Abstract
In a nationwide study in Germany, a total of 381 Streptococcus pyogenes were collected. Erythromycin A-resistant strains were characterized for the underlying resistance genotype, showing 55.6% had the efflux type mef(A), 31.5% had erm(A), and 13.0% had erm(B). A total of 23 different multilocus sequence types were observed.
Streptococcus pyogenes is a major cause of human disease, producing both mild (e.g., pharyngitis) and severe (e.g., toxic shock-like syndrome, necrotizing fasciitis) infections (6). Macrolides are treatment alternatives to penicillin, valuable especially in patients allergic to β-lactams. Different phenotypes of macrolide resistance have been recognized. Strains of the M phenotype are resistant to 14- and 15-member macrolides, due to the presence of mef(A) genes, conferring efflux of the antibiotic out of the bacterial cell. These strains remain susceptible to 16-member ring macrolides and clindamycin (16).
Target site modification is mostly based on dimethylation of an adenine residue (A2058) of the 23S rRNA domain V through the action of a family of enzymes encoded by erm class genes. Two classes of methylase genes, erm(B) and erm(A), subclass erm(TR), have been described (15). Some of the constitutively resistant erm(B)-positive S. pyogenes strains were found to be telithromycin resistant (13), but telithromycin retains activity against strains possessing the other macrolide resistance genotypes, such as erm(A) and mef(A).
In the present study, consecutive clinical isolates (n = 381) were collected between November 1999 and March 2000 from outpatients with S. pyogenes infections. S. pyogenes isolates were identified by hemolysis on sheep blood agar; Lancefield grouping, using a commercially available agglutination technique (Slidex, Streptokit; BioMérieux, Marcy-L'Etoile, France); and a positive pyrrolidonyl-arylamidase test. MIC testing was performed by the broth microdilution method as recommended by the National Committee for Clinical Laboratory Standards (NCCLS) (10). Streptococcus pneumoniae ATCC 49619 was used as a control strain. Current NCCLS interpretive criteria were used to define antimicrobial resistance (11). In the case of telithromycin, breakpoints proposed by Fuchs et al. (8) of ≤1 and ≥4 mg/ml were used for susceptible and resistant category, respectively. NCCLS breakpoints for roxithromycin were not available. The macrolide resistance phenotype was determined on the basis of the pattern of susceptibility to macrolide-lincosamide-streptogramin B (MLS) antibiotics and confirmed on the basis of the double-disk (erythromycin A plus clindamycin) agar diffusion test (9).
Macrolide-resistant S. pyogenes strains were tested by PCR for the presence of erm(A), erm(B), or mef(A) (13, 14).
The two telithromycin-resistant strains were screened for further resistance determinants, including ere(A), ere(B), msr(A), mph(A), mph(B), and mph(C), as described previously (16, 17). The primers and PCR conditions used to amplify 23S rRNA were identical to those used to amplify the S. pneumoniae gene (17). emm typing was performed as described by Podbielski et al. (12). Multilocus sequence typing was performed as described by Enright et al. for all macrolide-resistant strains (7).
