Bacillus subtilis Strain Engineered for Treatment of Soil-Transmitted Helminth Diseases

Abstract

Soil-transmitted helminths (hookworms, whipworms, and large roundworms) are agents of intestinal roundworm diseases of poverty that infect upwards of 2 billion people worldwide. A great challenge in treating these diseases is the development of anthelmintic therapeutics that are inexpensive, can be produced in great quantity, and are capable of delivery under varied and adverse environmental conditions. A potential solution to this challenge is the use of live bacteria that are acceptable for human consumption, e.g., Bacillus subtilis, and that can be engineered with therapeutic properties. In this study, we expressed the Bacillus thuringiensis anthelmintic protein Cry5B in a bacterial strain that has been used as a model for live bacterial therapy, Bacillus subtilis PY79. PY79 transformed with a Cry5B expression plasmid (PY79-Cry5B) is able to express Cry5B from the endogenous B. thuringiensis cry5B promoter. During sporulation of PY79-Cry5B, Cry5B is packaged as a crystal. Furthermore, Cry5B produced in PY79 is bioactive, with a 50% lethal concentration (LC₅₀) of 4.3 μg/ml against the roundworm Caenorhabditis elegans. PY79-Cry5B was a significantly effective therapeutic in experimental Ancylostoma ceylanicum hookworm infections of hamsters. A single 10-mg/kg (0.071 μmol/kg of body weight) dose of Cry5B administered as a Cry5B-PY79 spore crystal lysate achieved a 93% reduction in hookworm burdens, which is superior on a molar level to reductions seen with clinically used anthelmintics. Given that a bacterial strain such as this one can be produced cheaply in massive quantities, our results demonstrate that the engineering and delivery of live bacterial strains have great potential to treat a significant contributor to poverty worldwide, namely, hookworm disease and other soil-transmitted helminthiasis.

INTRODUCTION

Soil-transmitted helminths (STHs) are intestinal parasitic roundworms that infect upwards of 2 billion people and are leading causes of disease burden and disability in children and pregnant women worldwide (1–4). These parasites, notably hookworms (Ancylostoma duodenale and Necator americanus), whipworms (Trichuris trichiura), and large roundworms (Ascaris lumbricoides), infect mostly impoverished people in the developing world and contribute significantly to keeping these people trapped in poverty (5). There are two classes of approved drugs (anthelmintics) for treating these parasites, namely, the benzimidazoles and the nicotinic acetylcholine receptor agonists. However, neither of these is completely effective against the range of parasites they are employed to treat (6). There are also growing numbers of reports of low/reduced efficacy of these drugs against the parasites (e.g., see references 7 to 9), which point to significant therapeutic challenges in the future (e.g., emergence of resistance).

The development of new anthelmintics for STHs has been frustrated by the economic disincentives that typically retard the development of drugs for impoverished peoples. All of the drugs that are currently used for humans were originally developed to treat farm animals and pets, and these are therefore directed against parasites that do not infect humans (10, 11). An ideal drug would be directed against human parasites, be able to be produced easily and in large quantities, be able to be shipped and stored under adverse conditions, and have minimal production costs.

Bacteria with anthelmintic properties could satisfy these criteria. Bacteria can be produced cheaply and in large quantities, can be dried down, and can be shipped and stored stably even under adverse conditions. The discovery of a bacterial protein, Bacillus thuringiensis Cry5B (BtCry5B), which belongs to a class of proteins nontoxic to vertebrates and which can produce anthelmintic effects in rodents infected with STHs (12–14), makes this microbial approach theoretically possible.

Although generally considered nontoxic to vertebrates, there is no track record or discussion of using B. thuringiensis as a bacterial strain for live microbial delivery of therapy to humans. Although B. thuringiensis is safely sprayed in agriculture as a topical insecticide, it is not generally ingested on purpose. Conversely, other Bacillus species, such as Bacillus subtilis, do have a long track record as food additives/supplements and are safely ingested on purpose by humans (15). Among Bacillus subtilis strains, the strain most extensively studied as a model for live delivery of human therapeutics is the laboratory strain PY79. PY79 has been found to be nontoxic to vertebrates, lacks potentially hazardous virulence traits, and is very closely related to a Bacillus subtilis strain marketed in Italy as a human probiotic (16–20). PY79 has been studied as an agent to prevent disease caused by food-borne pathogens, as a vehicle for vaccines, and as a mucosal adjuvant (21–27).

Because of its track record as a safe food additive/supplement for humans and its close relationship with B. thuringiensis, we decided to test the proof of concept that B. subtilis might be able to functionally express Cry5B. We tested whether B. subtilis PY79 can express and package BtCry5B and whether such PY79-expressed Cry5B is bioactive against the laboratory roundworm Caenorhabditis elegans. We then turned to an experimental model of STH disease, namely, hamsters infected with the hookworm Ancylostoma ceylanicum, which is capable of infecting humans (28) and is closely related to the major human parasite A. duodenale. We tested whether PY79-Cry5B can affect A. ceylanicum hookworm infection in rodents and compared the effectiveness of this treatment to published data on clinical anthelmintics in the same system.

MATERIALS AND METHODS

Construction and verification of strains and preparation of lysates.

The B. subtilis strain PY79 was transformed with the plasmid vector pHT3101 (PY79-vector) or with a pHT3101-derived cry5B plasmid (PY79-Cry5B) (29). Natural competence was generated in PY79 by use of a standard medium shift protocol (30). To generate spore lysates and spore crystal lysates, PY79 strains were sporulated for 96 h at 37°C, spun down, washed once with prechilled 0.5 M NaCl, and washed again with prechilled sterile double-distilled water. Final pellets were stored at −80°C until use.

Transformants were screened by PCRs using the following primers on all three strains (PY79, PY79-vector, and PY79-Cry5B): Cry5B primer forward 1 (CGTTCAAAATCATCCGTAAATG) with Cry5B primer reverse 1 (AAATGCATGAACCACTTCCAC) (predicted product of 586 nucleotides [nt]), Cry5B primer forward 2 (TGGCAACAATTAATGAGTTGTATCCAG) with Cry5B primer reverse 2 (CTGCCTTGACAAATGGCTACT) (predicted product of 497 nt), and pHT3101 primer forward (CACCCCAGGCTTTACACTTTA) with pHT3101 primer reverse (AGGCGATTAAGTTGGGTAACG) (predicted product of 220 nt with empty vector pHT3101 and 6.5 kb with the cry5B insert). Templates were prepared as follows. Single colonies of PY79, PY79-vector, and PY79-Cry5B were picked from plates and suspended in 50 μl of sterile double-distilled water. These bacterial solutions were boiled for 3 min and then snap-frozen in liquid nitrogen for 3 min. The procedure was repeated for a total of three cycles of boiling-freezing. Supernatants were collected and used as PCR templates. Cycles were carried out using Taq polymerase under the following conditions: 94°C for 3 min and then 35 cycles of 94°C for 30 s, 54°C for 45 s, and 72°C for 1 min, followed by 72°C for 10 min. All amplified products were sequenced to confirm identities. To determine putative transcription factor binding sites, 1.5 kb of the region upstream of the cry5B start codon was entered into the DBTBS database (31; http://dbtbs.hgc.jp/), and the P value was set to 0.05. Two putative sigma E binding sites were revealed, 43 and 712 bases upstream of the start codon.

The identity of the strains was further confirmed by analysis of selected proteins. Cell lysates were fractionated by 8% SDS-PAGE, and protein bands were excised from the gels. Proteins were prepared for mass spectrometric sequencing by in-gel digestion with trypsin and then analyzed by high-pressure liquid chromatography (HPLC) in combination with tandem mass spectroscopy (MS/MS) using electrospray ionization as described previously (32). The collected data were analyzed using MASCOT (Matrix Sciences) and Protein Pilot 4.0 (AB Sciex) for peptide identifications.

SEM.

In preparation for scanning electron microscopy (SEM) imaging, the samples were drop cast on a polished Si chip and dried in a vacuum. The samples were then sputter coated with iridium in an Emitech K575X sputter coater. The sputter current was 85 mA, the argon pressure was 2 Pa, and the deposition time was 7 s, resulting in a film thickness of <10 nm. The samples were imaged with an FEI XL30 ESEM FEG instrument, using a 10-kV beam energy and a spot size of 3.

C. elegans bioassays and A. ceylanicum curative experiments.

Ancylostoma ceylanicum hookworms were maintained in golden Syrian hamsters (14). All animal experiments were carried out under protocols approved by the UCSD Institutional Animal Care and Use Committees (IACUC). All housing and care of laboratory animals used in this study conformed to the Guide for the Care and Use of Laboratory Animals (33) and all requirements and regulations issued by the USDA, including regulations implementing the Animal Welfare Act (P.L. 89-544) as amended (see 18-F23). Caenorhabditis elegans was maintained according to standard procedures (34).

The concentration of Cry5B protein in PY79-Cry5B spore crystal lysates was determined as previously described for BtCry5B spore crystal lysates (13). Dose-dependent C. elegans mortality bioassays (three independent trials) were carried out as previously described (13), including use of tetracycline at 30 μg/ml, except that the assays were carried out for 6 days and each well contained ∼25 to 30 animals (with triplicate wells per experiment and three independent experiments). The 50% lethal concentration (LC₅₀) was calculated using PROBIT (35).

For in vivo curative experiments, male hamsters were infected per os with 150 A. ceylanicum infectious larvae. On day 17 postinoculation (p.i.), a fecal sample was collected from each hamster, and the number of eggs was counted using the modified McMaster technique (13). On the basis of these fecal egg counts, the hamsters were segregated to ensure that the groups (control and treatment) had roughly equivalent infection levels. On day 18 p.i., hamsters were weighed individually and given either PY79-Cry5B spore lysate or a spore dose equivalent of PY79-vector spore lysate per os through a blunt-ended gavage needle. Feces were collected on days 1 and 3 posttreatment to determine fecal egg counts (13). The hamsters were sacrificed on day 22 p.i., and intestinal parasite burdens were determined as described previously (14). The one-tailed Mann-Whitney test was performed to compare the two groups for significance in the experiment using a dose of 10 mg/kg of body weight (data were calculated and plotted using Prism 5 [GraphPad Software Inc., La Jolla, CA]). Fecal egg counts were compared using one-tailed Student's t test. For the dose-response experiment, results for each treatment group were compared to those for the control group by one-way analysis of variance and Dunnett's method.

RESULTS

Cry5B is well produced in Bacillus subtilis PY79.

A recombinant cry5B plasmid engineered for B. thuringiensis (29) was purified from B. thuringiensis and transformed into B. subtilis strain PY79 by standard transformation techniques. This plasmid, based upon the E. coli-B. thuringiensis shuttle vector pHT3101 (36), contains the endogenous Cry5B promoter and 3′-untranslated region driving expression of the wild-type cry5B gene (29). To generate an empty vector control strain, empty vector pHT3101 was also transformed into PY79. The presence of the cry5B gene in the PY79-Cry5B strain and its absence from both the parent PY79 strain and the control strain (PY79-vector) were confirmed by PCR (Fig. 1A). PCR detection of the plasmid in the PY79-vector strain and its absence from the parent PY79 strain were also confirmed (Fig. 1B). PY79 was able to maintain both the cry5B plasmid and pHT3101 under standard antibiotic selection with erythromycin, indicating that the origin of replication for B. thuringiensis functions in B. subtilis, as demonstrated previously (37).

Fig 1.

Verification of strains used in this study. (A) PCR analysis with two different Cry5B-specific primer sets to detect the parent PY79 strain, PY79 transformed with empty vector (PY79-vector), and PY79 transformed with the Cry5B plasmid (PY79-Cry5B). Only the PY79-Cry5B strain was positive for the cry5B gene. (B) PCR analysis with pHT3101 vector-specific primers, performed on the same three strains. Only the PY79-vector strain was positive with this primer set. The PY79-Cry5B lane lacks a band because although it contains the pHT3101 sequences present in the PCR primers, the Cry5B insert would result in a 6.5-kb product, which is too large to be amplified under these conditions.

The PY79-Cry5B and PY79-vector strains were sporulated. Robust expression of a protein of the size of Cry5B was detected only in the PY79-Cry5B strain (Fig. 2). Mass spectroscopy confirmed that the protein was indeed Cry5B. On the basis of quantitation relative to bovine serum albumin (BSA) standards on polyacrylamide gels, Cry5B was expressed at 10 mg/liter culture, which is ∼7.5-fold lower than the Cry5B expression level in B. thuringiensis (75 mg/liter) (29). Two other bands common to both PY79-vector and PY79-Cry5B were identified by mass spectroscopy as the 60-kDa chaperonin protein and an oligopeptide-binding protein from B. subtilis 168, the parent strain of PY79 (38). These assays confirmed that Cry5B is expressed in the PY79-Cry5B strain and that the strain is B. subtilis PY79.

Fig 2.

Expression of Cry5B protein in PY79-Cry5B. PY79-vector and PY79-Cry5B were sporulated, and protein products were analyzed by polyacrylamide gel electrophoresis. Expression of the 140-kDa Cry5B protein (upper arrow) is evident for the PY79-Cry5B strain, and its identity was confirmed by mass spectroscopy. Two other bands analyzed by mass spectroscopy for both PY79-vector and PY79-Cry5B were definitively identified as B. subtilis proteins (e.g., not B. thuringiensis proteins): the 60-kDa chaperonin (middle arrow) and an oligopeptide-binding protein (lower arrow).

Crystal proteins expressed during sporulation of B. thuringiensis assemble into crystalline inclusions in the mother cell compartment that are often bipyramidal in shape (39). This assembling is also true of Cry5B produced in B. thuringiensis (40). Whereas no crystals were detected upon sporulation of the PY79-vector strain (Fig. 3A), many small crystalline inclusions were present upon sporulation of the PY79-Cry5B strain (Fig. 3B). Some of these crystals were bipyramidal in shape; others appeared to be truncated versions of such crystals (Fig. 3B). Thus, Cry5B not only is expressed in PY79 but also assembles into crystalline inclusions.

Fig 3.

PY79-Cry5B assembles Cry5B into crystals. Scanning electron microscopy of PY79-vector spore lysates (no crystals are seen) (A) and PY79-Cry5B spore crystal lysates (B). s, spore; c, crystal. An expansion of one crystal is shown in the lower left corner of panel B. The scales in the panels are the same (except for the expansion).

Cry5B made by PY79 is bioactive.

To test whether or not Cry5B made by PY79 is bioactive, dose-dependent mortality assays were set up using the laboratory roundworm C. elegans in a standard 48-well format (13, 41). The Cry5B component of PY79-Cry5B spore crystal lysates was quantitated relative to BSA standards on polyacrylamide gels. Fourth-stage larvae were incubated for 6 days in wells containing PY79-Cry5B spore crystal lysates containing fixed amounts of Cry5B. Antibiotics were included to prevent infection of the roundworms by bacteria (42). Cry5B made by PY79 was found to kill C. elegans, with an LC₅₀ of 4.3 μg/ml (95% confidence interval, 3.6 to 5.0 μg/ml) (Fig. 4). This LC₅₀ is similar to the LC₅₀ of Cry5B purified from B. thuringiensis (7 to 9 μg/ml) (35) under comparable conditions (25°C, 6 days). Conversely, C. elegans exposed to PY79-vector spore lysates (with a spore count equivalent to the highest dose used with PY79-Cry5B) was >99% viable (122/123 worms were alive). Thus, PY79 spore lysates are not lethal to C. elegans, and PY79 is able to produce bioactive Cry5B.

Fig 4.

PY79-Cry5B is bioactive against C. elegans. The results shown are from dose-dependent mortality assays plotting % live C. elegans (y axis) versus Cry5B concentration (x axis). The PY79-vector strain (vector-PY79) lacks Cry5B (0 μg/ml). Each data point represents the average for three independent experiments with ∼75 to 90 animals per experiment (∼225 to 270 animals per data point). Error bars represent standard errors.

PY79-Cry5B is therapeutic against experimental hookworm infection in hamsters.

Nine hamsters were infected with the hookworm parasite A. ceylanicum. At 18 days postinoculation, five hamsters were treated per os with a single dose of PY9-vector spore lysate, and four were treated with a single dose of PY79-Cry5B spore crystal lysate (equivalent spore counts were used in both treatment groups; the amount of Cry5B was determined relative to BSA standards on protein gels). The single dose of Cry5B used was 10 mg/kg, chosen based on published doses of clinical anthelmintics used in the same model of hookworm disease (Table 1). Feces were collected before and after treatment in order to determine worm loading and changes to parasite egg output. At 22 days postinfection, animals were sacrificed and intestinal worm burdens determined. With a single dose, hookworm burdens were reduced 93% relative to those of the control group (P = 0.009) (Fig. 5A). Strong effects could also be seen in the reduction of parasite eggs excreted into feces (91% reduction) (Fig. 5B). To determine if there was an effective dose-response relationship and if significant therapy could be provided at lower doses, another experiment was carried out with three hamsters per group and Cry5B doses of 0.4, 1.4, and 4 mg/kg. Significant clearance of parasites was seen at 1.4 and 4 mg/kg Cry5B in PY79 (69% and 79% reductions, with P values of 0.023 and 0.012, respectively).

Table 1.

Comparison of efficacies of PY79-Cry5B and clinically used anthelmintics against A. ceylanicum infections in hamsters

Treatmenta	Dose (μmol/kg)	% Parasite reduction	P value	Reference
Levamisole	49	60	0.057	47
Pyrantel	17	87	0.057	47
Tribendimidine	22	75	>0.05?	46
Albendazole (1.25 mg/kg)	4.7	88	<0.001	47
Cry5B	0.071	93	0.009	This study

^aTreatments were administered at 10 mg/kg unless otherwise stated.

Fig 5.

PY79-Cry5B has a dose-dependent therapeutic effect against hookworm infection in hamsters. (A) Intestinal hookworm burdens in nine hamsters following treatment with PY79-vector or PY79-Cry5B (10 mg/kg Cry5B) (error bars in all panels show standard errors). The average worm burdens were 18.6 ± 2.6 and 1.3 ± 0.3 for PY79-vector and PY79-Cry5B, respectively. (B) Fecal egg counts on day −1, day +1, and day +3 relative to the day of treatment. The actual egg counts for PY79-vector and PY79-Cry5B were 965 ± 193 and 1,044 ± 99, respectively, on day −1, 1,055 ± 230 and 94 ± 60, respectively, on day +1, and 1,055 ± 227 and 100 ± 42, respectively, on day +3. EPG, eggs per gram of feces. (C) In vivo dose-response experiment with 12 hamsters. The average worm burdens for PY79-vector and PY79-Cry5B at Cry5B concentrations of 0.4 mg/kg, 1.4 mg/kg, and 4 mg/kg were 27.0 ± 3.2, 15.7 ± 7.0, 8.3 ± 0.9, and 5.7 ± 0.9, respectively.

DISCUSSION

We demonstrate for the first time that Bacillus subtilis can be engineered to provide a significant therapeutic effect against an existing parasitic disease. For this pilot study, we chose PY79, a laboratory strain of B. subtilis that has been used as a model for the delivery of viable bacterial therapies in humans and livestock and that is closely related to a food-grade B. subtilis species. PY79 can be made to express and correctly present the BtCry5B protein in a manner that is bioactive against the laboratory roundworm C. elegans. A single 10-mg/kg dose (71 nmol/kg) of Cry5B administered as a Cry5B-PY79 spore crystal lysate reduced A. ceylanicum hookworm burdens in hamsters by 93%, and a dose as small as 1.4 mg/kg was able to provide significant therapy. In previously published data, we showed that purified Cry5B delivered at 10 mg/kg reduces hookworm burdens by 65% (14), suggesting that delivery of Cry5B via PY79 spore crystal lysates is superior to delivery via purified protein.

The expression of Cry5B in B. subtilis by use of the endogenous BtCry5B promoter may be due at least partly to two putative sigma E elements upstream of the cry5B start codon (see Materials and Methods). Sigma E is a sporulation-specific promoter that is active in B. subtilis and also known to be involved in crystal protein production in B. thuringiensis (43, 44). The engineered strain used for the present proof-of-concept study includes antibiotic resistance genes associated with the cry5B plasmid. Given the genetic tools associated with B. subtilis, a Cry5B-expressing B. subtilis therapeutic product for humans that includes the cry5B gene integrated into the genome and that lacks any antibiotic resistance genes could be engineered in the future (45).

The 93% elimination (P = 0.0.009) of A. ceylanicum hookworm parasites from hamsters by use of a single 10-mg/kg (71 nmol/kg) dose is noteworthy and compares very favorably to the results of anthelmintics used clinically (Table 1). For example, a 10-mg/kg (49 μmol/kg) dose of levamisole results in a 60% reduction of A. ceylanicum burdens in hamsters, a 10-mg/kg (17 μmol/kg) dose of pyrantel results in an 87% reduction in A. ceylanicum burdens, a 10-mg/kg (22 μmol/kg) dose of tribendimidine results in a 75% reduction of A. ceylanicum burdens, and a 1.25-mg/kg (4.7 μmol/kg) dose of albendazole results in an 88% reduction of A. ceylanicum burdens (46, 47). In addition to excellent efficacy, Cry5B has a different mechanism of action from that of chemical anthelmintics; it is a pore-forming protein that binds to invertebrate-specific glycolipids and attacks the plasma membrane of the nematode intestine (34, 35, 48–50).

Thus, even without any optimization, PY79-Cry5B is comparable to many current drugs in its efficacy on a mg/kg basis, and on a molar level, it appears to be superior (e.g., the molar dose of Cry5B used in our experiments is 66 times lower than the molar dose of albendazole mentioned above). Our results validate the B. subtilis-Cry5B approach and provide a starting point for increasing B. subtilis-Cry5B specific activity, e.g., by Cry5B point mutations that increase roundworm-killing activity (51) and by optimization of fermentation conditions that can also increase crystal protein specific activity (52). Given that Bacillus bacteria can be produced and stored cheaply and in large quantities (53), our results demonstrate that delivery of Cry5B by food-grade B. subtilis holds great promise in the mass treatment of STH diseases.