Histone Variant H2A.Z Functions in Sister Chromatid Cohesion in Saccharomyces cerevisiae

Abstract

H2A.Z is a highly conserved variant of histone H2A with well-characterized roles in transcriptional regulation. We previously reported that H2A.Z and Mcd1, a subunit of the cohesin complex, regulate the establishment of transcriptional silencing at telomeres in Saccharomyces cerevisiae and that H2A.Z broadly dissociated from chromatin during the anaphase-to-telophase transition, coincident with the dissociation of Mcd1 from chromosomes and dissolution of cohesion. In this study, we show that depletion of H2A.Z causes precocious loss of sister chromatid cohesion in yeast without loss of Mcd1 from chromosomes. H2A.Z is deposited into chromatin by the SWR1 complex and is subject to acetylation of its four N-terminal tail lysine residues by the NuA4 and SAGA histone acetyltransferase complexes. We found that cells compromised for function of the SWR1 complex were defective in cohesion, as were cells expressing a form of H2A.Z not subject to acetylation. Finally, inactivation of H2A.Z in metaphase-blocked cells led immediately to cohesion defects, suggesting a direct role for H2A.Z in the maintenance of sister chromatid cohesion.

INTRODUCTION

The packaging of DNA into chromatin affects multiple processes, including transcription, replication, and chromosome segregation. Complementing the function of the four major histones, histone variants play specific roles in these processes. Histone H2A.Z, coded for by the HTZ1 gene in Saccharomyces cerevisiae, is a well-conserved variant of H2A that functions in the regulation of gene expression, maintenance of heterochromatin-euchromatin boundaries, DNA repair, and resistance to genotoxic stress (reviewed in references 1 to 5). H2A.Z is deposited into chromatin by the SWR1 complex (6–8) and is subject to acetylation of its four N-terminal tail lysine residues by the NuA4 and SAGA histone acetyltransferase complexes (9–12). Several observations suggest that H2A.Z also promotes genomic integrity in yeast cells. Loss of H2A.Z, components of the SWR1 complex, or members of the NuA4 complex causes chromosome loss and sensitivity to the microtubule-destabilizing drug benomyl (13). In addition, genetic interactions between kinetochore and spindle checkpoint proteins and H2A.Z, SWR1, and NuA4 have been reported (13, 14).

H2A.Z also contributes to chromosome stability in fission yeast and mammals, where deletion or knockdown of H2A.Z leads to lagging chromosomes, anaphase bridges, and an increased rate of chromosome loss (15–18). Recently, H2A.Z has also been shown to stabilize the association of condensin with mitotic chromosomes in fission yeast (17, 19). In addition, H2A.Z localizes to pericentric chromatin in yeast and mammals (13, 20, 21) and contributes to the formation of proper centromere structure in mammals (20). However, the specific role of H2A.Z in chromosome segregation in any species has not been determined.

Precise chromosome segregation requires the formation of stable cohesion between the replicated sister chromatids until their separation in anaphase. In Saccharomyces cerevisiae and other eukaryotes, a multisubunit complex known as the cohesin complex is responsible for holding sister chromatids together. Yeast cohesin is composed of at least four proteins, Mcd1/Scc1, Smc1, Smc3, and Scc3; this complex may form a ring around both sister chromatids (reviewed in reference 22). We have previously shown that H2A.Z and Mcd1 regulate the establishment of silencing at telomeres in a similar manner, suggesting that these two proteins might have related functions. In addition, we found that H2A.Z is broadly dissociated from yeast chromatin during the anaphase-to-telophase transition, coincident with the dissociation of Mcd1 from chromosomes and dissolution of sister chromatid cohesion (23). In this study, we provide evidence that H2A.Z directly regulates sister chromatid cohesion by maintaining chromosome cohesion during metaphase.

MATERIALS AND METHODS

Media and cell cultures.

All cultures were grown in YPD medium (1% Bacto yeast extract, 2% Bacto peptone extract, 2% dextrose). For solid medium, Bacto agar was added to 2%. Cell cycle blocks were achieved as described in reference 23, except for H2A.Z degron cultures, wherein metaphase arrest was maintained by the addition of 20 μg/ml benomyl 3 h after the addition of nocodazole. H2A.Z degron strains were grown at 23°C in YPD medium containing 160 μg/ml CuSO₄. To induce H2A.Z degradation, the cell culture was shifted to 37°C after the copper was washed from the medium.

Yeast strains.