S. pyogenes isolates (n = 381) were predominantly isolated from the throat (n = 256 [67.2%]) and skin (n = 83 [21.8%]). Thirteen strains were isolated from the ear, and 29 were isolated from other sources. Data on antibiotic resistance of all strains and macrolide-resistant strains are presented in Table 1. Resistance to erythromycin A was detected in 54 strains (14.2%). One strain (MSR 141) was levofloxacin-resistant (MIC, ≥32 μg/ml), and two strains were resistant to telithromycin. Additional data on macrolide-resistant strains are presented in Table 2. S. pyogenes strains belonged to the following resistance genotypes: mef(A) (n = 30, 55.6%), erm(A) (n = 17, 31.5%), and erm(B) (n = 7, 13.0%). All mef(A)-positive strains showed the M phenotype as well as a slightly elevated telithromycin MIC at which 90% of the isolates tested are inhibited (MIC90). All erm(A)-positive strains showed inducible resistance to clindamycin. erm(B)-positive strains were inducibly clindamycin resistant or showed the cMLSB phenotype. Two of the erm(B)-positive strains were telithromycin resistant. The two telithromycin-resistant strains (MSR 63, telithromycin MIC, 32 μg/ml; MSR 610, telithromycin MIC, 4 μg/ml; both cMLSB phenotypes) did not contain additional macrolide resistance mechanisms, and no mutations were present in L4 or L22 ribosomal proteins or in the 23S rRNA sequences. In addition, both strains were found to harbor an erm(B) determinant that differed in several ways from the erm(B) determinant described in either the canonical Tn1545 or Tn917 element (15). Strains MSR 63 and MSR610 had a Tn917-like promoter but a 27-amino-acid leader peptide like that found in Tn1545 (Table 3). The two resistant strains also showed a change near the ribosome-binding site (RBS) upstream of the coding sequence. This change may impart better binding of the ribosome and more efficient translation. In addition, these strains had three amino acid differences (I75T, S100N, and H118R) compared to the erm(B) coding sequence in Tn1545; however, S100N is found in the erm(B) sequence in Tn917 without conferring ketolide resistance. I75T was also present in the erm(BC) gene found in the Escherichia coli plasmid pIP1527 (3). Only H118R is unique to these ketolide-resistant strains.
TABLE 1.
Antimicrobial susceptibility of S. pyogenes isolates with different macrolide resistance genotypes in Germany from 1999 to 2000
| S. pyogenes type (n) | Antibiotic | MIC (μg/ml)a
|
No. (%) of strainsb
|
||||
|---|---|---|---|---|---|---|---|
| Range | 50% | 90% | Susceptible | Intermediate | Resistant | ||
| All strains (381) | Penicillin G | ≤0.016-0.06 | ≤0.016 | ≤0.016 | 381 (100) | 0 (0) | 0 (0) |
| Erythromycin A | ≤0.03-≥32 | ≤0.03 | 4 | 326 (85.6) | 1 (0.3) | 54 (14.2) | |
| Clarithromycin | ≤0.03-≥32 | ≤0.03 | 2 | 327 (85.8) | 5 (1.3) | 49 (12.9) | |
| Roxithromycinc | ≤0.03-≥32 | 0.125 | 8 | NDd | ND | ND | |
| Azithromycin | ≤0.03-≥32 | 0.06 | 8 | 324 (85.0) | 2 (0.5) | 55 (14.4) | |
