Abstract
Background
Fournier’s gangrene is a rare necrotizing soft tissue infection of the scrotum and penis. We report, to our knowledge, the first case of Fournier’s gangrene caused by Streptococcus dysgalactiae subsp. equisimilis (SDSE), a strain of pyogenic β-hemolytic streptococci that is increasingly being recognized as an important human pathogen.
Case presentation
We describe a healthy 59 year-old Caucasian male who presented to the emergency department with Fournier’s gangrene of the penis and scrotum, with extension to the anterior abdominal wall. He underwent urgent surgical debridement of his scrotum, penis, and anterior abdomen. Swabs from the scrotum grew Gram-positive cocci, which were initially identified as Streptococcus anginosus group by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS). However, polymerase chain reaction (PCR) amplification and sequencing of the 16S rRNA gene identified the isolate as Streptococcus dysgalatiae subspecies equisimilis (SDSE). The incidences of invasive S. anginosus group and SDSE infections at the London Health Sciences Centre, a tertiary-care institution in southwestern Ontario, were determined between August 1, 2011 and August 31, 2012, revealing a slightly lower rate of SDSE (3.2 cases per 100,000 population) than other studies.
Conclusions
This case highlights a unique disease manifestation of the emerging human pathogen Streptococcus dysgalatiae subspecies equisimilis that has not been previously reported. This case also underscores the limitations of MALDI-TOF MS in differentiating between closely-related streptococcal species which may have different pathogenic profiles.
Keywords: Streptococcus dysgalactiae subsp. equisimilis, Fournier’s gangrene, MALDI-TOF MS, Species identification
Background
Fournier’s gangrene is a rare necrotizing infection of the male genitalia [1,2]. It is classically characterized by intense pain and tenderness in the genitals, rapidly progressing to gangrene and septic shock. Risk factors include diabetes [1], immune compromise, drug use, obesity, and trauma to the perineum [2,3]. Most cases of Fournier’s gangrene are polymicrobial [2], and commonly isolated microorganisms include Escherichia, Klebsiella, Bacteroides, Clostridium, streptococci and enterococci [1]. Early therapy is critical, including surgical debridement, broad-spectrum antibiotics, and skin grafting [1-3]. We describe a case of Fournier’s gangrene in a healthy male caused by Streptococcus dysgalactiae subsp. equisimilis (SDSE), initially misidentified as Streptococcus anginosus group. SDSE is a pyogenic β-hemolytic Streptococcus that is emerging as a human pathogen with a similar disease profile to S. pyogenes[4-6]. While it primarily presents as skin and soft-tissue infections, including cellulitis and necrotizing fasciitis [4], SDSE can also cause endocarditis, rheumatic fever, and streptococcal toxic shock-like syndrome [5,6]. With an ever-increasing clinical burden, there is a need to accurately identify invasive SDSE infections.
Case presentation
A 59 year-old, previously healthy Caucasian male presented with scrotal and penile pain for six days, and brownish-black discoloration of the scrotum. His past medical and surgical history was non-contributory and he did not take any medications. There was no history of trauma or sepsis in the genital area, and there were no symptoms of dysuria or hematuria. A review of systems was unremarkable. On examination, the patient was alert and oriented, but appeared unwell. He was also febrile (38.3°C), tachycardic (heart rate 116/min), and normotensive (blood pressure 136/79). His lower abdomen was erythematous with palpable subcutaneous emphysema extending to the umbilicus. His penile shaft was swollen and tender, and his scrotum was necrotic. Bloodwork revealed a white cell count of 17 × 109/L, hyponatremia (125 mmol/L), hypochloremia (86 mmol/L), and elevated serum lactate (3.1 mmol/L). The patient’s international normalized ratio (INR) was 1.6, and his serum alanine-aminotransferase (ALT), and serum aspartate-aminotransferase (AST) were elevated at 127 U/L, and 66 U/L respectively. Blood glucose and serum creatinine were within normal limits.