The yeast strains used in this study are described in Table 1. Most gene or locus deletions were constructed by PCR-mediated gene deletion (24) with MX series plasmids as templates (25). YSH505 and YSH814 have been described previously (23, 26). YSH996 was constructed by tagging the C terminus coding sequence of HTZ1 with a sequence encoding a three-FLAG epitope tag PCR amplified from plasmid pJR2659 (9). YSH1012 (YLA1119) (27) and YSH1015 (YBS1045) (28) cohesion assay strains were a generous gift from Robert Skibbens. YSH1030 and YSH1055 were created from YSH1015 by deleting the HTZ1 gene locus with the nat1MX4 and hygMX4 drug resistance markers, respectively. Similarly, YSH1068 was created from YSH1012 by replacing the HTZ1 gene locus with hygMX4. YSH1071 and YSH1072 were created from YSH1015 and YSH1055 by deleting the SWR1 gene locus with hygMX4. nat1MX4 and hygMX4 were PCR amplified from pAG25 and pAG32, respectively (25). YSH1086 containing the HTZ1 temperature-sensitive degron allele (htz1-td) was created with plasmid pKL187 from EUROSCARF (29). To achieve rapid depletion of H2A.Z at the nonpermissive temperature, a plasmid containing a heat-inducible UBR1 gene, p2HSE-5Myc-UBR1, a gift from M. Mitchell Smith, was integrated into YSH1086 to create YSH1096. YSH1100, YSH1101, and YSH1102 were created from YSH1055 by replacing Δhtz1::hygMX4 with HTZ1-3FLAG-kanMX4, htz1K14R-3FLAG-kanMX4, and htz1K3,8,10,14R-3FLAG-kanMX4, respectively. These HTZ1 alleles were amplified from pJR2659, pJR2973, and pJR2974, respectively, provided by Josh Babiarz and Jasper Rine (9). G418-resistant transformants that failed to grow on hygromycin plates were tested for HTZ1 integration by PCR; correct integration of the alleles was confirmed by sequencing. YSH1110 was created from YSH505 by deleting HTZ1 with kanMX4 and fusing the MCD1 gene at its 3′ end to a six-hemagglutinin (HA) epitope tag. The C terminus coding sequence of MCD1 was tagged with 6HA-hygMX4 in YSH1096 to create YSH1132. HTZ1 was deleted with natMX4 in YSH1161 to create YSH1162.

Table 1.

Strains used in this study

Strain	Genotype	Source or reference
YSH505	MATa ade2Δ::hisG his3Δ200 leu2Δ0 met15Δ0 ura3Δ0 Δppr1::HIS3 URA3-TELVR trp1Δ63::GAL10p-SIR3-TRP1	26
YSH814	YSH505 SCC1-6HA (HYG)	23
YSH996	YSH505 Δscc1::scc1-73LEU2 HTZ1-3FLAG-kanMX4	This study
YSH1012 (YLA1119)	MATa HIS3::LacI-GFP CLONAT:KAN:LacO:tel IV PDS1-12Myc:TRP1	27
YSH1015 (YBS1045)	MATa ade2 trp1 his3 leu2::LEU2 tetR-GFP URA3::3XURAtetO112 PDS1-13Myc-TRP1	28
YSH1030	YBS1045 Δhtz1::natMX4	This study
YSH1055	YBS1045 Δhtz1::hygMX4	This study
YSH1068	YLA1119 Δhtz1::hygMX4	This study
YSH1071	YBS1045 Δswr1::hygMX4	This study
YSH1072	YSH1055 Δswr1::hygMX4	This study
YSH1086	YBS1045 kan-Cup1pr-degrots-HTZ1	This study
YSH1096	YSH1086 UBR1::2HSE-5Myc-UBR1	This study
YSH1100	YSH1055 HTZ1-3FLAG-kanMX4	This study
YSH1101	YSH1055 htz1K14R-3FLAG-kanMX4	This study
YSH1102	YSH1055 htz1K3,8,10,14R-3FLAG-kanMX4	This study
YSH1110	YSH505 Δhtz1::kanMX4 Scc1-6HA(HYG)	This study

Fluorescence microscopy and cohesion assay.