| Clindamycin | ≤0.03-≥32 | ≤0.03 | 0.25 | 377 (98.9) | 0 (0) | 4 (1.1) | |
| Levofloxacin | 0.125-≥32 | 0.5 | 0.5 | 380 (99.7) | 0 (0) | 1 (0.3) | |
| Telithromycinb | ≤0.03-≥32 | ≤0.03 | ≤0.03 | 379 (99.5) | 0 (0) | 2 (0.5) | |
| Erythromycin A resistant (54) | Penicillin G | ≤0.016-0.06 | ≤0.016 | ≤0.016 | 54 (100) | 0 (0) | 0 (0) |
| Erythromycin A | 1-≥32 | 8 | ≥32 | 0 (0) | 0 (0) | 54 (100) | |
| Clarithromycin | 0.5-≥32 | 4 | ≥32 | 0 (0) | 5 (9.3) | 49 (90.7) | |
| Roxithromycinc | 1-≥32 | 16 | ≥32 | ND | ND | ND | |
| Azithromycin | 1-≥32 | 8 | ≥32 | 0 (0) | 1 (1.9) | 53 (98.1) | |
| Clindamycin | ≤0.03-≥32 | 0.06 | 0.25 | 50 (92.6) | 0 (0) | 4 (7.4) | |
| Levofloxacin | 0.125-1 | 0.5 | 0.5 | 54 (100) | 0 (0) | 0 (0) | |
| Telithromycinc | ≤0.03-≥32 | 0.25 | 0.5 | 52 (96.3) | 0 (0) | 2 (3.7) | |
| mef(A) positive (30) | Penicillin G | ≤0.016 | ≤0.016 | ≤0.016 | 30 (100) | 0 (0) | 0 (0) |
| Erythromycin A | 1-16 | 8 | 16 | 0 (0) | 0 (0) | 30 (100) | |
| Clarithromycin | 0.5-16 | 4 | 8 | 0 (0) | 1 (3.3) | 29 (96.7) | |
| Roxithromycinc | 1-32 | 16 | 32 | ND | ND | ND | |
| Azithromycin | 1-32 | 8 | 16 | 0 (0) | 1 (3.3) | 29 (96.7) | |
| Clindamycin | ≤0.03-0.25 | ≤0.03 | 0.25 | 30 (100) | 0 (0) | 0 (0) | |
| Levofloxacin | 0.125-1 | 0.5 | 0.5 | 30 (100) | 0 (0) | 0 (0) | |
| Telithromycinc | ≤0.03-1 | 0.25 | 0.5 | 30 (100) | 0 (0) | 0 (0) | |
| erm(A) positive (17) | Penicillin G | ≤0.016-0.03 | ≤0.016 | ≤0.016 | 17 (100) | 0 (0) | 0 (0) |
| Erythromycin A | 2-≥32 | 4 | 8 | 0 (0) | 0 (0) | 17 (100) | |
| Clarithromycin | 0.5-≥32 | 1 | 8 | 0 (0) | 4 (23.5) | 13 (76.5) | |
| Roxithromycinc | 2-≥32 | 8 | 32 | 0 (0) | 0 (0) | 17 (100) | |
| Azithromycin | 2-≥32 | 16 | 32 | 0 (0) | 0 (0) | 17 (100) | |
| Clindamycine | ≤0.03-0.25 | 0.06 | 0.25 | 17 (100) | 0 (0) | 0 (0) | |
| Levofloxacin | 0.25-1 | 0.25 | 0.5 | 17 (100) | 0 (0) | 0 (0) | |
| Telithromycinc | ≤0.03 | ≤0.03 | ≤0.03 | 17 (100) | 0 (0) | 0 (0) | |
| erm(B) positive (7) | Penicillin G | ≤0.016 | ≤0.016 | ≤0.016 | 7 (100) | 0 (0) | 0 (0) |
| Erythromycin A | 8-≥32 | ≥32 | ≥32 | 0 (0) | 0 (0) | 7 (100) | |
| Clarithromycin | 1-≥32 | ≥32 | ≥32 | 0 (0) | 1 (14.3) | 6 (85.7) | |
| Roxithromycinc | 4-≥32 | ≥32 | ≥32 | 0 (0) | 0 (0) | 7 (100) | |
| Azithromycin | 8-≥32 | ≥32 | ≥32 | 0 (0) | 0 (0) | 7 (100) | |
| Clindamycin | 0.25-≥32 | ≥32 | ≥32 | 3 (42.9) | 0 (0) | 4 (57.1) | |
| Levofloxacin | 0.25-0.5 | 0.25 | 0.5 | 7 (100) | 0 (0) | 0 (0) | |
| Telithromycinc | ≤0.03-≥32 | 0.5 | ≥32 | 5 (71.4) | 0 (0) | 2 (28.6) | |
50% and 90%, MIC50 and MIC90, respectively.
Breakpoints: penicillin G, intermediate, 0.1 to 1 μg/ml, resistant, ≥2 μg/ml; erythromycin A, intermediate, 0.5 μg/ml, resistant, ≥1 μg/ml; clarithromycin, intermediate, 0.5 μg/ml, resistant, ≥1 μg/ml; azithromycin, intermediate, 1 μg/ml, resistant, ≥2 μg/ml; clindamycin, intermediate, 0.5 μg/ml, resistant, ≥1 μg/ml; and levofloxacin, intermediate, 4 μg/ml, resistant, ≥8 μg/ml (11).
Roxithromycin breakpoints are not NCCLS approved. For telithromycin breakpoints of ≤1 μg/ml, ≥4 μg/ml was used (8).