Intravenous treatment with vancomycin (1 g every 12 h), and piperacillin-tazobactam (4.5 g every 8 h) was initiated. The patient was urgently taken to the operating room and underwent extensive debridement of his scrotum, penile shaft, and anterior abdomen, while preserving the testes and abdominal muscles. A small abscess cavity communicating with the necrotizing infection was identified in the right buttock and debrided. A suprapubic catheter was placed for urinary diversion, and the patient was admitted to the intensive care unit. After 48 hours, he underwent a transverse colostomy to divert stool from his perineum, and skin grafting to close his anterior abdominal wounds and penile shaft. His testes were tunnelled into his thighs, and after sixteen days in hospital, he was discharged home.
A swab from the scrotal tissue was taken during the initial operation, and was streaked on blood agar plates, resulting in a monoculture of uniformly-sized beta-haemolytic colonies. From this, the bacteria was isolated and subjected to matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) to identify the organism as Streptococcus anginosus group (score = 2.3), although the software (Biotyper software version 3.0) was unable to distinguish the species. Susceptibility testing was performed by the Kirby-Bauer disc diffusion method [7], and the organism was sensitive to ceftriaxone, clindamycin, erythromycin, penicillin, and vancomycin. Polymerase chain reaction (PCR) amplification (Table 1) and sequencing of the 16S rRNA amplicon from DNA isolated from overnight cultures of two isolated colonies identified the isolate as Streptococcus dysgalatiae subspecies equisimilis. This was further confirmed by sequencing the emm amplicon and performing a BLAST search on the Centers for Disease Control (CDC) streptococcal emm sequence database [8]: the isolate was identified as group G Streptococcus emm type stG643.0. Further PCR amplification experiments (Additional file 1: Figure S1) did not detect any of the 11 known streptococcal superantigen genes [9], when compared to genomic DNA preparations of S. pyogenes serotypes MGAS5005 [9], SF370 [10], MGAS8232 [10], and MGAS315 [10], which served as positive controls. In addition, proliferation assays [11] confirmed the absence of Group A streptococcal superantigen activity in the isolate (Addition file 1: Figure S2). Briefly, supernatants from overnight cultures of the isolate were added to fresh, gradient-purified human peripheral blood mononuclear cells (PBMCs; 2.0 × 105 cells/well) in 96-well plates. After 3 days, 3H-thymidine was added for 18 h to measure proliferation. Supernatant from S. pyogenes strain MGAS5005 [9] served as a positive control.
Table 1.
List of primers used to amplify streptococcal superantigen genes, 16S ribosomal RNA (rRNA), and emm genes
| Name | Sequence 5′-3′ | Source |
|---|---|---|
| SpeA forward |
AAAGTTGCCATCTCTTGGTTC |
Sigma genosys |
| SpeA reverse |
CAAGAGGTATTTGCTCAACAAGAC |
Sigma genosys |
| SpeC forward |
TTTGAGCAGGCGTAATTCCT |
Sigma genosys |
| SpeC reverse |
TTCAACGACACACACATTAAACA |
Sigma genosys |
| SpeG forward |
ACCCCATGCGATTATGAAAA |
Sigma genosys |
| SpeG reverse |
GGGAGACCAAAAACATCGAC |
Sigma genosys |
| SpeH forward |
ATTCCAATGTTGTTCAAGCAAA |
Sigma genosys |
| SpeH reverse |
TGAGCGGTTACTTTCGGTTT |
Sigma genosys |
| SpeI forward |
TCCGCCATTTTCAGGTAGTT |
Sigma genosys |
| SpeI reverse |
TTTCCTTCCTCAAAGCCAGA |
Sigma genosys |
| SpeJ forward |
GCTCTCGACCTCAGAATCAA |
Sigma genosys |
| SpeJ reverse |
CTTTCATGGGTACGGAAGTG |
Sigma genosys |
| SpeK forward |
CAAACAAGGAACGCAATTGAT |
Sigma genosys |
| SpeK reverse |
GTGTCTAATGCCACCGTCT |
Sigma genosys |
| SpeL forward |
ATAAGTCAGCACCTTCCTCTTTC |
