Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2013 Sep;87(17):9538–9546. doi: 10.1128/JVI.00177-13

An Intact Sialoadhesin (Sn/SIGLEC1/CD169) Is Not Required for Attachment/Internalization of the Porcine Reproductive and Respiratory Syndrome Virus

Randall S Prather a,✉, Raymond R R Rowland b, Catherine Ewen b, Benjamin Trible b, Maureen Kerrigan b, Bhupinder Bawa b, Jennifer M Teson a, Jiude Mao a, Kiho Lee a, Melissa S Samuel a, Kristin M Whitworth a, Clifton N Murphy a, Tina Egen a, Jonathan A Green a
PMCID: PMC3754101  PMID: 23785195

Abstract

Surface expression of SIGLEC1, also known as sialoadhesin or CD169, is considered a primary determinant of the permissiveness of porcine alveolar macrophages for infection by porcine reproductive and respiratory syndrome virus (PRRSV). In vitro, the attachment and internalization of PRRSV are dependent on the interaction between sialic acid on the virion surface and the sialic acid binding domain of the SIGLEC1 gene. To test the role of SIGLEC1 in PRRSV infection, a SIGLEC1 gene knockout pig was created by removing part of exon 1 and all of exons 2 and 3 of the SIGLEC1 gene. The resulting knockout ablated SIGLEC1 expression on the surface of alveolar macrophages but had no effect on the expression of CD163, a coreceptor for PRRSV. After infection, PRRSV viremia in SIGLEC1−/− pigs followed the same course as in SIGLEC1−/+ and SIGLEC1+/+ littermates. The absence of SIGLEC1 had no measurable effect on other aspects of PRRSV infection, including clinical disease course and histopathology. The results demonstrate that the expression of the SIGLEC1 gene is not required for infection of pigs with PRRSV and that the absence of SIGLEC1 does not contribute to the pathogenesis of acute disease.

INTRODUCTION

The viral disease that continues to have the greatest economic impact on swine production is porcine reproductive and respiratory syndrome (PRRS). It was first reported in the United States in 1987 (1) and in Europe in 1990 (2). Molecular analysis of the VR-2332 and Lelystad prototype PRRS viruses (PRRSVs; U.S. and European isolates, respectively) suggests that divergently evolved strains emerged on the two continents almost simultaneously, perhaps because of similar changes in swine management practices (3, 4). Since its initial emergence, PRRSV has spread worldwide, including the circulation of European genotype viruses in U.S. swine herds (5). PRRSV infection of pigs results in respiratory disease and reproductive failure and participates in polymicrobial disease syndromes such as the porcine respiratory disease complex and porcine circovirus-associated disease (6). The most consistent pathological lesion associated with acute PRRS in nursery age pigs is interstitial pneumonia (7 and references therein). The acute phase of PRRSV infection is typically characterized by viremia and clinical disease, after which many pigs fully recover, although many continue to carry subclinical viral loads. Persistently infected pigs shed the virus, either intermittently or continuously, and may infect naive pigs (8–13).

A receptor for PRRSV has been identified, purified, sequenced (14, 15), and named SIGLEC1, CD169, or sialoadhesin. SIGLEC1 is a transmembrane protein belonging to a family of sialic acid binding immunoglobulin-like lectins. It was first described as a sheep erythrocyte binding receptor on macrophages of hematopoietic and lymphoid tissues (16). SIGLEC proteins consist of an N-terminal V-set domain containing the sialic acid binding site, followed by a variable number of C2-set domains, a transmembrane domain, and a cytoplasmic tail. In contrast to other SIGLEC proteins, SIGLEC1 does not have a tyrosine-based motif in the cytoplasmic tail (17). SIGLEC1, which is expressed on macrophages, functions in cell-to-cell interactions through the binding of sialic acid ligands on erythrocytes, neutrophils, monocytes, NK cells, B cells, and some cytotoxic T cells. The SIGLEC1-sialic acid interaction participates in several aspects of adaptive immunity, such as antigen processing and presentation to T cells and activation of B cells and CD8 T cells (reviewed in references 18 and 19).

An intact N-terminal domain on SIGLEC1 has been suggested to be both necessary and sufficient for PRRSV binding and internalization by cultured macrophages (20, 21). Transfection of SIGLEC1-negative cells, such as PK-15, with SIGLEC1 is sufficient to mediate virus internalization. Incubation of PRRSV-permissive cells with anti-SIGLEC1 monoclonal antibody (MAb) blocks PRRSV binding and internalization (14). On the virus side, removal of the sialic acid from the surface of the virion or preincubation of the virus with sialic acid-specific lectins blocks infection (16, 22, 23). A model illustrating the role of SIGLEC1 in PRRSV infection is presented in Fig. 1. The interaction between SIGLEC1 and sialic acid on viral proteins, such as the GP5/M heterodimer, promotes the attachment and internalization of the virion in a clathrin-coated pit (22). Subsequent entry of PRRSV occurs by receptor-mediated endocytosis (24). A second receptor, CD163, located within the endosome compartment, participates in the uncoating of the virion. The interaction between CD163 and the virion occurs via binding of the GP2/3/4 heterotrimer, a minor group of viral proteins. In combination with a decrease in pH, the virus fuses with the endosome envelope and the viral genome is released into the cytoplasm (25).

Fig 1.

Fig 1

Open in a new tab

Proposed steps in the attachment, internalization, and uncoating of PRRSV. In step 1, virus-permissive macrophages coexpress SIGLEC1 and CD163. The initial binding step is through SIGLEC1 with sialic acid on the GP5/M heterodimer in a clathrin-coated pit (steps 2 and 3). The engagement of the GP2/3/4 heterotrimer combined with the acidification of the endosome results in uncoating and release of the viral genome (steps 4 and 5).

To test the hypothesis that SIGLEC1 is required for PRRSV infection, we infected transgenic pigs that possessed a knockout of the SIGLEC1 gene.