Semisquash preparations were adapted from procedure C of reference 30 with minor modifications. Cultures were grown to log phase (optical density at 600 nm, 0.2 to 0.4), and then 5 ml was removed and blocked in the G₁ and G₂ phases of the cell cycle with α-factor and nocodazole, respectively. After achieving the respective cell cycle arrests, freshly prepared paraformaldehyde was added to the cultures to a final concentration of 4%. Fixation was carried out at room temperature for 1 h and followed by a wash with 1 ml of a 1% potassium acetate (KAc)–1 M sorbitol solution (2,000 rpm for 4 min). Next, the cells were spheroplasted by resuspending the pellet in 500 μl of a 1% KAc–1 M sorbitol solution containing 10 μl of 1 M dithiothreitol and 20 μl of 10 mg/ml Zymolyase 20T. After 30 to 40 min of incubation at 37°C, digestion was halted by the addition of 500 μl stop solution [0.1 M 2-(N-morpholino)ethane acid (MES), 1 mM EDTA, 0.5 mM MgCl₂, and 1 M sorbitol in distilled water]. Cells were then collected by centrifugation, and the pellets were washed in 1 ml stop solution. Cell pellets were resuspended in 80 μl cold MES solution [0.1 M 2-(N-morpholino)ethane acid, 1 mM EDTA, 0.5 mM MgCl₂], and 200 μl of fixative (4% paraformaldehyde [pH 8]) was added. The fixed cells were immediately spread over a glass slide, and the slides were processed for immunostaining.

Immunostaining was performed as described previously (31) with mouse c-myc (9E10) monoclonal antibody (MMS-150P; Covance) to detect Pds1-13myc (securin) at a 1:100 dilution. Pds1 staining was used to identify metaphase-blocked cells in the experiments shown in Fig. 1 and 5. Alexa Fluor 568 anti-mouse antibody (A11004; Molecular Probes) at a 1:200 dilution was used as the secondary antibody. Softworx software, in conjunction with the Deltavision RT imaging system (Applied Precision) adapted to an Olympus (IX70) microscope, was used to acquire Z-stacked images. In all experiments, a minimum of 100 metaphase-arrested cells and 50 G₁-arrested cells were scored; data were accumulated in multiple independent experiments, and all scoring was done without experimenter knowledge of the strain being scored.

Fig 1.

Precocious loss of sister chromatid cohesion upon deletion of HTZ1 or SWR1. Visualization of sister chromatid cohesion in the wild-type (YSH1015) and Δhtz1 (YSH1030 and YSH1055), Δswr1 (YSH1071), and Δhtz1 Δswr1 (YSH1072) mutant strains containing chromosome V marked by GFP at the URA3 locus and expressing Pds1-13Myc. Cultures were grown to log phase, when one half of the culture was blocked in G₁ with α-factor and the other half was blocked in metaphase with nocodazole. (A) Representative micrographs of G₁- and metaphase-blocked cells stained with 4′,6-diamidino-2-phenylindole (DAPI) (DNA) and an antibody to the Myc epitope (Pds1-13Myc). GFP-marked chromosome V can be visualized as a single GFP spot or two separate GFP spots in the case of cohesion loss. Colors are indicated by the corresponding labels. Bars, 5 μm. (B) Bar graph showing the percentage of cells of each genotype with two GFP spots at G₁ and nocodazole arrest. The total numbers of cells scored for the wild type are 276 at G₁ and 193 at metaphase; for the Δhtz1 mutant, 131 at G₁ and 200 at metaphase, for the Δswr1 mutant, 50 at G₁ and 100 at metaphase, and for the Δhtz1 Δswr1 mutant, 50 at G₁ and 100 at metaphase. All cohesion assays were performed three times for the Δhtz1 mutant strains and at least two times for the remaining strains. The number of metaphase-arrested cells with two GFP spots in deletion strains is significantly different from that of the wild-type strain. The two-tailed Fisher exact test P value for the wild type versus the Δhtz1 mutant is <0.0001, that for the wild type versus the Δswr1 mutant is 0.0004, that for the wild type versus the Δhtz1 Δswr1 mutant is <0.0001, that for the Δhtz1 mutant versus the Δhtz1 Δswr1 mutant is 0.2882, and that for the Δswr1 mutant versus the Δhtz1 Δswr1 mutant is 0.3611. (C) Bar graph showing the percentages of cells of the wild-type (YSH1012) and Δhtz1 mutant (YSH1068) strains with two GFP spots marking a telomere-proximal region. The experiment was carried out as described for panel B. The total numbers of cells scored in two independent experiments for the wild-type strain are 76 at G₁ and 85 at metaphase, and those for the Δhtz1 mutant strain are 95 at G₁ and 78 at metaphase. The number of metaphase-arrested deletion mutant cells with two GFP spots is significantly different from that of wild-type cells (P < 0.0001).

Fig 5.

Acetylation of H2A.Z regulates sister chromatid cohesion. (A) Cohesion assays were performed as described in the legend to Fig. 1, with the wild-type (wt) HTZ1-FLAG-KanMx (YSH1100) and htz1-K14R-FLAG-KanMx (YSH1101) and htz1K3,8,10,14R-FLAG-KanMx (YSH1102) mutant strains. The number of cells scored for the wild type were 85 at G₁ and 184 at metaphase; for the htz1K14R mutant, 55 at G₁ and 190 at metaphase; and for the htz1K3,8,10,14R mutant, 70 at G₁ and 188 at metaphase. Images of the cells scored were collected from two independent experiments. The number of cells with two GFP spots is significantly different between the wild type and htz1K3,8,10,14R mutant (P = 0.0385) and between the htz1K14R and htz1K3,8,10,14R mutants (P = 0.0091) but not different between the wild type and the htz1K14R mutant (P = 0.7316). (B) Acetylated Smc3 (Smc3Ac) levels are not changed upon deletion of HTZ1. (Bottom) Wild-type or Δhtz1 cells expressing Smc3 with a tandem affinity purification tag (Smc3-TAP) were grown to log phase, when one-half of the culture was arrested in G₂ using nocodazole. Western blot analysis was carried out using antibodies specific to acetylated Smc3 (a gift from Katsuhiko Shirahige), to protein A for detecting total Smc3-TAP levels, and to tubulin, used as an internal control. (Top) To demonstrate the specificity of the anti-acetylated Smc3 antibody, an antibody to the HA epitope was used to immunoprecipitate Smc3 from strains expressing Smc3-HA or acetylation mutant smc3K112RK113R-HA (gifts from K. Nasmyth). This material was then subjected to immunoblotting using antibodies specific to acetylated Smc3 or to HA. Lysate, whole-cell lysate; -Ab, no antibody; IP, anti-HA-immunoprecipitated material.

ChIP.

Chromatin immunoprecipitation (ChIP) was carried out as described previously (23), except that protein G magnetic beads (S1430S; New England BioLabs) were used for Scc1-HA ChIP assays. The sequences of the primers used for the quantitative PCR are provided in Table 2.

Table 2.

Primers used in this study

Primer	Sequence	Hybridization region
SP907	ATATGATTGGATCCTACGGTCTTCC	GIT1 promoter
SP908	TCAATCCATGCTAAGGTGGG	GIT1 promoter
SP911	AAAAGAGTTAGGCTGAGTGAATCCTT	RPS8b promoter
SP912	GCCCAGAAGTCGGTAGCTAAAG	RPS8b promoter
SP978	TGGCAGAGAATCCAGATCCAA	PRP8
SP979	ACTGCTCGCCCTAGGTTAACG	PRP8
SP1098	TGAATGTCCACCCTGCATGA	AIF1 promoter
SP1099	GCTTTCGTTTCTAGTCTGCAGCA	AIF1 promoter
SP1340	AGAAAAACAGTTACCAATTTAG	CEN3 coordinates 113171–113423
SP1341	TAATTGAAGACGCTTTCAAT	CEN3 coordinates 113171–113423
SP867	TCTAAATCACTCATATAAACCGAACCC	CEN3 coordinates 114240–114341
SP868	CCATATTGTTTGGCGCTGATC	CEN3 coordinates 114240–114341
SP1344	CAGTAAAAAGGTAATGATTG	CEN3 coordinates 114622–114924
SP1345	TGAAGAAATCAATTTTGAAG	CEN3 coordinates 114622–114924
SP1346	CAGGAGAATGCATCGTCGTG	CEN16 coordinates 555039–555331
SP1347	GCCAAGATTGGATTATAGCC	CEN16 coordinates 555039–555331
SP865	CACTCCGACCTTTCTGATGAGTT	CEN16 coordinates 555455–555556
SP866	TTTAAAAGAAGAAGCATTTCCACAAG	CEN16 coordinates 555455–555556
SP1350	TCCTGCCAGAATCAATGTTA	CEN16 coordinates 556705–556974
SP1351	AATCTTCAAGAGTATCTTTC	CEN16 coordinates 556705–556974
SP1358	ATGAAGATGACATTGCTCCT	549.7 kb from left of telomere V
SP1359	GTATCTGGATAATGGATCTG	549.7 kb from left of telomere V
SP1360	ACAAGCATCATTCATAGCCT	534 kb from left of telomere V
SP1361	ATCGTGGCTAGGACATTTTG	534 kb from left of telomere V

Western blot analysis.

For H2A.Z degron strains, cells were grown to log phase in medium containing 1 mM CuSO₄. Half of the culture was centrifuged (3,000 rpm with a Sorvall RT6000B centrifuge for 5 min at room temperature) to remove the CuSO₄ from the medium, resuspended in fresh YPD medium (without CuSO₄), and then shifted to the nonpermissive temperature (37°C), while the other half of the culture was maintained at the permissive temperature (23°C) in medium containing CuSO₄. Samples were taken out after 2, 4, or 6 h of growth. Protein was extracted from whole cells by the trichloroacetic acid precipitation method. The samples were boiled for 5 min. Bradford assays were performed to determine the concentration of protein in each sample. Equal concentrations of proteins were then loaded onto 12% polyacrylamide-SDS gels. Duplicate gels were run; one gel was stained with Coomassie to confirm consistent loading from lane to lane. The proteins were transferred onto a nitrocellulose membrane with a Hoefer TE 70 Series SemiPhor semidry transfer unit (Amersham Biosciences). Membranes were blocked with 5% nonfat dry milk in 20 mM Tris (pH 7.5)–150 mM NaCl–0.10% Tween 20 and probed with an anti-c-myc antibody (clone 9E11; Cell Signaling Technology) used at a concentration of 2 μg/ml, anti-acetylated Smc3 antibody (gift from Katsuhiko Shirahige) at a 1:1,000 dilution, anti-HA antibody (12CA5; Roche) at a concentration of 1 μg/ml, or anti-tubulin antibody (YOL1/34; Santa Cruz) at a 1:200 dilution. Secondary detection was performed with a horseradish peroxidase-coupled goat anti-mouse secondary antibody (sc-2005; Santa Cruz) or goat anti-rat secondary antibody (sc-2065; Santa Cruz) at a 1:2,500 dilution. The chemifluorescent reagent (Amersham ECL plus Western blotting detection reagent RPN 2132 from GE Healthcare) was used for detection of the protein, and the membrane was scanned with a Typhoon 9400 (GE Healthcare).

RESULTS

H2A.Z regulates sister chromatid cohesion.

To determine whether H2A.Z plays a role in sister chromatid cohesion, we monitored cohesion in yeast cells lacking H2A.Z. A green fluorescent protein (GFP)-Tet repressor fusion protein bound to an array of Tet operators integrated at the URA3 locus (located 35 kb from the centromere on chromosome V) was used to monitor cohesion in mitotic cells (28, 32). Cells were arrested in metaphase with nocodazole or in G₁ with α-factor, and the number of GFP spots per cell was then determined. Pds1 staining in nocodazole-arrested cells confirmed that these cells had not entered anaphase (Fig. 1A). As expected, the majority of the G₁-arrested cells exhibited a single GFP spot, indicating that there was no aneuploidy present early in the cell cycle (Fig. 1B). At the metaphase arrest, the strain lacking H2A.Z exhibits a significant increase in the number of cells with two GFP spots compared to the wild-type strain (Fig. 1A and B). To examine whether H2A.Z is important for regulation of chromosome cohesion throughout the length of the chromosomes, we also monitored mitotic cohesion in Δhtz1 mutant cells containing lac operator repeats integrated 9.7 kb from the end of chromosome IV and expressing a lac repressor-GFP fusion protein (27). Consistent with the results of our centromere cohesion assays, deletion of HTZ1 also led to premature loss of cohesion at telomeres (Fig. 1C).

In yeast, H2A.Z is deposited into chromatin by the SWR1 complex (6–8). Counterintuitively, many phenotypes caused by the loss of H2A.Z can be suppressed by elimination of the SWR1 complex component Swr1 (33–35). Thus, many of the consequences of H2A.Z loss are likely due to continued SWR1 activity, which may destabilize nucleosomes in the absence of H2A.Z. We examined chromosome cohesion in a strain lacking Swr1 and in a strain lacking both Swr1 and H2A.Z. Both of these strains show a defect in cohesion similar in magnitude to that seen in the Δhtz1 mutant strain (Fig. 1B), suggesting that the cohesion defect we observed is directly attributable to the absence of H2A.Z.

Mcd1 association with chromatin remains unaltered in the absence of H2A.Z.