ND, no data.
All strains were inducibly clindamycin resistant (Table 2).
TABLE 2.
emm types and MLST of 54 erythromycin-resistant S. pyogenes strains isolated from outpatients in Germany from 1999 to 2000a
| Genotype (n) | MSR strain no. | Town of origin | Source | Infection | MIC (μg/ml)
|
Macrolide resistance
|
emm | MLST allele
|
ST | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ERY | TEL | CLI | GT | PT | gki | gtr | murL | mutS | recP | xpt | yqiL | |||||||
| mef(A) (30) | 18 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 1 | 0.03 | 0.25 | mef(A) | M | 1 | 4 | 3 | 4 | 4 | 4 | 2 | 4 | 28 |
| 54 | Plön | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.25 | mef(A) | M | 1 | 4 | 3 | 4 | 4 | 4 | 2 | 4 | 28 | |
| 750 | Neukirchen | Swab | Wound infection | 16 | 0.25 | 0.03 | mef(A) | M | 1 | 4 | 31 | 2 | 4 | 4 | 2 | 16 | 28−V1 | |
| 331 | Weiden | Throat swab | Tonsillopharyngitis | 8 | 0.5 | 0.03 | mef(A) | M | 1 | 4 | 3 | 4 | 4 | 4 | 2V | 4 | 28−V2 | |
| 332 | Weiden | Throat swab | Tonsillopharyngitis | 16 | 0.5 | 0.06 | mef(A) | M | 1 | 4 | 3 | 4 | 4 | 4 | 2V | 4 | 28−V2 | |
| 699 | Weiden | Throat swab | Tonsillopharyngitis | 16 | 1 | 0.03 | mef(A) | M | 1 | 4 | 3 | 4 | 4 | 4 | 2V | 4 | 28−V2 | |
| 361 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 8 | 0.5 | 0.03 | mef(A) | M | 2 | 11 | 9 | 1 | 9 | 2 | 3 | 4 | 55 | |
| 576 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.03 | mef(A) | M | 3 | 2 | 6 | 8 | 5 | 2 | 3 | 2 | 15 | |
| 403 | Dillingen/Saar | Swab | Wound infection | 4 | 0.125 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 42 | Trier | Throat swab | Tonsillopharyngitis | 8 | 0.25 | 0.125 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 60 | Plön | Throat swab | Tonsillopharyngitis | 8 | 0.25 | 0.25 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 254 | Wülfrath | Throat swab | Tonsillopharyngitis | 8 | 0.125 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 267 | Neukirchen | Throat swab | Tonsillopharyngitis | 8 | 0.25 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 295 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 8 | 0.25 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 582 | Dillingen/Saar | Ear | Wound infection | 8 | 0.25 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 598 | Plön | Throat swab | Tonsillopharyngitis | 8 | 0.125 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 51 | Plön | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.125 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 52 | Plön | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.25 | mef(A) | M | 4 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 61 | Plön | Throat swab | Tonsillopharyngitis | 16 | 0.5 | 0.06 | mef(A) | M | 4 | 4 | 11 | 8 | 5 | 15 | 2 | 1 | 39−V1 | |
| 583 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 8 | 0.25 | 0.03 | mef(A) | M | 4 | 5 | 11 | 8 | 3 | 15 | 2 | 1 | 39−V2 | |
| 5 | Leverkusen | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.25 | mef(A) | M | 4 | 5 | 11V | 8 | 5 | 15 | 2 | 1 | 39−V3 | |
| 794 | Stuttgart | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.03 | mef(A) | M | 5 | 33 | 30 | 7 | 5 | 5 | 26 | 3 | 99 | |
| 260 | Wülfrath | Swab | Wound infection | 4 | 0.25 | 0.03 | mef(A) | M | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 344 | Bonn | Swab | ND | 8 | 0.5 | 0.06 | mef(A) | M | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 695 | Dillingen/Saar | Throat swab | Tonsillopharyngitis | 16 | 0.25 | 0.03 | mef(A) | M | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 773 | Neukirchen | Throat swab | Tonsillopharyngitis | 16 | 0.5 | 0.03 | mef(A) | M | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 144 | Dillingen/Saar | Swab | Wound infection | 8 | 0.25 | 0.25 | mef(A) | M | 12 | 5 | 11 | 8 | 5 | 15 | 2 | 1 | 39 | |