MATERIALS AND METHODS

Unless otherwise stated, all of the chemicals used in this study were from Sigma, St. Louis, MO.

Targeted disruption of porcine SIGLEC1 gene.

The use of animals and virus was approved by university animal care and institutional biosafety committees at the University of Missouri and/or Kansas State University. Homologous recombination was incorporated to remove protein coding exons 2 and 3 from SIGLEC1 and introduce premature stop codons to eliminate the expression of the remaining coding sequence (Fig. 2). Porcine SIGLEC1 cDNA (GenBank accession no. NM214346) encodes a 210-kDa protein from an mRNA transcript of 5,193 bases (14). Genomic sequence from the region around SIGLEC1 (GenBank accession no. CU467609) was used to prepare oligonucleotide primers to amplify genomic fragments by high-fidelity PCR (AccuTaq; Invitrogen) for the generation of a targeting construct. On the basis of comparisons with the mouse and human genomic sequences, porcine SIGLEC1 is predicted to possess 21 exons. In addition, exon 2 is conserved among pigs, mice, and humans. Peptide sequence alignments reveal that the six amino acids in the exon 2 coding region in mouse SIGLEC1, known to be involved with sialic acid binding, are conserved in pig SIGLEC1. One fragment, the “upper arm,” represented part of the first coding exon and 3,304 bp upstream from the start codon. The second fragment, or “lower arm,” was 4,753 bp in length and represented most of the intron downstream of the third coding exon and extended into the sixth intron (including the fourth, fifth, and sixth coding exons). Between the lower and upper arms was a neo cassette inserted in the opposite direction and placed under the control of a phosphoglycerol kinase (PGK) promoter.

Fig 2.

Fig 2

Open in a new tab

SIGLEC1 knockout strategy. (A) Organization of porcine SIGLEC1, which contains 21 exons and spans approximately 20 kb (GenBank accession no. CU467609). (B) Targeting construct used for homologous recombination. The primer sequences for PCR amplification and cloning are labeled F (forward) and R (reverse). The upper-arm DNA fragment is ∼3.5 kbp upstream of exon 1 and includes part of exon 1 (after the start codon). The sialic acid binding domain is located in exon 2. The lower-arm DNA fragment includes exons 4, 5, and 6 and most of intron 6. Most of exon 1 and all of exons 2 and 3 were replaced with a neomycin (Neo) gene cassette under the control of the PGK promoter. A TK gene cassette was available immediately downstream of the lower arm but was not used for selection. Three in-frame stop codons (sss) were introduced into the end of the upper and lower arms by including them in the antisense and sense PCR primers used to amplify the region. (C) The mutated SIGLEC1 gene after homologous recombination. The horizontal arrows show the locations of the PCR primers used for screening.

Male and female fetal fibroblast primary cell lines, from day 35 of gestation, were isolated from large commercial white pigs (Landrace). The cells were cultured and grown for 48 h to 80% confluence in Dulbecco's modified Eagles medium (DMEM) containing 5 mM glutamine, sodium bicarbonate (3.7 g/liter), penicillin-streptomycin, and 1 g/liter d-glucose, which was further supplemented with 15% fetal bovine serum (FBS; HyClone), 10 μg/ml gentamicin, and 2.5 ng/ml basic fibroblast growth factor. Medium was removed and replaced 4 h prior to transfection. Fibroblast cells were washed with 10 ml of phosphate-buffered saline (PBS) and lifted off the 75-cm2 flask with 1 ml of 0.05% trypsin-EDTA (Invitrogen). The cells were resuspended in DMEM, collected by centrifugation at 600 × g for 10 min, washed with Opti-MEM (Invitrogen), and centrifuged again at 600 × g for 10 min. Cytosalts (75% cytosalts [120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4, pH 7.6, 5 mM MgCl2] and 25% Opti-MEM [Invitrogen]) were used to resuspend the pellet (26). The cells were counted with a hemocytometer and adjusted to 1 × 106/ml. Electroporation of cells was performed with 0.75 to 10 μg of double- or single-stranded targeting DNA (achieved by heat denaturation) in 200 μl of transfection medium containing 1 × 106 cells/ml. The cells were electroporated in a BTX ECM2001 Electro Cell Manipulator by using three 1-ms pulses of 250 V. The electroporated cells were diluted in DMEM-FBS-basic fibroblast growth factor at 10,000/13-cm plate and cultured overnight without selective pressure. The following day, the medium was replaced with culture medium containing G418 (Geneticin, 0.6 mg/ml). After 10 days of selection, G418-resistant colonies were isolated and transferred to 24-well plates for expansion. PCR was used to determine if targeting of SIGLEC1 was successful. PCR primers f and b and PCR primers a and e (Fig. 2B) were used to determine the successful targeting of both arms. Primers f and e annealed outside the region of each targeting arm. PCR primers c and d were used to determine the insertion of an intact neo gene.

Somatic cell nuclear transfer.

Pig oocytes were purchased from ART Inc. (Madison, WI) and matured according to the supplier's instructions. After 42 to 44 h of in vitro maturation, the oocytes were stripped of cumulus cells by gentle vortexing in 0.5 mg/ml hyaluronidase. Oocytes with good morphology and a visible polar body (metaphase II) were selected and kept in the micromanipulation medium at 38.5°C until nuclear transfer.

