction performed by the RE relaxase will produce a relaxed plasmid with the relaxase covalently bound. If this covalent product is not transferred to the recipient cell, the plasmid could be unstable. The quick hydrolysis of the covalent complex could be the mechanism to protect the plasmid DNA unless the transfer of the relaxases produces a conformational change that avoids the hydrolysis. The conjugation of some HUH relaxase-containing plasmids, such as pCF10 (34), is also induced by pheromones, but the need for accessory proteins could prevent the relaxation of the plasmid in the absence of pheromone.

In summary, the results shown in this article define a unique type of conjugative relaxases. DNA processing by RE relaxases is, in general terms, similar to processing by HUH relaxases. Thus, both relaxases should covalently bind the plasmid DNA to be transferred to the recipient cell to perform the termination reaction. The catalytic mechanism is also similar, although the structure of the relaxase is different. This is a beautiful case of adaptive convergence, whereby two radically different proteins (HUH and RE) functionally converge to create similar constellation of residues within the catalytic center and thus become able to catalyze the same biological reaction.

Materials and Methods

Structural Modeling.

The 3D structures of the N-terminal and C-terminal domains of TraX were predicted by homology modeling using the Phyre2 server (15). Images of the resulting 3D models were generated using Pymol (DeLano Scientific).

Cloning and Mutagenesis of TraX for Complementation Assays.

TraX was cloned into plasmid pMSP3535Sp (11). TraX point mutants were constructed by PCR as described in SI Materials and Methods and Tables S1 and S2.

Complementation Assays.

Plasmids encoding TraX or the point mutants generated were introduced into E. faecalis UV202 (rif, fus, recA−) containing pAM8130 and pAM307, respectively. Restoration or inhibition of the transfer ability was subsequently checked in each case by filter matings as described previously (9). The empty vector, pMSP3535Sp (11), was used as a negative control.

Cloning, Expression and Purification of WT TraX and Mutants for DNA Cleavage and Binding.

Recombinant TraX was expressed on E. coli BL21 pLysS (Invitrogen) from plasmid pAM8155 (9). TraX point mutants were constructed by PCR using pAM8155 as a template as described in SI Materials and Methods and Tables S1 and S2. Purification of TraX protein and mutants (Fig. S3) was carried out as previously described (9), with slight modifications indicated in SI Materials and Methods.

In Vivo Nicking Assays.

The generation of the nic site by WT TraX or the corresponding mutants tested was determined by using a runoff DNA synthesis assay as described previously (9).

In Vitro Nicking Assays.

Oligonucleotides containing the pAD1 nic region [Nick/oriT2, GGGTTTTAACCCACGTTGAGCGAAAAT/GGTCAGGAATTTTGCAGGCGGAGAAAGCC; and Nick2, ACCCACGTTGAGCGAAAAT/GGTCAGGAATTTTGCAGGCGGA, with the slash marks indicating the pAD1 nic site according to a previous report (9)] or the corresponding complementary strand as a negative control (Nick2c, TCCGCCTGCAAAATTCCTGACCATTTTCGCTCAACGTGGGT) were labeled at the 5′ end with [γ-32P]ATP and T4 polynucleotide kinase. Cleavage reactions were carried out as described previously (35), with the modifications indicated in SI Materials and Methods.

EMSA.

dsDNA containing oriT2 fragments for binding assays were generated by PCR as described in SI Materials and Methods and Tables S1 and S2. Gel mobility shift assays were performed basically as described previously (36), with slight modifications indicated in SI Materials and Methods.

Supplementary Material

Supporting Information

Acknowledgments

We thank Gary Dunny for providing the vector pMSP3535Sp, and all members of our laboratories for helpful discussions. This work was supported by Spanish Fondo de Investigación Sanitaria (FIS) and Instituto de Salud Carlos III Grant FIS PI10/01081 (to M.V.F.); Spanish FIS, Instituto de Salud Carlos III and Fundación Marqués de Valdecilla–Instituto de Formación e Investigación Marqués de Valdecilla Grant CES08/008 (to M.V.F.); Ministerio de Sanidad y Consumo, Instituto de Salud Carlos III, Grant Red Española de Investigación en Patología Infecciosa RD06/0008/0031 (to M.V.F.); European Union Sixth Framework Programme Grant LSHE-CT-2007-037410 (to M.F.V.); Ministerio de Ciencia e Innovación (Spain) Grants BIO2010-14809 (to G.M.) and BFU2011-26608 (to F.d.l.C.); and European Union Seventh Framework Programme Grants 248919/FP7-ICT-2009-4 and 282004/FP7-HEALTH.2011.2.3.1-2 (to F.d.l.C.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1310037110/-/DCSupplemental.