| 591 | Bonn | Throat swab | Tonsillopharyngitis | 16 | 0.5 | 0.03 | mef(A) | M | 75 | 11 | 2 | 1 | 3 | 12 | 3 | 7 | 49 | |
| 567 | Weiden | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.06 | mef(A) | M | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 206 | Bonn | Ear | ND | 16 | 0.5 | 0.03 | mef(A) | M | 77 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| erm(B) (7) | 564 | Weiden | Throat swab | Tonsillopharyngitis | 32 | 0.5 | 32 | erm(B) | c | 1 | 4 | 3 | 4 | 4 | 4 | 2V | 4 | 28−V2 |
| 63 | Hamburg | Throat swab | Tonsillopharyngitis | 32 | 32 | 32 | erm(B) | c | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 235 | Bad Hersfeld | Throat swab | Tonsillopharyngitis | 32 | 1 | 32 | erm(B) | c | 12 | 5 | 2 | 2 | 6 | 6 | 2 | 2 | 36 | |
| 610 | Stuttgart | Swab | Wound infection | 32 | 4 | 32 | erm(B) | c | 22 | 9 | 8 | 1 | 1 | 1 | 3 | 4 | 46 | |
| 76 | Hamburg | Throat swab | Scarlatina | 8 | 0.03 | 0.25 | erm(B) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 44 | Trier | Throat swab | Tonsillopharyngitis | 32 | 0.03 | 0.25 | erm(B) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 333 | Weiden | Throat swab | Tonsillopharyngitis | 32 | 0.06 | 0.25 | erm(B) | i | 77 | 16 | 2 | 8 | 3 | 1 | 13 | 3 | 101 | |
| erm(A) (17) | 227 | Osnabrück | Throat swab | Tonsillopharyngitis | 8 | 0.03 | 0.125 | erm(A) | i | 12 | 3 | 6 | 2 | 3 | 23 | 3 | 11 | New |
| 108 | Plön | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.25 | erm(A) | i | 28 | 11 | 6 | 14 | 5 | 9 | 17 | 19 | 52 | |
| 247 | Trier | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.03 | erm(A) | i | 28 | 11 | 6 | 14 | 5 | 9 | 17 | 19 | 52 | |
| 380 | Stuttgart | Swab | Wound infection | 2 | 0.03 | 0.03 | erm(A) | i | 44/61 | 4 | 2 | 3 | 11 | 17 | 3 | 1V | New | |
| 600 | Wülfrath | Swab | Erysipelas | 4 | 0.03 | 0.06 | erm(A) | i | 44/61 | 4 | 2 | 3 | 1 | 17 | 3 | 1V | New | |
| 393 | Leverkusen | Throat swab | Tonsillopharyngitis | 4 | 0.03 | 0.06 | erm(A) | i | 58 | 3 | 2 | 3 | 3 | 1 | 3 | 3 | 19−V1 | |
| 698 | Neukirchen | Swab | Wound infection | 2 | 0.03 | 0.06 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 269 | Augsburg | Throat swab | Tonsillopharyngitis | 4 | 0.03 | 0.125 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 50 | Plön | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.03 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 92 | Bad Hersfeld | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.25 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 77 | Hamburg | Throat swab | Scarlatina | 8 | 0.03 | 0.125 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 113 | Plön | Throat swab | Tonsillopharyngitis | 8 | 0.03 | 0.25 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 395 | Leverkusen | Throat swab | Tonsillopharyngitis | 8 | 0.03 | 0.125 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 21 | Weiden | Swab | Wound infection | 32 | 0.03 | 0.125 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 23 | 3 | 11 | 63 | |
| 640 | Stuttgart | Throat swab | Tonsillopharyngitis | 2 | 0.03 | 0.03 | erm(A) | i | 77 | 13 | 6 | 2 | 3 | 9 | 3 | 11 | 63−V1 | |
| 690 | Berlin | Ear | Wound infection | 2 | 0.03 | 0.03 | erm(A) | i | 77 | 9 | 6 | 2 | 5 | 23 | 3 | 11 | 63−V2 | |
| 696 | Dillingen/Saar | BS | ND | 4 | 0.03 | 0.06 | erm(A) | i | 77 | 5 | 6 | 2 | 6 | 23 | 3 | 11 | 63−V3 | |
Abbreviations: TEL, telithromycin; ERY, erythromycin; CLI, clindamycin; BS, bronchial secretion; PT, phenotype; GT, genotype; i, inducible MLSB phenotype; c, constitutive MLSB phenotype; V, variant; ND, no data.