Sigma genosys |
| SpeL reverse |
AAATCTCCCGTTACCTTCCA |
Sigma genosys |
| SpeM forward |
AACTTCTTCTTCCTTAAAGCGTCT |
Sigma genosys |
| SpeM reverse |
TGCTGTGTTGGTTAATAGCGA |
Sigma genosys |
| SmeZ forward |
TTTCTCGTCCTGTGATTGGA |
Sigma genosys |
| SmeZ reverse |
AATGGGACGGAGAACATAGC |
Sigma genosys |
| SSA forward |
ACAGGTCAGCTTTTACAGCA |
Sigma genosys |
| SSA reverse |
GGGCATCATATCGTACCAAA |
Sigma genosys |
| 16S rRNA forward |
AGAGTTTGATCCTGGCTCAG |
Invitrogen life technologies |
| 16S rRNA reverse |
AAGGAGGTGATCCAGCCGCA |
Invitrogen life technologies |
|
emm genotyping primer forward |
TATTCGCTTAGAAAATTAA |
Invitrogen life technologies |
| emm genotyping primer reverse | GCAAGTTCTTCAGCTTGTTT | Invitrogen life technologies |
We also used the London Health Sciences Centre (LHSC) microbiology database to retrospectively review patients with invasive S. anginosus group or SDSE infections at LHSC (a tertiary-care centre in Southwestern Ontario that serves a regional population of 435 000) between August 1, 2011 and August 31, 2012. The review was conducted according to the Helsinki Declaration, and approved by the Research Ethics Board of Western University (approval number 103036). Incidences were calculated using Statistics Canada census data from 2011 [12]. We identified 17 cases of invasive S. anginosus group infections (3.9 cases per 100,000 population), and 14 cases of invasive SDSE infections (3.2 cases per 100,000 population; Table 2). When testing antibiotic susceptibility by the disc diffusion method [7], all SDSE isolates were sensitive to penicillin, whereas 6% of S. anginosus group isolates were resistant. Two SDSE isolates (14%) were resistant to clindamycin and one (7%) was resistant to erythromycin (Table 2).
Table 2.
Characteristics of invasive SDSE and S. anginosus group infections in a one-year period at London health sciences centre
| Characteristics | SDSE | S. anginosus group |
|---|---|---|
| Patients, n |
14 |
17 |
| Rate (per 100,000 population) |
3.2 |
3.9 |
| Source of organism, n (%) |
|
|
| Blood |
11 (79) |
6 (35) |
| Tissue |
3 (21) |
10 (59) |
| Cerebrospinal fluid (CSF) |
0 (0) |
1 (6) |
| Antibiotic resistance, n (%) |
|
|
| Penicillin |
0 (0) |
1 (6) |
| Ceftriaxone |
- |
1 (6) |
| Erythromycin |
1 (7) |
2 (12) |
| Clindamycin |
2 (14) |
2 (12) |
| Vancomycin | - | 0 (0) |
Conclusions
Fournier’s gangrene was first identified in 1883, when the French dermatologist and venereologist Jean Alfred Fournier diagnosed a rapidly progressive gangrene of the genitalia with no discernible etiology in five young men [13]. Now defined as a necrotizing fasciitis of the perineal or genital areas [1,2], Fournier’s gangrene remains unusually rare, with an incidence ranging from 0.002% to 0.005% of annual hospital admissions [14]. The infection can rapidly spread throughout the perineum, thighs, and torso, subsequently leading to gangrene, septic shock, and death if untreated. Although Group A streptococci were thought to be the sole cause of Fournier’s gangrene [15], subsequent clinical series have emphasized the polymicrobial nature of the disease [1,16], which is hypothesized to synergize enzyme production and promote rapid multiplication and spread of infection [1]. The most common causative microorganisms include facultative organisms (E. coli, Klebsiella, enterococci), along with anaerobes (Bacteroides, Fusobacterium, Clostridium, or anaerobic or microaerophilic Streptococci). This case is unique because the patient lacked the typical risk factors associated with Fournier’s gangrene, such as diabetes, immune compromise, obesity, drug use, or genital trauma [1-3], and his infection was caused by Streptococcus dysgalactiae subsp. equisimilis (SDSE).
SDSE, a pyogenic β-hemolytic streptococcus [17], usually colonizes the upper respiratory, gastrointestinal, and female genital tracts [17]. However, it is increasingly being recognized as an important human pathogen [18], with a wide spectrum of disease similar to that caused by S. pyogenes[5], including endocarditis, rheumatic fever, and streptococcal toxic shock-like syndrome [6]. In a recent population-based study, the burden of invasive SDSE infections approximated that of invasive S. pyogenes infections [4]. SDSE primarily presents as skin and soft-tissue infections, including pyoderma, cellulitis, wound infections, abscesses, erysipelas, and necrotizing fasciitis [4]. SDSE contains either Lancefield group antigens C or G, but needs to be distinguished from S. anginosus group strains, which frequently contain the same antigens. The use of MALDI-TOF MS to differentiate between streptococcal species has been established [19-21], although misidentification may occur because of striking similarities in proteomic profiles [22,23]. The organism in our case was misidentified as S. anginosus group by MALDI-TOF MS, because sequencing the 16S rRNA segment confirmed the isolate as SDSE. While few laboratories report identification of β-hemolytic Group C and G streptococci to the species level [24], differentiation should not be ignored because SDSE is more invasive than the S. anginosus group [25], and may have virulence factors similar to S. pyogenes[26,27]. Although the presence of streptococcal superantigens such as SpeG homologues have been described in SDSE [6,28], our clinical isolate lacked Group A streptococcal superantigen genes and activity. Nevertheless, our case demonstrates the potential benefit of molecular assays in differentiating closely-related streptococcal species, although further studies are needed to assess their clinical impact. To our knowledge, there are no other reports of Fournier’s gangrene caused by Streptococcus dysgalactiae subspecies equisimils (SDSE). One study isolated Group C Streptococcus from the perineum of a diabetic male with Fournier’s gangrene [29], but the species was not reported, and a potential role for superantigens was not investigated.
At our institution, the incidences of invasive S. anginosus group and SDSE infections were 3.9 and 3.2 cases per 100,000 respectively (Table 2). The rate of invasive S. anginosus group infection is slightly higher than previous studies [4], while the rate of invasive SDSE infection is slightly lower. Although rare penicillin-resistant SDSE strains have been reported [30], isolates from our centre were sensitive to penicillin. Six percent of S. anginosus group isolates, however, were resistant to penicillin, which is higher than other studies [31]. While the mechanisms of resistance have yet to be fully elucidated, the potential transfer of penicillin resistance determinants from related Streptococcal species [32], together with selective antibiotic pressure, may play a role in the emergence of penicillin resistance in the S. anginosus group [4,33]. Therefore, the addition of an aminoglycoside to a cell wall-active agent may be appropriate for severe S. anginosus group infections to avoid delayed response of infection [33]. Similar to other studies [30] showing widespread resistance to macrolides (16-24%) we also observed erythromycin resistance (12% and 7% for S. anginosus group and SDSE isolates, respectively), albeit at a lower rate. Additionally, 12% of S. anginosus group isolates and 14% of SDSE isolates were resistant to clindamycin, suggesting that despite the popularity of macrolide and clindamycin use in infected patients, they may not be appropriate for all cases.
In conclusion, we present a case of Fournier’s gangrene of the penis caused by SDSE, highlighting a unique disease presentation of the organism, and underscoring the limitations of MALDI-TOF MS in differentiating between closely-related streptococcal species which may hixave differing pathogenic profiles.
Consent
Written informed consent was obtained from the patient for publication of this case report. A copy of the written consent is available for review by the editor of this journal.
Competing interests
The authors report no actual or potential conflicts of interest.
Authors’ contributions
RVA collected the tissue culture sample, contributed to the discussion of the results, and drafted and wrote the manuscript. KJK carried out the PCR amplification of the 16S rRNA and superantigen genes and contributed to the discussion of the results. KGP performed the proliferation assay and generated the supplementary figures. JJZ carried out the emm sequencing. JD and JKM contributed to the assessment and discussion of the results. All authors read and approved the final manuscript.