References

  • 1.Tomich PK, An FY, Damle SP, Clewell DB. Plasmid-related transmissibility and multiple drug resistance in Streptococcus faecalis subsp. zymogenes strain DS16. Antimicrob Agents Chemother. 1979;15(6):828–830. doi: 10.1128/aac.15.6.828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Francia MV, et al. Completion of the nucleotide sequence of the Enterococcus faecalis conjugative virulence plasmid pAD1 and identification of a second transfer origin. Plasmid. 2001;46(2):117–127. doi: 10.1006/plas.2001.1533. [DOI] [PubMed] [Google Scholar]
  • 3.Garcillán-Barcia MP, Francia MV, de la Cruz F. The diversity of conjugative relaxases and its application in plasmid classification. FEMS Microbiol Rev. 2009;33(3):657–687. doi: 10.1111/j.1574-6976.2009.00168.x. [DOI] [PubMed] [Google Scholar]
  • 4.Clewell DB, Dunny GM. Conjugation and genetic exchange in enterococci. In: Gilmore MS, editor. The Enterococci: Pathogenesis, Molecular Biology and Antibiotic Resistance. Washington, DC: ASM; 2002. pp. 265–300. [Google Scholar]
  • 5.Clewell DB. Properties of Enterococcus faecalis plasmid pAD1, a member of a widely disseminated family of pheromone-responding, conjugative, virulence elements encoding cytolysin. Plasmid. 2007;58(3):205–227. doi: 10.1016/j.plasmid.2007.05.001. [DOI] [PubMed] [Google Scholar]
  • 6.Chandler JR, Dunny GM. Enterococcal peptide sex pheromones: Synthesis and control of biological activity. Peptides. 2004;25(9):1377–1388. doi: 10.1016/j.peptides.2003.10.020. [DOI] [PubMed] [Google Scholar]
  • 7.Ehrenfeld EE, Kessler RE, Clewell DB. Identification of pheromone-induced surface proteins in Streptococcus faecalis and evidence of a role for lipoteichoic acid in formation of mating aggregates. J Bacteriol. 1986;168(1):6–12. doi: 10.1128/jb.168.1.6-12.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ehrenfeld EE, Clewell DB. Transfer functions of the Streptococcus faecalis plasmid pAD1: Organization of plasmid DNA encoding response to sex pheromone. J Bacteriol. 1987;169(8):3473–3481. doi: 10.1128/jb.169.8.3473-3481.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Francia MV, Clewell DB. Transfer origins in the conjugative Enterococcus faecalis plasmids pAD1 and pAM373: Identification of the pAD1 nic site, a specific relaxase and a possible TraG-like protein. Mol Microbiol. 2002;45(2):375–395. doi: 10.1046/j.1365-2958.2002.03007.x. [DOI] [PubMed] [Google Scholar]
  • 10.Ike Y, Craig RA, White BA, Yagi Y, Clewell DB. Modification of Streptococcus faecalis sex pheromones after acquisition of plasmid DNA. Proc Natl Acad Sci USA. 1983;80(17):5369–5373. doi: 10.1073/pnas.80.17.5369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chandler JR, Flynn AR, Bryan EM, Dunny GM. Specific control of endogenous cCF10 pheromone by a conserved domain of the pCF10-encoded regulatory protein PrgY in Enterococcus faecalis. J Bacteriol. 2005;187(14):4830–4843. doi: 10.1128/JB.187.14.4830-4843.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Francia MV, et al. A classification scheme for mobilization regions of bacterial plasmids. FEMS Microbiol Rev. 2004;28(1):79–100. doi: 10.1016/j.femsre.2003.09.001. [DOI] [PubMed] [Google Scholar]
  • 13.Zechner EL, et al. Conjugative-DNA transfer processes. In: Thomas CM, editor. The Horizontal Gene Pool. Bacterial Plasmids and Gene Spread. Amsterdam: Harwood; 2000. pp. 87–174. [Google Scholar]
  • 14.Núñez B, De La Cruz F. Two atypical mobilization proteins are involved in plasmid CloDF13 relaxation. Mol Microbiol. 2001;39(4):1088–1099. doi: 10.1046/j.1365-2958.2001.02308.x. [DOI] [PubMed] [Google Scholar]
  • 15.Kelley LA, Sternberg MJ. Protein structure prediction on the Web: A case study using the Phyre server. Nat Protoc. 2009;4(3):363–371. doi: 10.1038/nprot.2009.2. [DOI] [PubMed] [Google Scholar]
  • 16.Hong M, Fuangthong M, Helmann JD, Brennan RG. Structure of an OhrR-ohrA operator complex reveals the DNA binding mechanism of the MarR family. Mol Cell. 2005;20(1):131–141. doi: 10.1016/j.molcel.2005.09.013. [DOI] [PubMed] [Google Scholar]
  • 17.Kumarevel T, et al. Crystal structure of the MarR family regulatory protein, ST1710, from Sulfolobus tokodaii strain 7. J Struct Biol. 2008;161(1):9–17. doi: 10.1016/j.jsb.2007.08.017. [DOI] [PubMed] [Google Scholar]