Using an inverted microscope, a cumulus-free oocyte was held with a holding micropipette in drops of micromanipulation medium supplemented with 7.5 μg/ml cytochalasin B and covered with mineral oil. The zona pellucida was penetrated with a fine glass injecting micropipette near the first polar body, and the first polar body and adjacent cytoplasm, containing the metaphase II chromosomes, were aspirated into the pipette. The pipette was withdrawn, and the contents were discarded. A single round and bright donor cell with a smooth surface was selected and transferred into the perivitelline space adjacent to the oocyte membrane (27, 28). The nuclear transfer complex (oocyte plus fibroblast) was fused in fusion medium with a low calcium concentration (0.3 M mannitol, 0.1 mM CaCl2 · 2H2O, 0.1 mM MgCl2 · 6H2O, 0.5 mM HEPES). The fused oocytes were then activated by treatment with 200 μM thimerosal for 10 min in the dark, rinsed, and treated with 8 mM dithiothreitol (DTT) for 30 min; the oocytes were rinsed again to remove the remaining DTT (29, 30). Following fusion and activation, the oocytes were washed three times with Porcine Zygote Culture Medium 3 supplemented with 4 mg/ml of bovine serum albumin (31) and cultured at 38.5°C in a humidified atmosphere of 5% O2, 90% N2, and 5% CO2 for 30 min. Those complexes that had successfully fused were cultured for 15 to 21 h until surgical embryo transfer.

Embryo transfer.

The surrogate gilts were synchronized by administering 18 to 20 mg Regu-mate (Intervet, Millsboro, DE) mixed into the feed for 14 days according to a scheme dependent on the stage of the estrous cycle. After the last Regu-mate treatment (105 h), an intramuscular injection of 1,000 units of human chorionic gonadotropin was given to induce estrus. Surrogate pigs on the day of standing estrus (day 0) or on the first day after standing estrus were used (28). The surrogates were aseptically prepared, and a caudal ventral incision was made to expose the reproductive tract. Embryos were transferred into one oviduct through the ovarian fimbria. Pigs were checked for pregnancy by abdominal ultrasound examination around day 30 and then checked once a week through gestation until parturition at 114 days of gestation.

PCR and Southern blot confirmation in transgenic piglets.

For PCR and Southern blot assays, genomic DNA was isolated from tail tissue. Briefly, the tissues were digested overnight at 55°C with 0.1 mg/ml of proteinase K (Sigma, St. Louis, MO) in 100 mM NaCl–10 mM Tris (pH 8.0)–25 mM EDTA (pH 8.0)–0.5% SDS. The material was extracted sequentially with neutralized phenol and chloroform, and the DNA was precipitated with ethanol (32). Detection of both wild-type and targeted SIGLEC1 alleles was performed by PCR with primers that annealed to DNA flanking the targeted region of SIGLEC1. To amplify the thymidine kinase (TK) lower-arm region (black arrows in Fig. 2), a-forward (5′-AGAGGCCACTTGTGTAGCGC) and e-reverse 5′-CAGGTACCAGGAAAAACGGGT were used. To amplify the upper-arm Neo region (blue arrows in Fig. 2), f-forward 5′-GGAACAGGCTGAGCCAATAA and b-reverse (5′-GGTTCTAAGTACTGTGGTTTCC) were used. To amplify exon 1 and the neo gene (red arrows in Fig. 2), c-forward (5′-GCATTCCTAGGCACAGC) and d-reverse (5′-CTCCTTGCCATGTCCAG) were used. The incorporation of primers c and d (red arrows in Fig. 2) was designed to yield ∼2,400 and ∼2,900 bp of the wild-type and targeted alleles, respectively.

For Southern blot assays, the genomic DNA was digested at 37°C with ScaI and MfeI (New England BioLabs). Sites for MfeI reside in the genomic regions upstream of the translation start site and in intron 6. A ScaI site is present in the neo cassette. Digested DNA was separated on an agarose gel, transferred to a nylon membrane (Immobilon NY+; EMD Millipore) by capillary action, and immobilized by UV cross-linking (32). A genomic fragment consisting of intron 4 and portions of exons 4 and 5 was amplified by PCR (oligonucleotides 2789 F [GATCTGGTCACCCTCAGCT] and 3368 R [GCGCTTCCTTAGGTGTATTG]) and labeled with digoxigenin according to the manufacturer's protocol (Roche). Hybridization, washing, and signal detection were performed in accordance with the manufacturer's recommendations (Roche). The predicted sizes of the wild-type and targeted SIGLEC1 genes were 7,892 and 7,204 bp, respectively.

Infection of pigs.

A single litter of 11 pigs, at 3 weeks of age, was brought into the challenge facility. The litter was derived from the mating of heterozygous parents. Three genotypes were represented, homozygous (+/+, four pigs), heterozygous (+/−, three pigs), and homozygous (−/−, four pigs). The pigs were housed in the same room and allowed to intermingle freely. After acclimation for 1 week, the pigs were challenged with a low-passage-number PRRSV isolate, KS-06, a North American isolate obtained during a PRRS outbreak in 2006. Virus was propagated by three rounds of amplification on MARC-145 cells (33). The virus retained the ability to grow on primary cultures of porcine alveolar macrophage (PAM) cells and reproduced PRRS clinical signs following experimental infection. Pigs were challenged with approximately 105 TCID50 of virus diluted in 3 ml of culture medium. One-half of the inoculum was delivered intramuscularly, and the rest was delivered intranasally. Blood samples were collected on days 0, 4, 7, 14, 21, and 28 and at termination on day 35. Blood was allowed to clot, and serum was stored at −80°C until use. At the termination of the study, pigs were necropsied and tissues were fixed in 10% buffered formalin, embedded in paraffin, and processed for histopathology by the Kansas State Veterinary Diagnostic Laboratory. Paraffin-embedded thin sections were mounted on slides, deparaffinized, and stained with hematoxylin and eosin. Histopathology was assessed by a board-certified pathologist.

Measurement of PRRSV viremia.