TABLE 3.
erm(B) upstream sequences from ketolide-resistant S. pyogenes isolates
| Isolate | Sequence |
|---|---|
| pAM77 | TTTTGT--ATAATAGGAATTGAAGTTAAA |
| Tn1545 | GT |
| MSR 63 | -- |
| MSR 610 | -- |
| pAM77 | TTAGATGCTAAAAATTTGTAATTAAGAAggagg |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | |
| pAM77 | GATTCGTCATGTTGGTATTCCAAATGCGTA |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | |
| pAM77 | ATGTAGATAAAACATCTACTGTTTTGAAACAG |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | |
| pAM77 | ACTAAAAACAGTGATTACGCAGATAAA |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | |
| pAM77 | TA----CGTTAGATTAATTCCTACCAGTGACT |
| Tn1545 | AATA |
| MSR 63 | AATA |
| MSR 610 | AATA |
| pAM77 | AATCTTATGACTTTTTAAACAGATAACTAAAA |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | |
| pAM77 | ATTACAAACAAATCGTTTAACTTCTGTATTTA |
| Tn1545 | |
| MSR 63 | |
| MSR 610 | G |
| pAM77 | TTTATAGATGTA-TCACTTCAGGAGTGATTAC |
| Tn1545 | CAA |
| MSR 63 | AA |
| MSR 610 | AA |
erm(B) upstream sequences from ketolide-resistant S. pyogenes isolates are shown. The sequences upstream of erm(B) in Streptococcus sanguis (pAM77), S. pneumoniae (Tn1545), and the two ketolide-resistant S. pyogenes strains are compared (15). Boldface residues delineate the promoter region, lowercase letters represent the RBS before a leader peptide (underlined) of 36 amino acids (pAM77) or 27 amino acids (Tn1545, MSR 63, MSR610). (TAA is a stop codon.) Only residues that differ from pAM77 erm(B) are shown.
emm typing of erythromycin A-resistant (n = 54) and randomly selected macrolide-susceptible (n = 60) S. pyogenes isolates showed that strains of emm types 77 (n = 19, 45.2%) and 4 (n = 13, 26.2%) were found significantly more often among resistant isolates (Table 4).
TABLE 4.