  • 18.Vanamee ES, et al. Asymmetric DNA recognition by the OkrAI endonuclease, an isoschizomer of BamHI. Nucleic Acids Res. 2011;39(2):712–719. doi: 10.1093/nar/gkq779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Steczkiewicz K, Muszewska A, Knizewski L, Rychlewski L, Ginalski K. Sequence, structure and functional diversity of PD-(D/E)XK phosphodiesterase superfamily. Nucleic Acids Res. 2012;40(15):7016–7045. doi: 10.1093/nar/gks382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Grandoso G, et al. Two active-site tyrosyl residues of protein TrwC act sequentially at the origin of transfer during plasmid R388 conjugation. J Mol Biol. 2000;295(5):1163–1172. doi: 10.1006/jmbi.1999.3425. [DOI] [PubMed] [Google Scholar]
  • 21.Dostál L, Shao S, Schildbach JF. Tracking F plasmid TraI relaxase processing reactions provides insight into F plasmid transfer. Nucleic Acids Res. 2011;39(7):2658–2670. doi: 10.1093/nar/gkq1137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pansegrau W, Schröder W, Lanka E. Concerted action of three distinct domains in the DNA cleaving-joining reaction catalyzed by relaxase (TraI) of conjugative plasmid RP4. J Biol Chem. 1994;269(4):2782–2789. [PubMed] [Google Scholar]
  • 23.Scherzinger E, Lurz R, Otto S, Dobrinski B. In vitro cleavage of double- and single-stranded DNA by plasmid RSF1010-encoded mobilization proteins. Nucleic Acids Res. 1992;20(1):41–48. doi: 10.1093/nar/20.1.41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guzmán LM, Espinosa M. The mobilization protein, MobM, of the streptococcal plasmid pMV158 specifically cleaves supercoiled DNA at the plasmid oriT. J Mol Biol. 1997;266(4):688–702. doi: 10.1006/jmbi.1996.0824. [DOI] [PubMed] [Google Scholar]
  • 25.Zou X, Caufield PW, Li Y, Qi F. Complete nucleotide sequence and characterization of pUA140, a cryptic plasmid from Streptococcus mutans. Plasmid. 2001;46(2):77–85. doi: 10.1006/plas.2001.1539. [DOI] [PubMed] [Google Scholar]
  • 26.Hickman AB, et al. Unexpected structural diversity in DNA recombination: The restriction endonuclease connection. Mol Cell. 2000;5(6):1025–1034. doi: 10.1016/s1097-2765(00)80267-1. [DOI] [PubMed] [Google Scholar]
  • 27.Moscoso M, del Solar G, Espinosa M. Specific nicking-closing activity of the initiator of replication protein RepB of plasmid pMV158 on supercoiled or single-stranded DNA. J Biol Chem. 1995;270(8):3772–3779. doi: 10.1074/jbc.270.8.3772. [DOI] [PubMed] [Google Scholar]
  • 28.Meyer TF, Geider K. Bacteriophage fd gene II-protein. II. Specific cleavage and relaxation of supercoiled RF from filamentous phages. J Biol Chem. 1979;254(24):12642–12646. [PubMed] [Google Scholar]
  • 29.Asano S, Higashitani A, Horiuchi K. Filamentous phage replication initiator protein gpII forms a covalent complex with the 5′ end of the nick it introduced. Nucleic Acids Res. 1999;27(8):1882–1889. doi: 10.1093/nar/27.8.1882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Moscoso M, Eritja R, Espinosa M. Initiation of replication of plasmid pMV158: Mechanisms of DNA strand-transfer reactions mediated by the initiator RepB protein. J Mol Biol. 1997;268(5):840–856. doi: 10.1006/jmbi.1997.1012. [DOI] [PubMed] [Google Scholar]
  • 31.Viadiu H, Aggarwal AK. The role of metals in catalysis by the restriction endonuclease BamHI. Nat Struct Biol. 1998;5(10):910–916. doi: 10.1038/2352. [DOI] [PubMed] [Google Scholar]
  • 32.Pingoud A, Fuxreiter M, Pingoud V, Wende W. Type II restriction endonucleases: Structure and mechanism. Cell Mol Life Sci. 2005;62(6):685–707. doi: 10.1007/s00018-004-4513-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chandler M, et al. Breaking and joining single-stranded DNA: the HUH endonuclease superfamily. Nat Rev Microbiol. 2013;11:525–538. doi: 10.1038/nrmicro3067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chen Y, Staddon JH, Dunny GM. Specificity determinants of conjugative DNA processing in the Enterococcus faecalis plasmid pCF10 and the Lactococcus lactis plasmid pRS01. Mol Microbiol. 2007;63(5):1549–1564. doi: 10.1111/j.1365-2958.2007.05610.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Pérez-Mendoza D, et al. The relaxase of the Rhizobium etli symbiotic plasmid shows nic site cis-acting preference. J Bacteriol. 2006;188(21):7488–7499. doi: 10.1128/JB.00701-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Francia MV, Weaver KE, Goicoechea P, Tille P, Clewell DB. Characterization of an active partition system for the Enterococcus faecalis pheromone-responding plasmid pAD1. J Bacteriol. 2007;189(23):8546–8555. doi: 10.1128/JB.00719-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: A sequence logo generator. Genome Res. 2004;14(6):1188–1190. doi: 10.1101/gr.849004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES