Abstract
Vibrio cholerae, an environmental organism, is a facultative human pathogen. Here, we report the virulence profiles, comprising 18 genetic markers, of 102 clinical and 692 environmental V. cholerae strains isolated in Bangladesh between March 2004 and January 2006, showing the variability of virulence determinants within the context of public health.
TEXT
Vibrio cholerae, the etiological agent of cholera, is a serious health threat in developing countries. It is a common member of natural aquatic environments, and the ocean serves as the principal reservoir for this organism in nature. Since cholera is impossible to eradicate, it is crucial to continuously monitor the environment in order to minimize or prevent infections when V. cholerae is present in its pathogenic form or at high densities.
More than 200 serogroups have been described, but only serogroups O1 and O139 are linked to epidemic cholera worldwide (1). The pathogenicity of serogroups O1 and O139 is associated with expression of cholera toxin (CT), encoded in the genome of a filamentous bacteriophage, CTXΦ (2), and the ability to adhere to the intestine via type IV pilus (toxin-coregulated pilus [TCP]) functioning as a colonization factor encoded by a pathogenicity island (Vibrio pathogenicity island [VPI]) (3).
Non-O1/non-O139 V. cholerae strains inhabit estuarine and coastal waters, but their clinical significance is underappreciated. For 30 years, they have been associated with septicemia (4, 5), peritonitis (6), and gastroenteritis (7–9), via ingestion of contaminated food or exposure to the aquatic environment. Similarly, nontoxigenic Vibrio cholerae O1 has been linked to gastroenteritis (10) and localized cholera outbreaks (11).
A range of putative virulence factors has been described, including hemolysin (hlyA) (12), non-O1 (NAG-ST) and O1 (O1-ST) heat-stable enterotoxins (encoded by stn and sto genes, respectively) (13), ToxR (toxR) (14), zonula occludens toxin (zot) (15), actin cross-linking repeats in toxin (rtxA) (16), hemagglutinin protease (hap) (17), the type VI secretion system (T6SS) (18), and the type III secretion system (T3SS) (19). Occasionally, cholera toxin (ctxA) (15) and toxin-coregulated-pilus-associated genes (tcpA and tcpI) (20) have been reported in V. cholerae non-O1/non-O139 strains.
The aim of this study was to determine the presence of virulence-associated factors in 794 V. cholerae strains (Table 1) isolated during epidemiological and ecological surveillance in the provinces of Bakerganj and Mathbaria, Bangladesh, between 2004 and 2006, with details described elsewhere (21). The strain collection comprised 102 clinical and 50 environmental V. cholerae O1 isolates, as well as 10 clinical and 31 environmental V. cholerae O139 isolates and 601 environmental V. cholerae non-O1/non-O139 isolates.
Table 1.
V. cholerae O1, O139, and non-O1/non-O139 strains isolated from clinical and environmental samples collected in Bakerganj and Mathbaria between March 2004 and January 2006
| Location and yr | No. of strains |
||||||
|---|---|---|---|---|---|---|---|
|
V. cholerae O1 |
V. cholerae O139 |
V. cholerae non-O1/non-O139a | |||||
| Clinical |
Environmental |
Clinical | Environmental | ||||
| Inaba | Ogawa | Inaba | Ogawa | ||||
| Mathbaria | |||||||
| 2004 | 19 | 6 | 12 | 0 | 0 | 5 | 162 |
| 2005 | 6 | 10 | 3 | 2 | 10 | 25 | 220 |
| 2006 | 1 | 0 | 0 | 0 | 0 | 0 | 8 |
| Bakerganj | |||||||
| 2004 | 21 | 9 | 18 | 1 | 0 | 0 | 72 |
| 2005 | 10 | 17 | 12 | 2 | 0 | 1 | 131 |
| 2006 | 1 | 2 | 0 | 0 | 0 | 0 | 8 |
| Total (794) | 58 | 44 | 45 | 5 | 10 | 31 | 601 |
All V. cholerae non-O1/non-O139 strains were isolated from the environment.