Pre-publication history
The pre-publication history for this paper can be accessed here:
Supplementary Material
PCR analysis of S. dysgalactiae subspecies equisimilis (SDSE) chromosomal DNA did not detect any known Group A streptococcal superantigen genes. S. dysgalactiae subspecies equisimilis (s), positive control (S. pyogenes MGAS5005, SF370, MGAS8232, and MGAS315; +), and negative control (no template). Figure S2: Supernatant from the clinical isolate identified as S. dysgalactiae subspecies equisimilis (SDSE) failed to induce the proliferation of human PBMCs. Human PBMCs were incubated with supernatant dilutions from S. pyogenes strain MGAS5005 or the clinical isolate for 72h and subsequently pulsed with [3H]thymidine to assess mitogenic activity. DNA was harvested after 18 h, and the counts per minute (cpm) were determined by scintillation counting and normalized. The mean (± SEM) of experiments performed in quadruplicate are shown.
Contributor Information
Ram V Anantha, Email: rananth@uwo.ca.
Katherine J Kasper, Email: kjkasper@uwo.ca.
Kelcey G Patterson, Email: kpatte23@uwo.ca.
Joseph J Zeppa, Email: jzeppa3@uwo.ca.
Johan Delport, Email: johan.delport@lhsc.on.ca.
John K McCormick, Email: john.mccormick@schulich.uwo.ca.
Acknowledgements
This study was funded by the Division of General Surgery, Western University, and the Canadian Institutes of Health Research (CIHR) operating grant MOP-64176.
References
- Rudolph R, Soloway M, DePalma RG, Persky L. Fournier’s syndrome: synergistic gangrene of the scrotum. Am J Surg. 1975;129(5):591–596. doi: 10.1016/0002-9610(75)90324-4. [DOI] [PubMed] [Google Scholar]
- Yumura Y, Chiba K, Saito K, Hirokawa M. Fournier’s gangrene of penis in a patient with malignant lymphoma: a case report. Hinyokika Kiyo. 2000;46:735–737. [PubMed] [Google Scholar]
- Schneider PR, Russell RC, Zook EG. Fournier’s gangrene of penis: a report of two cases. Ann Plast Surg. 1986;17:87–90. doi: 10.1097/00000637-198607000-00016. [DOI] [PubMed] [Google Scholar]
- Broyles LN, Van Beneden C, Beall B, Facklam R, Shewmaker PL, Malpiedi P, Daily P, Reingold A, Farley MM. Population-based study of invasive disease Due to β-hemolytic streptococci of groups other than a and B. Clin Infect Dis. 2009;48(6):706–712. doi: 10.1086/597035. [DOI] [PubMed] [Google Scholar]
- Efstratiou A. Pyogenic streptococci of lancefield groups C and G as pathogens in man. Soc Appl Bacteriol Symp Ser. 1997;26:72S–79S. [PubMed] [Google Scholar]
- Hashikawa S, Iinuma Y, Furushita M, Ohkura T, Nada T, Torii K, Hasegawa T, Ohta M. Characterization of group C and G streptococcal strains that cause streptococcal toxic shock syndrome. J Clin Microbiol. 2004;42(1):186–192. doi: 10.1128/JCM.42.1.186-192.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clinical and Laboratory Standards Institute. Performance standards for antimicrobial disk susceptibility tests. Approved standard M2-A10. Wayne, PA: Clinical and Laboratory Standards Institute; 2009. [Google Scholar]
- Streptococci Group A Subtyping Request Form Blast 2.0 Server. [ http://www.cdc.gov/ncidod/biotech/strep/strepblast.htm]
- Brouillard JN, Gunther S, Varma AK, Gryski I, Herfst CA, Rahman AK, Leung DY, Schlievert PM, Madrenas J, Sundberg EJ. et al. Crystal structure of the streptococcal superantigen SpeI and functional role of a novel loop domain in T cell activation by group V superantigens. J Mol Biol. 2007;367(4):925–934. doi: 10.1016/j.jmb.2007.01.024. [DOI] [PubMed] [Google Scholar]
- Beres SB, Sylva GL, Barbian KD, Lei B, Hoff JS, Mammarella ND, Liu MY, Smoot JC, Porcella SF, Parkins LD. et al. Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence. Proc Natl Acad Sci U S A. 2002;99(15):10078–10083. doi: 10.1073/pnas.152298499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y, Li H, Dimasi N, McCormick JK, Martin R, Schuck P, Schlievert PM, Mariuzza RA. Crystal structure of a superantigen bound to the high-affinity, zinc-dependent site on MHC class II. Immunity. 2001;14(1):93–104. doi: 10.1016/S1074-7613(01)00092-9. [DOI] [PubMed] [Google Scholar]
- Census Profile - Population Centre. [ http://www12.statcan.gc.ca/census-recensement/2011/dp-pd/prof/details/page.cfm?Lang=E&Geo1=POPC&Code1=0480&Geo2=PR&Code2=35&Data=Count&SearchText=London&SearchType=Begins&SearchPR=01&B1=All&Custom=&TABID=1]
- Fournier JA. Gangrene foudroyante de la verge. Semaine Médicale. 1883;4:589–597. [Google Scholar]
- Sorensen MD, Krieger JN, Rivara FP, Broghammer JA, Klein MB, Mack CD, Wessells H. Fournier’s gangrene: population based epidemiology and outcomes. J Urol. 2009;181(5):2120–2126. doi: 10.1016/j.juro.2009.01.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meleney FL, Zau ZD. The viability of hemolytic streptococcus in certain solutions containing gelatin. J Exp Med. 1924;39(6):811–825. doi: 10.1084/jem.39.6.811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bernstein SM, Celano T, Sibulkin D. Fournier’s gangrene of penis. South Med J. 1976;69:1242–1244. doi: 10.1097/00007611-197609000-00044. [DOI] [PubMed] [Google Scholar]
- Vandamme PPB, Falsen E, Kersters K, Devriese LA. Taxonomic study of Lancefield streptococcal groups C, G, and L (Streptococcus dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov. Int J Syst Bacteriol. 1996;46:774–781. doi: 10.1099/00207713-46-3-774. [DOI] [PubMed] [Google Scholar]
- Barnham MR, Weightman NC. Changing incidence of detected streptococcal bacteraemia in North Yorkshire, England. Indian J Med Res. 2004;119(S):160–163. [PubMed] [Google Scholar]
- Risch M, Radjenovic D, Han JN, Wydler M, Nydegger U, Risch L. Comparison of MALDI TOF with conventional identification of clinically relevant bacteria. Swiss Med Wkly. 2010;140:w13095. doi: 10.4414/smw.2010.13095. [DOI] [PubMed] [Google Scholar]
- Eigner U, Holfelder M, Oberdorfer K, Betz-Wild U, Bertsch D, Fahr AM. Performance of a matrix-assisted laser desorption ionization-time-of-flight mass spectrometry system for the identification of bacterial isolates in the clinical routine laboratory. Clin Lab. 2009;55(7–8):289–296. [PubMed] [Google Scholar]
- Cherkaoui A, Emonet S, Fernandez J, Schorderet D, Schrenzel J. Evaluation of matrix-assisted laser desorption ionization-time of flight mass spectrometry for rapid identification of Beta-hemolytic streptococci. J Clin Microbiol. 2011;49(8):3004–3005. doi: 10.1128/JCM.00240-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seng P, Drancourt M, Gouriet F, La Scola B, Fournier PE, Rolain JM, Raoult D. Ongoing revolution in bacteriology: routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin Infect Dis. 2009;49(4):543–551. doi: 10.1086/600885. [DOI] [PubMed] [Google Scholar]
- Stevenson LG, Drake SK, Murray PR. Rapid identification of bacteria in positive blood culture broths by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J Clin Microbiol. 2010;48(2):444–447. doi: 10.1128/JCM.01541-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Facklam R. What happened to the streptococci: overview of taxonomic and nomenclature changes. Clin Microbiol Rev. 2002;15:613–630. doi: 10.1128/CMR.15.4.613-630.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cimolai N, MacCulloch L, Damm S. The epidemiology of beta-haemolytic non-group A streptococci isolated from the throats of children over a one-year period. Epidemiol Infect. 1990;104(1):119–126. doi: 10.1017/S0950268800054595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Igwe EI, Shewmaker PL, Facklam RR, Farley MM, van Beneden C, Beall B. Identification of superantigen genes speM, ssa, and smeZ in invasive strains of beta-hemolytic group C and G streptococci recovered from humans. FEMS Microbiol Lett. 2003;229(2):259–264. doi: 10.1016/S0378-1097(03)00842-5. [DOI] [PubMed] [Google Scholar]
- Schnitzler N, Podbielski A, Baumgarten G, Mignon M, Kaufhold A. M or M-like protein gene polymorphisms in human group G streptococci. J Clin Microbiol. 1995;33(2):356–363. doi: 10.1128/jcm.33.2.356-363.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sachse S, Seidel P, Gerlach D, Gunther E, Rodel J, Straube E, Schmidt KH. Superantigen-like gene(s) in human pathogenic Streptococcus dysgalactiae, subsp equisimilis: genomic localisation of the gene encoding streptococcal pyrogenic exotoxin G (speG(dys)) FEMS Immunol Med Microbiol. 2002;34(2):159–167. doi: 10.1111/j.1574-695X.2002.tb00618.x. [DOI] [PubMed] [Google Scholar]
- Marinella MA. Group C streptococcal sepsis complicating Fournier gangrene. South Med J. 2005;98(9):921–923. doi: 10.1097/01.smj.0000177354.44532.9f. [DOI] [PubMed] [Google Scholar]
- Biedenbach DJ, Toleman MA, Walsh TR, Jones RN. Characterization of fluoroquinolone-resistant beta-hemolytic Streptococcus spp. isolated in North America and Europe including the first report of fluoroquinolone-resistant Streptococcus dysgalactiae subspecies equisimilis: report from the SENTRY Antimicrobial Surveillance Program (1997–2004) Diagn Microbiol Infect Dis. 2006;55(2):119–127. doi: 10.1016/j.diagmicrobio.2005.12.006. [DOI] [PubMed] [Google Scholar]
- Tracy M, Wanahita A, Shuhatovich Y, Goldsmith EA, Clarridge JE 3rd, Musher DM. Antibiotic susceptibilities of genetically characterized Streptococcus milleri group strains. Antimicrob Agents Chemother. 2001;45(5):1511–1514. doi: 10.1128/AAC.45.5.1511-1514.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dowson CG, Hutchison A, Woodford N, Johnson AP, George RC, Spratt BG. Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae. Proc Natl Acad Sci U S A. 1990;87(15):5858–5862. doi: 10.1073/pnas.87.15.5858. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brandt CM, Spellerberg B. Human infections due to Streptococcus dysgalactiae subspecies equisimilis. Clin Infect Dis. 2009;49(5):766–772. doi: 10.1086/605085. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
PCR analysis of S. dysgalactiae subspecies equisimilis (SDSE) chromosomal DNA did not detect any known Group A streptococcal superantigen genes. S. dysgalactiae subspecies equisimilis (s), positive control (S. pyogenes MGAS5005, SF370, MGAS8232, and MGAS315; +), and negative control (no template). Figure S2: Supernatant from the clinical isolate identified as S. dysgalactiae subspecies equisimilis (SDSE) failed to induce the proliferation of human PBMCs. Human PBMCs were incubated with supernatant dilutions from S. pyogenes strain MGAS5005 or the clinical isolate for 72h and subsequently pulsed with [3H]thymidine to assess mitogenic activity. DNA was harvested after 18 h, and the counts per minute (cpm) were determined by scintillation counting and normalized. The mean (± SEM) of experiments performed in quadruplicate are shown.