Two approaches were used to measure the amount of PRRSV in serum. Virus titration was performed by adding serial 1:10 dilutions of serum to confluent MARC-145 cells in a 96-well plate. Serum was diluted in Eagle's minimum essential medium supplemented with 8% FBS, penicillin, streptomycin, and amphotericin B (Fungizone). After 4 days of incubation at 37°C, the wells were examined under a microscope for the presence of a cytopathic effect (CPE). The last well showing a CPE was scored as the titration endpoint. For the measurement of viral nucleic acid, total RNA was isolated from serum with the Life Technologies MagMAX-96 viral RNA isolation kit according to the manufacturer's recommendations. Reverse transcription (RT)-PCR was performed with the EZ-PRRSV MPX 4.0 kit from Tetracore according to the manufacturer's instructions, and reactions were performed on a CFX-96 real-time PCR system (Bio-Rad) in a 96-well format. Each 25-μl reaction mixture contained RNA from 5.8 μl of serum. A standard curve was constructed by preparing serial dilutions of an RNA control supplied in the RT-PCR kit (Tetracore). RT-PCR results were reported as the number of templates per PCR.

SIGLEC1 (CD169) and CD163 surface staining of PAM cells.

PAM cells were collected by lung lavage. Briefly, excised lungs were filled with approximately 100 ml of cold PBS. After a single wash, the pellet was resuspended in approximately 5 ml of cold PBS and stored on ice. Approximately 107 PAM cells were incubated in 5 ml of 20 μg/ml anti-porcine CD169 (clone 3B11/11; AbD Serotec) or anti-porcine CD163 (clone 2A10/11; AbD Serotec) antibody diluted in PBS with 5% FBS and 0.1% sodium azide (PBS-FBS) for 30 min on ice. Cells were centrifuged, washed, and resuspended in 1/100 fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG (Life Technologies) diluted in staining buffer and incubated for 30 min on ice. At least 104 cells were analyzed with a FACSCalibur flow cytometer and Cell Quest software (Becton, Dickinson).

Measurement of PRRSV-specific Ig and IgM.

Recombinant PRRSV N protein, expressed in bacteria (34), was conjugated to magnetic Luminex beads with a kit from Luminex Corp. N protein-coupled beads were diluted in PBS with 10% goat serum (PBS-GS) to a working concentration of 2,500 beads in 50 μl and placed into the wells of a 96-well round-bottom polystyrene plate. Fifty microliters of a 1:400 dilution of serum in PBS-GS was added to duplicate wells and incubated for 30 min at room temperature with gentle shaking. The plate was washed three times with PBS-GS, and then 50 μl of biotin-SP-conjugated affinity-purified goat anti-swine secondary antibody (IgG, Jackson ImmunoResearch) or biotin-labeled affinity-purified goat anti-swine IgM (KPL) diluted to 2 μg/ml in PBS-GS was added. After 30 min of incubation, the plates were washed three times and then 50 μl of streptavidin-conjugated phycoerythrin (2 μg/ml in PBS-GS; Moss, Inc.) was added. After 30 min, the plates were washed and microspheres resuspended in 100 μl of PBS-GS and analyzed with the MAGPIX and the Luminex xPONENT 4.2 software. The results were reported as mean fluorescence intensity (MFI).

RESULTS

Creation of SIGLEC1 knockout pigs.

The knockout strategy used, diagrammed in Fig. 2, focused on creating drastic alterations of SIGLEC1 such that exons 2 and 3 were eliminated and no functional protein was expected to be obtained from the mutated gene. In addition, further disruption of the gene was accomplished by replacing part of exon 1 and all of exons 2 and 3 with a neomycin-selectable cassette oriented in the opposite direction (35). Thirty-four transfections were conducted with a variety of plasmid preparations (0.75 to 10 μg/μl, both single- and double-stranded constructs, and both medium- and large-size constructs). Also included were male and female cells representing five different porcine fetal cell lines. Over 2,000 colonies were screened for the presence of the targeted insertion of the neo cassette. The PCR primers pairs f plus b and a plus e (Fig. 2B and C) were used to check for the successful targeting of the upper and lower arms of the construct. Two colonies tested positive for the presence of the correct insertion, one male and one female (data not shown).

Cells from the male clone, 4-18, were used for somatic cell nuclear transfer and the transfer of 666 embryos into surrogates. The transfer of cloned embryos into two surrogates produced a total of eight piglets. One surrogate delivered six normal male piglets on day 115 of gestation. A C-section was performed on the second surrogate on day 117 of gestation, resulting in two normal male piglets. Three embryo transfers were also conducted with the female cells (658 embryos), but none established a pregnancy. Figure 3 shows the results for PCRs performed with genomic DNA extracted from the eight male piglet clones (F0) generated from the 4-18 targeted fetal fibroblast line. To detect both alleles, a PCR was performed with primers c and d (Fig. 2C). The predicted PCR product sizes were ∼2,400 bp for the wild-type allele and ∼2,900 bp for the targeted allele. The results of the PCR with primers c and d are shown in Fig. 3. All of the pigs tested positive for the presence of the wild-type 2,400-bp and targeted 2,900-bp alleles (Fig. 3B). Control PCRs incorporating DNA from the cell line used for cloning, the targeted 4-18 fibroblast cell line, and the nontargeted 4-18 cell line produced the predicted products (Fig. 3A). The presence of the targeted mutation was further confirmed by amplifying regions with primer pairs identified by the blue and black arrows in Fig. 2C, which were predicted to yield products of ∼4,500 and ∼5,000 bp, respectively. Results showed the presence of both products in the eight founder pigs (data not shown).

Fig 3.

Fig 3

Open in a new tab

PCR screening of wild-type and targeted SIGLEC1+/− alleles in transgenic founder pigs. PCR primers c and d (red arrows in Fig. 2) were used to amplify genomic DNA from the eight founder pigs derived from the male 4-18 clone. Panel A shows DNA from KW2 cells (the initial cells used for transfection), the targeting plasmid, the targeted 4-18 cells (note the two bands, ∼2,400 and ∼2,900 bp), a nontargeted fibroblast, and a water blank as a PCR negative control. The arrow shows the location of a faint 2,900-bp band for the 4-18 clone. Panel B shows the results for eight F0 transgenic pigs. Note the presence of two bands (∼2,400 and 2,900 bp) for each piglet. A wild-type 4-18 clone, 11-1, and a targeting plasmid show only a single band. Standard molecular size markers are shown on the right side of panels A and B. Some fragment sizes from the molecular size markers are indicated.