Chromosomal DNA was extracted (22), and PCR was performed in a 50-μl reaction mixture containing 1 U of GoTaq DNA polymerase (Bio-Rad). PCR screening employed positive and negative controls (V. cholerae O1 strains N16961 and O395; V. cholerae non-O1/non-O139 strains RC385, RC66, and AM-19226) and primers previously described for ctxA, hlyA, zot/toxR, tcpA, tcpI, and stn/sto (23); nag-ST, rtxA, and hap (24); luxA (25); and T3SS genes, vcsC, vcsV, vcsN, and vspD (26). Specific T6SS primers for vasA, vasH, and vasK were designed: vasA-104F (GTACGACCGATCCTGACGTT), vasA-446R (ATCTGAATGGTCGTGGCTTC), vasH-857F (GTGGCACGCTATTTCTGGAT), vasH-1242R (TTTCAGCTCACGCACATTTC), vasK-1851F (GCGTCAAATTCAGGAAGAGC), and vasK-2250R (CTGTCCCAGAACCCAACTGT). PCR data presented in Table 2 are the results of at least two independent experiments.
Table 2.
Virulence gene profiles of V. cholerae isolates examined in this study
| Gene | No. of strains positive for gene/no. tested (% positive) by V. cholerae serogroup: |
% positive of total (n = 794) | ||
|---|---|---|---|---|
| O1 (n = 152) | O139 (n = 41) | Non-O1/non-O139 (n = 601) | ||
| hlyA | 82/97 (85) | 34/41 (83) | 478/582 (82) | 83 |
| hap | 56/57 (98) | 18/18 (100) | 246/251 (98) | 98 |
| ctxA | 141/152 (93) | 34/41 (83) | 15/601 (2) | 24 |
| zot | 146/152 (96) | 33/41 (80) | 13/601 (2) | 24 |
| toxR | 119/152 (78) | 37/41 (90) | 538/601 (90) | 87 |
| nag-ST | 0/97 (0) | 0/41 (0) | 17/600 (3) | 2 |
| stn/sto | 0/41 (0) | 0/24 (0) | 6/334 (2) | 2 |
| tcpI | 54/57 (95) | 18/18 (100) | 6/257 (2) | 23 |
| tcpA | 113/152 (74) | 22/41 (54) | 1/599 (0.2) | 17 |
| rtxA | 148/152 (97) | 39/41 (95) | 527/548 (96) | 96 |
| T6SS | ||||
| vasA | 132/152 (87) | 41/41 (100) | 573/601 (95) | 94 |
| vasK | 151/152 (99) | 41/41 (100) | 594/601 (99) | 99 |
| vasH | 152/152 (100) | 41/41 (100) | 593/601 (99) | 99 |
| luxA | 0/41 (0) | 0/24 (0) | 34/334 (10) | 9 |
| T3SS | ||||
| vcsN | 0/152 (0) | 3/41 (7) | 41/601 (7) | 6 |
| vcsV | 2/81 (2) | 2/36 (6) | 54/405 (13) | 11 |
| vcsC | 0/57 (0) | 2/18 (11) | 35/270 (13) | 11 |
| vspD | 2/152 (1) | 1/41 (2) | 51/601 (8) | 7 |
Virulence factors for specific V. cholerae serogroups are summarized in Tables 2 and 3. Most V. cholerae O1, O139, and non-O1/non-O139 strains, regardless of whether they were toxigenic, carried hemagglutinin protease hap (98%) and T6SS (94 to 99%) genes but not heat-stable enterotoxins (Table 2). Variability in gene content in T6SS (vasA, vasK, and vasH) and T3SS (vcsN, vcsV, vcsC, and vspD) regions may be a consequence of gene absence; conversely, amplification failure due to single nucleotide polymorphisms (SNPs) in the primer sequence cannot be ruled out also.
Table 3.