Distribution of emm types among 54 erythromycin-resistant and 60 erythromycin-susceptible S. pyogenes strains isolated from outpatients in Germany from 1999 to 2000
| emm type | No. (%) of strains:
|
|
|---|---|---|
| Erythromycin susceptible | Erythromycin resistant | |
| 1 | 6 (10.0) | 7 (13.0) |
| 2 | 2 (3.3) | 1 (1.9) |
| 3 | 3 (5.0) | 1 (1.9) |
| 4 | 4 (6.7) | 13 (24.1) |
| 5 | 0 (0.0) | 1 (1.9) |
| 6 | 5 (8.3) | 0 (0.0) |
| 9 | 2 (3.3) | 0 (0.0) |
| 12 | 10 (16.7) | 8 (14.8) |
| 22 | 1 (1.7) | 1 (1.9) |
| 28 | 9 (15.0) | 2 (3.7) |
| 29 | 1 (1.7) | 0 (0.0) |
| 44/61 | 0 (0.0) | 2 (3.7) |
| 49 | 2 (3.3) | 0 (0.0) |
| 58 | 0 (0.0) | 1 (1.9) |
| 59 | 1 (1.7) | 0 (0.0) |
| 75 | 5 (8.3) | 1 (1.9) |
| 77 | 5 (8.3) | 16 (29.6) |
| 78 | 3 (5.0) | 0 (0.0) |
| 81 | 1 (1.7) | 0 (0.0) |
| Total | 60 (100.0) | 54 (100.0) |
Antibiotic resistance is of growing concern with regard to S. pyogenes isolates from Germany. Previous investigators have reported on macrolide resistance rates among S. pyogenes of 4% in 1992 to 1993 (5), 1.6% in 1997 (18), 12.7% in 1996 to 1998 (1), 7.9% in 1997 (2), and 13.7% in 2000 (13). In an international study including 1,485 isolates of S. pyogenes, almost 10% of S. pyogenes isolates were erythromycin A resistant. There was a wide heterogeneity of resistance, with high levels of macrolide resistance in Poland (42%), Hong Kong (28%), Italy (25%), Portugal (24%), and Spain (21%) and no macrolide resistance in Indonesia, Austria, Belgium, The Netherlands, or the United Kingdom (4).
In the present study, stable associations between emm type and MLST were observed. Twelve new STs were described. Of note, three strains (MSR 144, MSR 206, and MSR 333) showed an MLST emm type combination that had not been described to date. A total of 27 different STs were observed in the present investigation, but three clones were identified to account for more than 50% of macrolide resistance of S. pyogenes in Germany: mef(A)-positive emm type 4 isolates (ST 39, n = 10 plus 3 single-locus variants), an erm(A)-positive clone of emm type 77 (ST 63, n = 8 plus 3 single-locus variants), and mef(A)-positive emm type 12 isolates (ST 36, n = 4).
Acknowledgments
(This work was presented in part at the 40th Interscience Conference on Antimicrobial Agents and Chemotherapy, Toronto, Canada [abstr. C2-693], and at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy, Chicago, Ill. [abstr. C1-1813].)
S. pyogenes reference strains were kindly provided by Helena Seppälä, Turku, Finland [strain A200, erm(A)/erm(TR)-positive], Aftab Jasir, Lund, Sweden [strains 544 and 517R, erm(B)], and Joyce Sutcliffe, New Haven, Conn. [strain O2C1064, mef(A) positive]. We thank Nelli Neuberger and Claudia Cremer for excellent technical assistance. We thank Susanne Reinert (SR Medical Communications GmbH, Germany) for organizing and monitoring the study.
This study was supported in part by Aventis Pharma, Romainville, France, and in part by grant RKI-415/1369235 from the German Ministry of Health (Bundesminister für Gesundheit).
We thank the following persons and institutions (all in Germany) for cooperation and for providing isolates: B. Wille, Institut für Krankenhaushygiene und Infektionskontrolle, Giessen; G. Schonard, Laborarztpraxis, Bad Hersfeld; U. Grimmer, Laborarztpraxis, Chemnitz; M. Seewald, Institut für Medizin Diagnostik, Berlin; R. Pfüller, Medizinisch-Diagnistische Institute, Berlin; J. Ungeheuer, Labor Frohreich und Partner, Hamburg; J. Enzenhauer, Osnabrück; Untersuchungsamt, Hanover; A. Krenz-Weinreich, Plön; E. Kühnen, Trier; H. G. Enders, Stuttgart; U. Walter, Wülfrath; J. Lenzen, Bonn; M. Jacobs, Mikrobiologisches Labor, Dillingen; W. Dirr, Augsburg; H. Hofmeister, Weiden; J. Matthes, Neuötting; F. Pranada, Gemeinschaftspraxis für Labormedizin, Dortmund; N. Schöngen, Gemeinschafts Praxis für Labormedizin, Leverkusen; and B. Hövener, Aachen.
REFERENCES
- 1.Arvand, M., M. Hoeck, H. Hahn, and J. Wagner. 2000. Antimicrobial resistance in Streptococcus pyogenes isolates in Berlin. J. Antimicrob. Chemother. 46:621-624. [DOI] [PubMed] [Google Scholar]
- 2.Brandt, C. M., M. Honscha, N. D. Truong, R. Holland, B. Hovener, A. Bryskier, R. Lütticken, and R. R. Reinert. 2001. Macrolide resistance in Streptococcus pyogenes isolates from throat infections in the region of Aachen, Germany. Microb. Drug Resist. 7:165-170. [DOI] [PubMed] [Google Scholar]
- 3.Brisson-Noël, A., M. Arthur, and P. Courvalin. 1988. Evidence for natural gene transfer from gram-positive cocci to Escherichia coli. J. Bacteriol. 170:1739-1745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Canton, R., E. Loza, M. I. Morosini, and F. Baquero. 2002. Antimicrobial resistance amongst isolates of Streptococcus pyogenes and Staphylococcus aureus in the PROTEKT Antimicrobial Surveillance Programme during 1999-2000. J. Antimicrob. Chemother. 50(Suppl. 1):9-24. [DOI] [PubMed] [Google Scholar]
- 5.Cullmann, W. 1996. Comparative evaluation of orally active antibiotics against community-acquired pathogens: results of eight European countries. Chemotherapy 42:11-20. [DOI] [PubMed] [Google Scholar]
- 6.Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13:470-511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Enright, M. C., B. G. Spratt, A. Kalia, J. H. Cross, and D. E. Bessen. 2001. Multilocus sequence typing of Streptococcus pyogenes and the relationships between emm type and clone. Infect. Immun. 69:2416-2427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fuchs, P. C., A. L. Barry, and S. D. Brown. 2002. Selection of zone size interpretive criteria for disk diffusion susceptibility tests of three antibiotics against Streptococcus pneumoniae, using the new guidelines of the National Committee for Clinical Laboratory Standards. Antimicrob. Agents Chemother. 46:398-401. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Montanari, M. P., M. Mingoia, E. Giovanetti, and P. E. Varaldo. 2001. Differentiation of resistance phenotypes among erythromycin-resistant pneumococci. J. Clin. Microbiol. 39:1311-1315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A6, 4th ed. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 11.National Committee for Clinical Laboratory Standards. 2003. Performance standards for antimicrobial susceptibility testing. Supplement M100-S13. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 12.Podbielski, A., B. Melzer, and R. Lütticken. 1991. Application of the polymerase chain reaction to study the M protein(-like) gene family in beta-hemolytic streptococci. Med. Microbiol. Immunol. 180:213-227. [DOI] [PubMed] [Google Scholar]
- 13.Reinert, R. R., R. Lütticken, A. Bryskier, and A. Al-Lahham. 2003. Macrolide-resistant Streptococcus pneumoniae and Streptococcus pyogenes in the pediatric population in Germany during 2000-2001. Antimicrob. Agents Chemother. 47:489-493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Reinert, R. R., A. Wild, P. Appelbaum, R. Lütticken, M. Y. Cil, and A. Al-Lahham. 2003. Ribosomal mutations conferring resistance to macrolides in Streptococcus pneumoniae clinical strains isolated in Germany. Antimicrob. Agents Chemother. 47:2319-2322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppälä. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823-2830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Tait-Kamradt, A., T. Davies, M. Cronan, M. R. Jacobs, P. C. Appelbaum, and J. Sutcliffe. 2000. Mutations in 23S rRNA and ribosomal protein L4 account for resistance in pneumococcal strains selected in vitro by macrolide passage. Antimicrob. Agents Chemother. 44:2118-2125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Traub, W. H., and B. Leonhard. 1997. Comparative susceptibility of clinical group A, B, C, F, and G beta-hemolytic streptococcal isolates to 24 antimicrobial drugs. Chemotherapy 43:10-20. [DOI] [PubMed] [Google Scholar]