Five of the F0 males were used for mating to wild-type females that resulted in 67 F1 offspring (40 males and 27 females), 39 (58%) of which were SIGLEC1+/−. One of the F1 males was mated to one of the F1 females (litter 52) to yield a litter of 12 pigs, 11 of which remained viable until weaning. Identification of wild-type and targeted alleles in the offspring was done by Southern blotting of genomic DNA. The results in Fig. 4 show four SIGLEC1+/+, three SIGLEC1+/−, and four SIGLEC1−/− F2 animals. These 11 animals were infected with PRRSV.

Fig 4.

Fig 4

Open in a new tab

Southern blot identification of knockout pigs in F2 litter 52. The upper arrow points to the wild-type band (7,892 bp), while the lower arrow identifies the predicted gene knockout (7,204 bp). Molecular size standards (STD) are shown. The STD DNA ladder represents double-stranded DNA fragments of 8,000, 7,000, and 6,000 bp. In addition to the SIGLEC1−/− (−/−) pigs, examples of wild-type (SIGLEC1+/+ [+/+]), and heterozygous (SIGLEC1+/− [+/−]) pigs and are depicted. ID, identification.

Expression of CD169 (SIGLEC1) and CD163 on PAM cells.

Cells for antibody staining were obtained from pigs at the end of the study. As shown in Fig. 5, greater than 90% of the PAM cells from SIGLEC1+/+ and SIGLEC1+/− pigs were doubly positive for CD169 and CD163. In contrast, all of the SIGLEC1−/− pigs were negative for surface expression of CD169 but remained positive for CD163. The results showed the absence of CD169 expression on cells from all of the SIGLEC1−/− pigs. The absence of CD169 surface expression did not alter the expression the PRRSV coreceptor, CD163. To determine if infection had an effect on the level of CD169 surface expression, staining of pigs not infected with PRRSV was also performed. The results for CD169 and CD163 expression on PAM cells from the SIGLEC1+/+, SIGLEC1+/−, and SIGLEC1−/− pigs were similar to those obtained with the infected pigs (data not shown).

Fig 5.

Fig 5

Open in a new tab

Expression of SIGLEC1 (CD169) and CD163 on the surface of PAM cells. Fresh PAM cells were stained for CD169 (MAb 3B11/11) or CD163 (MAb 2A10/11). PAM cells stained with only FITC-conjugated goat anti-mouse IgG were included as a background control.

Clinical outcome and histopathology following infection with PRRSV.

The infected pigs were assessed daily for clinical signs, including overall body condition, respiratory signs, ambulation, and general activity. There were no apparent clinical signs prior to virus infection. All pigs maintained a healthy body condition and remained active throughout the study period. The only exceptions were two pigs in the SIGLEC1−/− group, which developed lameness, a condition during PRRSV infection generally linked to a secondary bacterial infection. Swelling of the affected joint is the principal clinical sign of bacterium-induced lameness. In one pig, lameness first appeared on day 2 after infection and was resolved by day 28. Lameness in the second pig appeared 3 days after infection and was resolved 6 days later. In both cases, joint swelling was absent, suggesting an etiology not related to a secondary bacterial infection caused by PRRS. Respiratory distress is the principal clinical sign associated with acute PRRSV infection. Beginning at day 3 after infection, all of the pigs began to exhibit mild respiratory signs, including sneezing, coughing, and increased breathing effort. These signs, typical of PRRS, were resolved within 1 to 2 weeks after onset. In one SIGLEC1+/+ pig, more severe respiratory signs, including dyspnea and coughing, reappeared on day 28 after infection and continued until the end of the study. A 0-to-4 scoring system was used to assess microhistological changes in the lungs as follows: 0, no significant lesion; 1, mild interstitial pneumonia (<25% lung lobe involvement); 2, moderate multifocal interstitial pneumonia (50 to 75% lung lobe involvement); 3, moderate-to-severe multifocal interstitial pneumonia (50 to 75% lung lobe involvement); 4, severe diffuse interstitial pneumonia (>75% lung lobe involvement). The mean scores of the SIGLEC1+/+, SIGLEC1+/−, and SIGLEC1−/− groups were 2.8 (n = 4), 2.7 (n = 3), and 2.8 (n = 4), respectively. There were no statistically significant differences between the group mean histopathology scores. However, it should be noted that the group sizes were relatively small. Taken together, the clinical signs and histopathology scores were consistent with acute PRRSV infection and there were no significant differences between the groups of pigs.

PRRSV viremia and antibody.

The course of PRRSV viremia over 36 days of infection was measured by virus isolation and RT-PCR of viral nucleic acid. As shown in Fig. 6A, the virus isolation results showed a peak in the mean virus titers of all of the groups between 7 and 14 days after infection. The virus titers of all of the pigs declined until they reached undetectable levels by 36 days after infection. Statistical analysis showed no significance differences between groups on any day. Viremia, as measured by RT-PCR (Fig. 6 B), showed similar patterns of infection in all of the groups. The principal difference relative to the virus isolation results was the presence of detectable levels of viral nucleic acid in serum at 36 days after infection. Again, there were no statistically significant differences between groups on any of the days after infection.

Fig 6.

Fig 6

Open in a new tab

Viremia and antibody responses following infection with PRRSV. Pigs 2 to 3 weeks old were challenged with North American PRRSV isolate KS-06. Serum samples we analyzed for the presence of virus by virus isolation (A) and RT-PCR assay of viral nucleic acid (B). PRRSV N protein-specific IgM (C) and IgG (D) were measured by fluorescence microsphere immunoassay.

PRRSV-specific IgM and IgG responses were evaluated by measuring antibodies against the PRRSV N protein. Results for PRRSV-specific IgM are presented in Fig. 6C. Consistent with a primary immune response to PRRSV infection, N protein-specific IgM appeared by day 7, peaked at about day 11, and then rapidly declined, reaching background levels by the end of the study. The SIGLEC1+/+ and SIGLEC1+/− groups showed higher peak IgM MFI levels than the SIGLEC1−/− group. However, because of a large degree of variation among the pigs within each group, the differences in IgM levels between groups were not statistically significant. The anti-swine secondary antibody used for the detection of IgG is specific for the light chain; therefore, it can be assumed that the anti-swine antibody detected total Ig, including IgG, IgM, and circulating IgA. N-specific Ig was first detected at day 7 after infection, peaked at about day 21, and remained elevated for the remainder of the study. The mean Ig level was elevated in the SIGLEC1+/+ and SIGLEC1+/− groups relative to that of the SIGLEC1−/− group. Similar to IgM, there was a large degree of variation among the pigs in each group and differences between groups were not statistically significant.

DISCUSSION

Previous models, developed on the basis of the virus infection of cultured cells, identified the interaction between sialic acid on the surface of PRRSV and SIGLEC1 on the surface of macrophages as the initial interaction required for PRRSV attachment and internalization in permissive cells (Fig. 1). The subsequent interaction of CD163 with the virion GP2/3/4 heterotrimer mediates further internalization and uncoating. The present report describes the course of PRRSV infection and pathogenesis in SIGLEC1 knockout pigs with the goal of creating pigs that are resistant to PRRSV. The knockout of SIGLEC1 was accomplished by the removal of exons 2 and 3 of the SIGLEC1 gene and demonstrated by the absence of SIGLEC1 expression on the surface of PAM cells from SIGLEC−/− pigs (Fig. 5). Macrophages from SIGLEC1−/− pigs retained the ability to express CD163 and at the same level as heterozygous and wild-type littermates. The absence of SIGLEC1 expression did not appear to significantly alter the development or maturation of PRRSV-permissive macrophages. Furthermore, the absence of SIGLEC1 did not significantly alter the level of the second PRRSV receptor.

Infection of SIGLEC1−/− pigs with PRRSV resulted in a productive infection, as demonstrated by the presence of circulating virus nucleic acid and viable virus (Fig. 6). The peak and duration of infection in SIGLEC1−/− pigs were no different from those in SIGLEC1 heterozygous (SIGLEC1+/−) and wild-type (SIGLEC1+/+) littermates. One explanation for the presence of virus replication in the absence of SIGLEC1 could be related to the different experimental systems incorporated to investigate PRRSV receptors. The current model supporting SIGLEC1 as an important virus receptor is based on PRRSV infection of cultured macrophages. Under these experimental conditions, the blocking of SIGLEC1 from cells or the removal of sialic acid from the virion is sufficient to block infection. Within the more complex environment of the pig, there may exist other cell populations that can support PRRSV replication. For instance, immunohistochemical staining of tissues from infected pigs reveals the presence of PRRSV antigen in nonmacrophage cells such as pneumocytes and epithelial germ cells of the testes (12, 36). However, the presence of a PRRSV receptor or productive virus infection of these cell types is not known. Another explanation for the replication of PRRSV in SIGLEC1−/− pigs is the potential for leaky expression of the SIGLEC1 gene, which could provide a source for virus binding. However, the complete removal of exons 2 and 3, combined with the insertion of a neo gene cassette cloned in the opposite direction, as well as the addition of stop codons flanking the neo cassette, suggested that a nonfunctional or truncated SIGLEC1 protein was produced. And finally, Welsh et al. (37) reported that transfection of PRRSV-nonpermissive, SIGLEC1− PK-15 cells with a vector that expressed CD163 was sufficient to establish PRRSV permissiveness. Since CD163 can be released in a soluble form and taken back up into cells, it is possible that CD163 could bind and internalize the virus (as discussed in reference 38). Together with the results presented here, the previous observations place into question the importance of SIGLEC1 as the primary receptor of PRRSV.

Presumably, the entry of PRRSV into MARC-145 cells is independent of SIGLEC1 (39). Therefore, a MARC-145 cell-adapted virus would lose the requirement for SIGLEC1, perhaps through increased affinities for heparin sulfate and/or other receptors on the MARC-145 cell surface. In fact, repeated passage of PRRSV on MARC-145 leads to an increased virus yield on MARC-145 cells, loss of the ability of the virus to replicate in macrophages, and attenuation of clinical signs in pigs. However, these phenotypic changes occur after approximately 100 serial passages in MARC-145 cells (personal observation). The virus used in this study, KS06, was passaged only a limited number of times in MARC-145 cells, retained the ability to replicate in macrophages, and produced clinical signs in pigs. Furthermore, VR-2333, the prototypic representative of genotype II North American PRRSV isolates, retains the requirement for SIGLEC1 (14), even though it was originally isolated and passaged on a monkey kidney cell line, from which the MARC-145 cell line was derived. Therefore, it is unlikely that the virus used in this study would be sufficiently MARC-145 cell adapted to lose a requirement for SIGLEC1.

Conversely, the serial passage of PRRSV on macrophages should increase the tropism of the virus for macrophages, increase the dependence of the virus on SIGLEC1 for binding and internalization, and produce enhanced clinical disease signs. There is no documented evidence that demonstrates enhanced pathogenesis of PRRSV after propagation in macrophages.

SIGLEC1 participates in a variety of macrophage-associated immune functions. The immune response to several sialic acid-containing pathogens is initiated by the interaction of sialic acid with SIGLEC1 (reviewed in references 18 and 19). Furthermore, SIGLEC1 modulates cytotoxic T lymphocyte and B cell function. In SIGLEC1−/− mice, there are increased CD8+ cells in the spleen and lymph nodes and a corresponding decrease in B220+ B cells. In addition, the level of circulating IgM was reduced by 50%. De Baere et al. (40) reported that the engagement of SIGLEC1 by PRRSV significantly reduced the capacity of macrophages to phagocytize fluorescent beads. The degree of inhibition was dependent on the amount of virus present, and the effect of PRRSV on phagocytosis was blocked by the preincubation of cells with a SIGLEC1 antibody (17).

Even though PRRSV replication was unaffected by the absence of SIGLEC1, there was the possibility that PRRSV-specific pathogenesis could be altered during the infection of SIGLEC1−/− pigs. SIGLEC1 knockout pigs showed lower levels of PRRSV N protein-specific IgM and IgG in their serum; however, the differences were not statistically significant (Fig. 6C and D). Furthermore, knockout of SIGLEC1 expression did not appear have a measureable effect on the overall clinical signs or disease progression. Even though the absence of SIGLEC1 expression on macrophages had no apparent effect on PRRSV infection or pathogenesis, the availability of a SIGLEC1 knockout pig creates the opportunity to study the role of SIGLEC1 in porcine immunology and the responses to other infectious diseases.

ACKNOWLEDGMENTS

We acknowledge the support for this project provided by Lee D. Spate, Jianguo Zhao, Changchun Li, Jason Dowell, and Lonnie Dowell.

Funding was from the USDA ARS Program for Prevention of Animal Infectious Diseases and Advanced Technologies for Vaccines and Diagnostics (8-1940-5-519), and Food for the 21st Century.

Patent protection has been filed for the SIGLEC1 mutation in pigs.

Footnotes

Published ahead of print 19 June 2013

REFERENCES

  • 1.Keffaber KK. 1989. Reproductive failure of unknown etiology. Am. Assoc. Swine Pract. Newsl. 1:1–9 [Google Scholar]
  • 2.Wensvoort G, Terpstra C, Pol JMA, ter Laak EA, Bloemrad M, de Kluyver EP, Kragten C, van Buiten L, den Besten A, Wagenaar F, Broekhuijsen JM, Moonen PLJM, Zetstra T, de Boer EA, Tibben HJ, de Jong MF, van't Veld P, Groenland GJR, van Gennep JA, Voets MT, Verheijden JHM, Braamskamp J. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet. Q. 13:121–130 [DOI] [PubMed] [Google Scholar]
  • 3.Murtaugh MP, Elam MR, Kakach LT. 1995. Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus. Arch. Virol. 140:1451–1460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nelsen CJ, Murtaugh MP, Faaberg KS. 1999. Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents. J. Virol. 73:270–280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ropp SL, Wees CEM, Fang Y, Nelson EA, Rossow KD, Bien M, Arndt B, Preszler S, Steen P, Christopher-Hennings J, Collins JE, Benfield DA, Faaberg KS. 2004. Characterization of emerging European-like porcine reproductive and respiratory syndrome virus isolates in the United States. J. Virol. 78:3684–3703 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, Christianson WT, Morrison RB, Gorcyca D, Chladek D. 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). J. Vet. Diagn. Invest. 4:127–133 [DOI] [PubMed] [Google Scholar]
  • 7.Plagemann PGW. 1996. Lactate dehydrogenase-elevating virus and related viruses, p 1105–1120 Fields BN, Knipe DM, Howley PM. (ed), Fields virology, 3rd ed. Lippincott-Raven Press, Philadelphia, PA [Google Scholar]
  • 8.Albina E, Madec F, Cariolet R, Torrison J. 1994. Immune response and persistence of the porcine reproductive and respiratory syndrome virus in infected pigs and farm units. Vet. Rec. 134:567–573 [DOI] [PubMed] [Google Scholar]
  • 9.Allende R, Laegreid WW, Kutish GF, Galeota JA, Wills RW, Osorio FA. 2000. Porcine reproductive and respiratory syndrome virus: description of persistence in individual pigs upon experimental infection. J. Virol. 74:10834–10837 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Benfield DA, Nelson J, Rossow KD, Rowland RR, Lawson SR, Steffen M, Collins M. 1998. Pathogenesis and persistence of PRRS, p 169–171 Proceedings of the Allen D. Leman Swine Conference. College of Veterinary Medicine, University of Minnesota, Minneapolis, MN [Google Scholar]
  • 11.Christopher-Hennings J, Nelson EA, Hines RJ, Nelson JK, Swenson SL, Zimmerman JJ, Chase CCL, Yaeger MJ, Benfield DA. 1995. Persistence of porcine reproductive and respiratory syndrome virus in serum and semen of adult boars. J. Vet. Diagn. Invest. 7:456–464 [DOI] [PubMed] [Google Scholar]
  • 12.Sur JH, Cooper VL, Galeota JA, Hesse RA, Doster AR, Osorio FA. 1996. In vivo detection of porcine reproductive and respiratory syndrome virus RNA by in situ hybridization at different times postinfection. J. Clin. Microbiol. 34:2280–2286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yoon IL, Joo HS, Christianson WE, Morrison RB, Dial GD. 1993. Persistent and contact infection in nursery pigs experimentally infected with PRRS virus. Swine Health Prod. 1:5–8 [Google Scholar]
  • 14.Vanderheijden N, Delputte PL, Favoreel HW, Vandekerckhove J, Van Damme J, van Woensel PA, Nauwynck HJ. 2003. Involvement of sialoadhesin in entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages. J. Virol. 77:8207–8215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wissink EHJ, van Wijk HAR, Pol JMA, Godeke GJ, van Rijn PA, Rottier PJM, Meulenberg JJM. 2003. Identification of porcine alveolar macrophage glycoproteins involved in infection of porcine respiratory and reproductive syndrome virus. Arch. Virol. 148:177–187 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Delputte PL, Meerts P, Costers S, Nauwynck HJ. 2004. Effect of virus-specific antibodies on attachment, internalization and infection of porcine reproductive and respiratory syndrome virus in primary macrophages. Vet. Immunol. Immunopathol. 102:179–188 [DOI] [PubMed] [Google Scholar]