Representative genotypes of V. cholerae serogroups
| Straina | Yr(s) | Sourceb | Genotype |
|---|---|---|---|
| O1 | |||
| 49 | 2005–2006 | Clin (M, B) | hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH |
| 7 | 2004–2006 | Env (M, B) | |
| 11 | 2004–2005 | Env (M, B) | hlyA hap ctxA zot toxR tcpI rtxA vasA vasK vasH |
| 2 | 2005 | Env (B) | hlyA hap toxR rtxA vasA vasK vasH vcsV vcsC |
| O139 | |||
| 3 | 2004–2005 | Env (M, B) | hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH |
| 10 | 2005 | Clin (M) | |
| 10 | 2005 | Env (M) | hlyA hap ctxA zot toxR tcpI rtxA vasA vasK vasH |
| 2 | 2005 | Env (M) | hlyA hap zot toxR tcpI tcpA rtxA vasA vasK vasH |
| 2 | 2005 | Env (M) | hlyA hap zot toxR tcpI rtxA vasA vasK vasH |
| 3 | 2005 | Env (M) | hap ctxA zot toxR tcpI rtxA vasA vasK vasH |
| NIH430 | 2005 | Env (M) | hlyA hap toxR tcpI rtxA vasA vasK vasH vcsN vcsV vcsC |
| NIH753 | 2005 | Env (M) | hlyA hap ctxA toxR tcpI rtxA vasA vasK vasH vcsN vcsV vcsC |
| NIH758 | 2005 | Env (M) | hlyA hap toxR tcpI tcpA rtxA vasA vasK vasH vcsN vcsC |
| Non-O1/non-O139 | |||
| 160 | 2005–2006 | Env (M, B) | hlyA hap toxR rtxA vasA vasK vasH |
| NIH831 | 2005 | Env (B) | hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH |
| 12 | 2004, 2006 | Env (M, B) | hlyA hap toxR nag-ST stn/sto rtxA vasA vasK vasH |
Data are either numbers of strains showing the same genotype or strain designations.
Abbreviations: Clin, clinical; Env, environmental; M, Mathbaria; B, Bakherganj.
V. cholerae O1 clinical isolates possessed a typical virulence profile, ctxA zot tcpI tcpA (74 to 96%), and almost ubiquitous T6SS genes vasA, vasK, and vasH (87 to 100%) and hlyA and hap (85 to 98%) (Table 2). The most frequent genotype in clinical and environmental V. cholerae O1 isolates (56 out of 150) was hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH (Table 3). A variant profile, lacking tcpA, was observed in 11 environmental O1 strains (Table 3). Overall, environmental O1 virulence profiles were more heterogeneous than clinical ones, with 18 different profiles (data not shown). Interestingly, two environmental O1 isolates, isolated in Bakerganj in 2005, lacked common cholera-associated virulence genes (ctxA, tcpI, tcpA, and zot) but carried hlyA, hap, rtxA, T6SS, and T3SS (Table 3).
All V. cholerae O139 isolates were positive for tcpI, hap, and T6SS, and most were positive for hlyA, ctxA, zot, toxR, and rtxA (80 to 100%) (Table 2). Remarkably, the two most frequently observed O139 genotypes were identical to O1 genotypes: (i) hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH, in both clinical and environmental isolates from Mathbaria and Bakerganj, and (ii) tcpA-negative variant, observed in environmental strains from Mathbaria (Table 3). Overall, compared to clinical O139, environmental isolates showed greater variability in virulence profiles (12 profiles); the most prevalent ones are shown in Table 3. Three environmental O139 isolates (NIH430, NIH753, and NIH758) isolated in Mathbaria in 2005 carried some of the T3SS genes (vcsN, vcsV, and/or vcsC) but demonstrated variable virulence profiles (Table 3).
Environmental non-O1/non-O139 isolates comprised the majority of the collection (601 strains). Most lacked typical cholera virulence genes; only 26 were positive for tcpI, tcpA, ctxA, and/or zot (0.2 to 2%) (Table 2). Conversely, most were positive for hlyA, rtxA, and hap, as well as T6SS (82 to 99%) and T3SS (7 to 13%) genes. The common genotype was hlyA toxR hap rtxA vasA vaH vasK (160 strains) (Table 3). Only one (NIH831) showed the same genotype, hlyA hap ctxA zot toxR tcpI tcpA rtxA vasA vasK vasH, observed in V. cholerae O1 and O139 isolates. Seventeen non-O1/non-O139 isolates whose genomes encoded heat-stable enterotoxin (NAG-ST) demonstrated five virulence profiles, hlyA toxR hap stn/sto rtxA vasA vaH vasK being the most common (12 out of 17) (Table 3), a finding consistent with the report that NAG-ST is mostly associated with V. cholerae non-O1/non-O139 and Vibrio mimicus strains (13, 27, 28), although a V. cholerae O1 isolate with genes encoding NAG-ST has also been reported (29, 30).
Overall, most strains carried rtxA, hap, hlyA, and type VI secretion system genes (31). RtxA has been correlated with cytotoxic activity causing mammalian cells to detach and round up (16), whereas V. cholerae hemolysin exhibits vacuolating activity (32) and HapA affects epithelial tight junction-associated proteins (33). These combined virulence factors may be the cause of nontoxigenic V. cholerae non-O1/non-O139 diarrhea. Furthermore, association of these virulence factors with CT in non-O1/non-O139 isolates may foreshadow the emergence of new toxigenic clones from the environment; a noteworthy example is NIH831 (non-O1/non-O139, Bakerganj, 2005), which carries genes encoding all virulence factors except T3SS, virtually sharing the same pathogenicity profile as that associated with toxigenic O1 strains.
The emergence of toxigenic V. cholerae non-O1/non-O139 strains is consistent with identification of new pathogenic clones in both clinical and environmental samples worldwide (23, 34, 35), cementing the link between the environmental reservoir and human infection for cholera. New variants may lead to epidemic outbreaks of cholera in Bangladesh, confirming the value of monitoring V. cholerae within the context of public health.
ACKNOWLEDGMENTS
This research was funded by National Institutes of Health research grants 1RO1A139129-01 and 2RO1A1039129-11A2.
Footnotes
Published ahead of print 19 July 2013
REFERENCES
- 1.Kaper JB, Morris JG, Jr, Levine MM. 1995. Cholera. Clin. Microbiol. Rev. 8:48–86 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Waldor MK, Tschape H, Mekalanos JJ. 1996. A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139. J. Bacteriol. 178:4157–4165 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Karaolis DKR, Johnson JA, Bailey CC, Boedeker EC, Kaper JB, Reeves PR. 1998. A Vibrio cholerae pathogenicity island associated with epidemic and pandemic strains. Proc. Natl. Acad. Sci. U. S. A. 95:3134–3139 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Briceño LI, Puebla AC, Guerra AF, Jensen FD, Núñez BH, Ulloa FMT, Osorio ACG. 2009. Non-toxigenic hemolytic Vibrio cholerae non-O1 non-O139 fatal septicemia. Report of one case. Rev. Med. Chil. 137:1193–1196 [PubMed] [Google Scholar]
- 5.Crump JA, Bopp CA, Greene KD, Kubota KA, Middendorf RL, Wells JG, Mintz ED. 2003. Toxigenic Vibrio cholerae serogroup O141-associated cholera-like diarrhea and bloodstream infection in the United States. J. Infect. Dis. 187:866–868 [DOI] [PubMed] [Google Scholar]
- 6.Ichinose Y, Ehara M, Shimizu T, Ohmagari T, Kaku M, Hara K, Tsuji T, Simada T. 2001. The characterization of Vibrio cholerae non-O1 strain causing perforative pan-peritonitis. Kansenshogaku Zasshi 75:696–702 [DOI] [PubMed] [Google Scholar]
- 7.Morris JJ, Takeda T, Tall B, Losonsky G, Bhattacharya S, Forrest B, Kay B, Nishibuchi M. 1990. Experimental non-O group 1 Vibrio cholerae gastroenteritis in humans. J. Clin. Invest. 85:697–705 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Onifade T, Hutchinson R, Zile KV, Bodager D, Baker R, Blackmore C. 2011. Toxin producing Vibrio cholerae O75 outbreak, United States, March to April 2011. Euro Surveill. 16:19870 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19870 [PubMed] [Google Scholar]
- 9.Wilson R, Lieb S, Roberts A, Stryker S, Janowski H, Gunn R, Davis B, Riddle CF, Barrett T, Morris JG, Blake PA. 1981. Non-O group 1 Vibrio cholerae gastroenteritis associated with eating raw oysters. Am. J. Epidemiol. 114:293–298 [DOI] [PubMed] [Google Scholar]
- 10.Morris JG, Picardi JL, Lieb S, Lee JV, Roberts A, Hood M, Gunn RA, Blake PA. 1984. Isolation of nontoxigenic Vibrio cholerae O group 1 from a patient with severe gastrointestinal disease. J. Clin. Microbiol. 19:296–297 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Saha PK, Koley H, Mukhopadhyay AK, Bhattacharya SK, Nair GB, Ramakrishnan BS, Krishnan S, Takeda T, Takeda Y. 1996. Nontoxigenic Vibrio cholerae O1 serotype Inaba biotype El Tor associated with a cluster of cases of cholera in southern India. J. Clin. Microbiol. 34:1114–1117 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Zhang XH, Austin B. 2005. Haemolysins in Vibrio species. J. Appl. Microbiol. 98:1011–1019 [DOI] [PubMed] [Google Scholar]
- 13.Dalsgaard A, Albert MJ, Taylor DN, Shimada T, Meza R, Serichantalergs O, Echeverria P. 1995. Characterization of Vibrio cholerae non-O1 serogroups obtained from an outbreak of diarrhea in Lima, Peru. J. Clin. Microbiol. 33:2715–2722 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Waldor MK, Mekalanos JJ. 1994. ToxR regulates virulence gene expression in non-O1 strains of Vibrio cholerae that cause epidemic cholera. Infect. Immun. 62:72–78 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Jiang S, Chu W, Fu W. 2003. Prevalence of cholera toxin genes (ctxA and zot) among non-O1/O139 Vibrio cholerae strains from Newport Bay, California. Appl. Environ. Microbiol. 69:7541–7544 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lin W, Fullner KJ, Clayton R, Sexton JA, Rogers MB, Calia KE, Calderwood SB, Fraser C, Mekalanos JJ. 1999. Identification of a Vibrio cholerae RTX toxin gene cluster that is tightly linked to the cholera toxin prophage. Proc. Natl. Acad. Sci. U. S. A. 96:1071–1076 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Silva AJ, Leitch GJ, Camilli A, Benitez JA. 2006. Contribution of hemagglutinin/protease and motility to the pathogenesis of El Tor biotype cholera. Infect. Immun. 74:2072–2079 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Unterweger D, Kitaoka M, Miyata ST, Bachmann V, Brooks TM, Moloney J, Sosa O, Silva D, Duran-Gonzalez J, Provenzano D, Pukatzki S. 2012. Constitutive type VI secretion system expression gives Vibrio cholerae intra- and interspecific competitive advantages. PLoS One 7:e48320. 10.1371/journal.pone.0048320 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Dziejman M, Serruto D, Tam VC, Sturtevant D, Diraphat P, Faruque SM, Rahman MH, Heidelberg JF, Decker J, Li L, Montgomery KT, Grills G, Kucherlapati R, Mekalanos JJ. 2005. Genomic characterization of non-O1, non-O139 Vibrio cholerae reveals genes for a type III secretion system. Proc. Natl. Acad. Sci. U. S. A. 102:3465–3470 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sarkar A, Nandy RK, Nair GB, Ghose AC. 2002. Vibrio pathogenicity island and cholera toxin genetic element-associated virulence genes and their expression in non-O1 non-O139 strains of Vibrio cholerae. Infect. Immun. 70:4735–4742 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Alam M, Hasan NA, Sadique A, Bhuiyan NA, Ahmed KU, Nusrin S, Nair GB, Siddique AK, Sack RB, Sack DA, Huq A, Colwell RR. 2006. Seasonal cholera caused by Vibrio cholerae serogroups O1 and O139 in the coastal aquatic environment of Bangladesh. Appl. Environ. Microbiol. 72:4096–4104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. 1990. Current protocols in molecular biology. Green Publishing Associates and Wiley, New York, NY [Google Scholar]
- 23.Rivera ING, Chun J, Huq A, Sack RB, Colwell RR. 2001. Genotypes associated with virulence in environmental isolates of Vibrio cholerae. Appl. Environ. Microbiol. 67:2421–2429 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Haley BJ, Chen A, Grim CJ, Clark P, Diaz CM, Taviani E, Hasan NA, Sancomb E, Elnemr WM, Islam MA, Huq A, Colwell RR, Benediktsdóttir E. 2012. Vibrio cholerae in a historically cholera-free country. Environ. Microbiol. Rep. 4:381–389 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Grim CJ, Taviani E, Alam M, Huq A, Sack RB, Colwell RR. 2008. Occurrence and expression of luminescence in Vibrio cholerae. Appl. Environ. Microbiol. 74:708–715 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Huq A, Haley BJ, Taviani E, Chen A, Hasan NA, Colwell RR. 2012. Detection, isolation, and identification of Vibrio cholerae from the environment. Curr. Protoc. Microbiol. 26:6A.5.1–6A.5.51. 10.1002/9780471729259.mc06a05s26 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sarkar B, Bhattacharya T, Ramamurthy T, Shimada T, Takeda Y, Nair GB. 2002. Preferential association of the heat-stable enterotoxin gene (stn) with environmental strains of Vibrio cholerae belonging to the O14 serogroup. Epidemiol. Infect. 129:245–251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Vicente ACP, Coelho AM, Salles CA. 1997. Detection of Vibrio cholerae and V. mimicus heat-stable toxin gene sequence by PCR. J. Med. Microbiol. 46:398–402 [DOI] [PubMed] [Google Scholar]
- 29.Mallard KE, Desmarchelier PM. 1995. Detection of heat-stable enterotoxin genes among Australian Vibrio cholerae O1 strains. FEMS Microbiol. Lett. 127:111–115 [DOI] [PubMed] [Google Scholar]
- 30.Takeda T, Peina Y, Ogawa A, Dohi S, Abe H, Nair GB, Pal SC. 1991. Detection of heat-stable enterotoxin in a cholera toxin gene-positive strain of Vibrio cholerae O1. FEMS Microbiol. Lett. 64:23–27 [DOI] [PubMed] [Google Scholar]
- 31.Pukatzki S, Ma AT, Sturtevant D, Krastins B, Sarracino D, Nelson WC, Heidelberg JF, Mekalanos JJ. 2006. Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc. Natl. Acad. Sci. U. S. A. 103:1528–1533 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Figueroa-Arredondo P, Heuser JE, Akopyants NS, Morisaki JH, Giono-Cerezo S, Enríquez-Rincón F, Berg DE. 2001. Cell vacuolation caused by Vibrio cholerae hemolysin. Infect. Immun. 69:1613–1624 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Wu Z, Nybom P, Magnusson K-E. 2000. Distinct effects of Vibrio cholerae haemagglutinin/protease on the structure and localization of the tight junction-associated proteins occludin and ZO-1. Cell. Microbiol. 2:11–17 [DOI] [PubMed] [Google Scholar]
- 34.Bakhshi B, Barzelighi-Mohammadi H, Adabi M, Lari AR, Pourshafie MR. 2009. A molecular survey on virulence associated genotypes of non-O1 non-O139 Vibrio cholerae in aquatic environment of Tehran, Iran. Water Res. 43:1441–1447 [DOI] [PubMed] [Google Scholar]
- 35.Bakhshi B, Mohammadi-Barzelighi H, Sharifnia A, Dashtbani-Roozbehani A, Rahbar M, Pourshafie M. 2012. Presence of CTX gene cluster in environmental non-O1/O139 Vibrio cholerae and its potential clinical significance. Indian J. Med. Microbiol. 30:285–289 [DOI] [PubMed] [Google Scholar]