How might deletion of H2A.Z cause loss of chromosome cohesion? H2A.Z and Mcd1 both dissociate from telomeres during the metaphase-to-anaphase transition of the cell cycle to allow the establishment of silencing (23), raising the possibility that H2A.Z affects the association of cohesin with chromatin. By ChIP, we analyzed Mcd1 association in Δhtz1 mutant cells at CEN3 and CEN16, regions known to be highly enriched with cohesin (36), and at a cohesin-bound chromosome arm locus (37). Parallel cultures of wild-type and Δhtz1 mutant cells were grown to log phase, blocked in metaphase with nocodazole, and then analyzed by ChIP of Mcd1-HA. We found that the association of Mcd1 at centromeres and at the chromosome arm locus did not differ between Δhtz1 mutant and wild-type cells (Fig. 2B), suggesting that deletion of HTZ1 does not affect the association of Mcd1 with chromatin. Experiments carried out with log-phase (unarrested) cells yielded similar results (Fig. 2C).

Fig 2.

HTZ1 deletion does not affect Mcd1 association with chromatin. ChIP assays for Mcd1-HA were carried out with the wild-type (YSH814) and Δhtz1 mutant (YSH1110) strains at the centromere of chromosome III, the centromere of chromosome XVI, and a chromosome arm locus in nocodazole-blocked cells (B) and cycling cells (C). The primer pairs hybridize within a 2-kb region around the centromeres and 27 kb from the right telomere of chromosome V. The diagrams illustrate the relative positions of the regions bound by the primer pairs used (A). The bar graphs represent the relative fold change in the enrichment of Mcd1 in the deletion strain relative to the wild-type strain. The enrichment of Mcd1 is calculated relative to a region 534 kb from the left telomere of chromosome V that is known to be deficient in Mcd1 binding.

To investigate whether H2A.Z association with chromatin is influenced by Mcd1, we studied the association of H2A.Z in a pericentric region and at three additional chromosomal loci known to be enriched with H2A.Z (38–40) in a strain carrying a temperature-sensitive allele of Mcd1 (scc1-73). We observe a consistent increase in H2A.Z association with chromatin upon Mcd1 inactivation, but these changes do not reach statistical significance (Fig. 3A and B). We conclude that H2A.Z and Mcd1 do not associate with chromatin in an interdependent manner.

Fig 3.

Mcd1 inactivation does not affect the association of H2A.Z with chromatin. ChIP assays for H2A.Z-FLAG upon inactivation of Mcd1. A culture of YSH996 was grown to log phase at 23°C. Half of this culture was then shifted to 37°C for 2 h to inactivate Mcd1. The fold change in the enrichment of H2A.Z at 37°C relative to 23°C was determined at the pericentric regions of chromosomes III and XVI (A) and at the promoter regions of GIT1, RPS8b, and AIF1 (B).

In its role as a regulator of transcription, H2A.Z could affect the levels of Mcd1, possibly leading to chromosome cohesion defects. We found that cells lacking HTZ1 exhibit an ∼50% decrease in MCD1 mRNA levels and a corresponding ∼50% decrease in total Mcd1 protein levels (Fig. 4A and B). A prior study that systematically reduced levels of Mcd1 protein found that pericentric localization of cohesin and sister chromatid cohesion were unaffected even when the total Mcd1 protein levels were reduced to 13% of the wild-type level (41). This suggests that the decrease in Mcd1 levels is insufficient to explain the cohesion defects we observed. We also noted that our ChIP assays did not indicate a drop in levels of chromatin-associated Mcd1 in htz1 mutant cells at the loci we queried. In addition, transcription profiles of Δhtz1 mutant cells do not show a significant change in the transcription of genes involved in chromosome segregation, including genes encoding spindle proteins, kinetochore components, or checkpoint proteins (39, 42). Thus, H2A.Z likely has a more direct effect on chromosome cohesion.

Fig 4.

Deletion of HTZ1 causes a steady-state decrease in Mcd1 mRNA and total protein levels. The YSH814 (wild-type [wt]) and YSH1110 (Δhtz1 mutant) strains were grown to log phase, when half of the culture was arrested in G₁ phase with α-factor and the other half was arrested in metaphase with nocodazole. MCD1 mRNA (A) and total protein (B) levels were measured in these samples. ACT1 mRNA and tubulin protein levels were used as internal controls, respectively. Bar graphs represent cumulative results of three independent experiments.

An acetylated form of H2A.Z regulates sister chromatid cohesion.

H2A.Z's N-terminal tail lysine residues (K3, K8, K10, and K14) undergo posttranslational acetylation by the NuA4 and SAGA histone acetyltransferase complexes (9–12). Mutations in genes coding for subunits of NuA4 or SWR1 or in the HTZ1 gene cause sensitivity to benomyl and an increased rate of chromosome loss (13). Furthermore, mutants of H2A.Z that are unable to undergo acetylation at the four lysine residues or at lysine 14 are also sensitive to benomyl (10, 11, 43). To determine whether acetylation of H2A.Z is important for cohesion, we assessed chromosome cohesion in strains expressing H2A.Z proteins that cannot be acetylated at lysine 14 (htz1K14R), the most frequently acetylated residue in the N-terminal tail (12), or at all four lysine residues (htz1K,3,8,10,14R) and thus are unable to undergo acetylation after incorporation into chromatin (9, 10). We found that the htz1K3,8,10,14R mutant strain exhibits an increase in the percentage of cells with two GFP spots comparable to that seen in the Δhtz1 mutant strain, while the htz1K14R mutant strain exhibited wild-type levels of cohesion (Fig. 5A). These data suggest that acetylation of H2A.Z is important for the regulation of sister chromatid cohesion.

Acetylation of the cohesin subunit Smc3 by the EcoI acetyltransferase is required to establish chromatid cohesion (44–47) and may contribute to its maintenance (48). Acetylation of Smc3 takes place postreplication and is maintained until the separation of sister chromatids in anaphase, when it is deacetylated by Hos1 (48–50). Using an antibody specific for the acetylated form of Smc3, we found that loss of H2A.Z does not alter the amount of acetylated Smc3 (Fig. 5B).

H2A.Z is required to maintain sister chromatid cohesion.

To examine the immediate consequences of H2A.Z loss for sister chromatid cohesion, we created a temperature-sensitive degradable (degron) allele of the HTZ1 gene (29, 51). The chromosomal HTZ1 gene was modified by integrating a temperature-inducible degron (td) cassette (Ub-Arg-DHFR^ts-Myc) under the control of the CUP1 promoter at the 5′ end of the open reading frame. To achieve faster degradation of H2A.Z, a heat-inducible UBR1 gene was also integrated into this strain background. Upon the removal of copper from the medium and a shift to the nonpermissive temperature (37°C), H2A.Z was reduced to <30% of wild-type levels after 4 h (Fig. 6A). To establish whether persistent depletion of H2A.Z because of the temperature shift caused a cohesion defect similar to that seen in cells lacking H2A.Z, cells were grown to log phase at the permissive temperature (23°C) in the presence of copper, and then half of the culture was shifted to 37°C for 4 h after the removal of copper from the medium to allow degradation of H2A.Z; cells were then blocked in nocodazole. Consistent with our data from the Δhtz1 null strain, decreased H2A.Z levels caused an increase in the frequency of cells with two GFP spots (Fig. 6B).

Fig 6.

H2A.Z is required for the maintenance of cohesion in metaphase. Assays of sister chromatid cohesion in temperature-sensitive H2A.Z (htz1-td) strain YSH1096 were carried out as described in the legend to Fig. 1. (A) Western blot analysis of the total H2A.Z protein levels in cycling and nocodazole-arrested cells. Cells were grown to log phase at the permissive temperature (23°C) in the presence of CuSO₄. Copper was then removed from half of the culture, and the culture was shifted to 37°C for 4 h to inactivate H2A.Z. As a control, the untagged wild-type strain (YSH1015) was treated the same way. Cells with a large-budded morphology, a single DNA mass, and a short spindle as shown by tubulin staining were judged to be in metaphase. (B) Steady-state experiments were carried out to study the phenotype of the htz1-td mutant strain at 37°C. Cell cultures were grown to early log phase at 23°C in the presence of 1 mM CuSO₄, copper was removed, and the culture was shifted to 37°C for 4 h to inactivate H2A.Z. The culture was then blocked in metaphase by the addition of nocodazole. As a control, the wild-type strain (YSH1015) was processed in the same way. The total numbers of cells scored for the wild-type strain were 50 at the permissive temperature and 76 at the nonpermissive temperature and for the htz1-td mutant strain, 162 at the permissive temperature and 235 at the nonpermissive temperature. The number of htz1-td mutant strain cells with two GFP spots at 37°C was significantly different from the number with two GFP spots at 23°C (P = 0.0199). (C) H2A.Z is required for sister chromatid cohesion. Cells were grown at 23°C in 1 mM CuSO₄ and blocked in metaphase by the addition of nocodazole, and half of the culture was shifted to 37°C for 4 h after the removal of copper from the medium. The total numbers of cells scored for the wild type were 125 at the permissive temperature and 100 at the nonpermissive temperature and for the htz1-td mutant strain, 147 at the permissive temperature and 153 at the nonpermissive temperature. The number of cells of the htz1-td mutant strain with two GFP spots at the nonpermissive temperature is significantly different from the number with two GFP spots at the permissive temperature (P = 0.0107); the difference is not significant for the wild-type strain (P = 0.85). Images of cells scored for panels B and C were collected from two independent experiments.

To determine whether H2A.Z is continuously required to maintain sister chromatid cohesion, cells were grown in the presence of copper at 23°C to allow the establishment of chromosome cohesion, blocked in metaphase with nocodazole, and then shifted to 37°C after the removal of copper from the medium. After 4 h, the cells were assayed for cohesion. We found that upon depletion of H2A.Z in nocodazole-blocked cells, there was a significant loss of sister chromatid cohesion (Fig. 6C), indicating that H2A.Z is required for the maintenance of cohesion. In this time frame, we did not see a decrease in the total Mcd1 protein level following the degradation of H2A.Z (data not shown), further suggesting that the cohesion defects we observed are a direct consequence of H2A.Z loss.

DISCUSSION

H2A.Z is required for the maintenance of genomic stability in yeast and mammals (13, 15, 17, 18), but the nature of H2A.Z's contribution to chromosome stability has not been defined. Loss of H2A.Z leads to cell death or a significantly increased doubling time in strains that lack any of several other nonessential proteins involved in chromosome cohesion, including Ctf4 (52), the DNA helicase Chl1 (53), and proteins of the alternative replication factor C complex containing Ctf18, Ctf8, and Dcc1 (52, 54), suggesting that H2A.Z may act in a redundant manner with these proteins to promote cohesion. In this study, we show that yeast cells lacking H2A.Z are defective in the maintenance of sister chromatid cohesion. Our data suggest that H2A.Z contributes to a chromosome architecture permissive for the maintenance of cohesion, and its loss in anaphase may help promote chromosome segregation.

Some phenotypes caused by the absence of H2A.Z in yeast are likely due to aberrant action of the SWR1 complex, which may destabilize nucleosomes when H2A.Z is not available to be deposited into chromatin (33–35). However, since we also observed cohesion defects in Δswr1 and Δswr1 Δhtz1 mutant strains, the cohesion defects we observed can be attributed to the absence of H2A.Z. We found that strains lacking the HTZ1 gene express Mcd1 at ∼50% of wild-type levels. Prior experiments demonstrated that cells expressing Mcd1 at 13% of wild-type levels maintained normal cohesion and chromosome segregation (41). In addition, when we induced the degradation of H2A.Z with a temperature-sensitive protein, we observed a rapid loss of cohesion in the absence of a change in Mcd1 levels or association with chromatin. Thus, while we cannot rule out the possibility that the phenotypes we observe are due to combinatorial changes in transcription, our data support a more direct role for H2A.Z in the maintenance of chromosome cohesion.

H2A.Z is acetylated at four N-terminal tail lysine residues (9, 10, 12). We found that a strain expressing a form of H2A.Z that is unable to undergo acetylation (htz1K3,8,10,14R) has defective sister chromatid cohesion. Unacetylatable forms of H2A.Z in which the four N-terminal lysines were changed to arginine or glutamine had similar patterns of genetic interactions with other chromatin factors, suggesting that H2A.Z's contributions to chromatin structure might depend on dynamic charge modulations (11). We have previously shown that H2A.Z dissociates from chromatin during the anaphase-to-telophase transition of the cell cycle (23), coinciding with the dissolution of sister chromatid cohesion. The dynamics of H2A.Z acetylation may influence the transition from sister chromatid pairing in metaphase to chromatid resolution in anaphase.

According to the ring model of cohesion establishment, cohesion between sister chromatids is formed by a topological embrace of the cohesin ring around the replicated sister chromatids. A transient opening of the ring's embrace might allow the escape of one sister chromatid, leading to dissociation of cohesin and loss of cohesion (22). However, we did not observe any change in cohesin association with chromatin upon cohesion loss in H2A.Z-depleted cells. Similar results have been obtained in other studies where cohesion was lost even though cohesin remained bound to chromatin (55–59). These observations are consistent with an alternative cohesin model wherein, instead of a single ring embracing both sister chromatids, each chromatid might have its own cohesin ring. Destabilization of intermolecular cohesin complex interactions may cause cohesion loss without any change in the association of cohesin with chromatin (60).