  • 17.Oetke C, Vinson MC, Jones C, Crocker PR. 2006. Sialoadhesin-deficient mice exhibit subtle changes in B- and T-cell populations and reduced immunoglobulin M levels. Mol. Cell. Biol. 26:1549–1557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Martinez-Pomares L, Gordon S. 2012. CD169+ macrophages at the crossroads of antigen presentation. Trends Immunol. 33:66–70 [DOI] [PubMed] [Google Scholar]
  • 19.O'Neill AS, van den Berg TK, Mullen GE. 2013. Sialoadhesin—a macrophage-restricted marker of immunoregulation and inflammation. Immunology 138:198–207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.An TQ, Tian ZJ, He YX, Xiao Y, Jiang YF, Peng JM, Zhou YJ, Liu D, Tong GZ. 2010. Porcine reproductive and respiratory syndrome virus attachment is mediated by the N-terminal domain of the sialoadhesin receptor. Vet. Microbiol. 143:371–378 [DOI] [PubMed] [Google Scholar]
  • 21.Delputte PL, Van Breedam W, Delrue I, Oetke C, Crocker PR, Nauwynck HJ. 2007. Porcine arterivirus attachment to the macrophage-specific receptor sialoadhesin is dependent on the sialic acid-binding activity of the N-terminal immunoglobulin domain of sialoadhesin. J. Virol. 81:9546–9550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Delputte PL, Nauwynck HJ. 2004. Porcine arterivirus infection of alveolar macrophages is mediated by sialic acid on the virus. J. Virol. 78:8094–8101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Van Breedam W, Van Gorp H, Zhang JQ, Crocker PR, Delputte PL, Nauwynck HJ. 2010. The M/GP(5) glycoprotein complex of porcine reproductive and respiratory syndrome virus binds the sialoadhesin receptor in a sialic acid-dependent manner. PLoS Pathog. 6:e1000730. 10.1371/journal.ppat.1000730 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Nauwynck HJ, Duan X, Favoreel HW, Van Oostveldt P, Pensaert MB. 1999. Entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages via receptor-mediated endocytosis. J. Gen. Virol. 80:297–305 [DOI] [PubMed] [Google Scholar]
  • 25.Van Breedam W, Delputte PL, Van Gorp H, Misinzo G, Vanderheijden N, Duan X, Nauwynck HJ. 2010. Porcine reproductive and respiratory syndrome virus entry into the porcine macrophage. J. Gen. Virol. 91:1659–1667 [DOI] [PubMed] [Google Scholar]
  • 26.van den Hoff MJ, Moorman AF, Lamers WH. 1992. Electroporation in ‘intracellular' buffer increases cell survival. Nucleic Acids Res. 20:2902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lai L, Kang JX, Li R, Wang J, Witt W, Yong HY, Hao Y, Wax D, Murphy CN, Rieke A, Samuel M, Linville ML, Korte SW, Evans R, Starzl TE, Prather RS, Dai Y. 2006. Generation of cloned transgenic pigs rich in omega-3 fatty acids. Nat. Biotechnol. 24:435–437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lai LX, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, Samuel M, Bonk A, Rieke A, Day BN, Murphy CN, Carter DB, Hawley RJ, Prather RS. 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295:1089–1092 [DOI] [PubMed] [Google Scholar]
  • 29.Macháty Z, Prather RS. April 2001. Complete activation of mammalian oocytes. US patent 6,211,429 B1
  • 30.Macháty Z, Wang WH, Day BN, Prather RS. 1997. Complete activation of porcine oocytes induced by the sulfhydryl reagent, thimerosal. Biol. Reprod. 57:1123–1127 [DOI] [PubMed] [Google Scholar]
  • 31.Im G-S, Lai L, Liu Z, Hao Y, Prather RS. 2004. In vitro development of preimplantation porcine nuclear transfer embryos cultured in different media and gas atmospheres. Theriogenology 61:1125–1135 [DOI] [PubMed] [Google Scholar]
  • 32.Green MR, Sambrook J. 2012. Molecular cloning: a laboratory manual, 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 33.Kim HS, Kwang J, Yoon IJ, Joo HS, Frey ML. 1993. Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Arch. Virol. 133:477–483 [DOI] [PubMed] [Google Scholar]
  • 34.Trible BR, Suddith AW, Kerrigan MA, Cino-Ozuna AG, Hesse RA, Rowland RR. 2012. Recognition of the different structural forms of the capsid protein determines the outcome following infection with porcine circovirus type 2. J. Virol. 86:13508–13514 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Mansour SL, Thomas KR, Capecchi MR. 1988. Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes. Nature 336:348–352 [DOI] [PubMed] [Google Scholar]
  • 36.Sur JH, Doster AR, Christian JS, Galeota JA, Wills RW, Zimmerman JJ, Osorio FA. 1997. Porcine reproductive and respiratory syndrome virus replicates in testicular germ cells, alters spermatogenesis, and induces germ cell death by apoptosis. J. Virol. 71:9170–9179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Welch SKW, Calvert JG. 2010. A brief review of CD163 and its role in PRRSV infection. Virus Res. 154:98–103 [DOI] [PubMed] [Google Scholar]
  • 38.Van Gorp H, Delputte PL, Nauwynck HJ. 2010. Scavenger receptor CD163, a Jack-of-all-trades and potential target for cell-directed therapy. Mol. Immunol. 47:1650–1660 [DOI] [PubMed] [Google Scholar]
  • 39.Jusa ER, Inaba Y, Kouno M, Hirose O. 1997. Effect of heparin on infection of cells by porcine reproductive and respiratory syndrome virus. Am. J. Vet. Res. 58:488–491 [PubMed] [Google Scholar]
  • 40.De Baere MI, Van Gorp H, Delputte PL, Nauwynck HJ. 2012. Interaction of the European genotype porcine reproductive and respiratory syndrome virus (PRRSV) with sialoadhesin (CD169/Siglec-1) inhibits alveolar macrophage phagocytosis. Vet. Res. 43:47. 10.1186/1297-9716-43-47 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES