Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2013 Sep;81(9):3119–3127. doi: 10.1128/IAI.00145-13

Identification of Salmonella enterica Serovar Pullorum Antigenic Determinants Expressed In Vivo

Qiuchun Li 1, Yachen Hu 1, Jing Chen 1, Zhicheng Liu 1, Jun Han 1, Lin Sun 1, Xinan Jiao 1,✉
Editor: B A McCormick
PMCID: PMC3754199  PMID: 23774596

Abstract

Salmonella enterica serovar Pullorum affecting poultry causes pullorum disease and results in severe economic loss in the poultry industry. Currently, it remains a major threat in countries with poor poultry surveillance and no efficient control measures. As S. Pullorum could induce strong humoral immune responses, we applied an immunoscreening technique, the in vivo-induced antigen technology (IVIAT), to identify immunogenic bacterial proteins expressed or upregulated during S. Pullorum infection. Convalescent-phase sera from chickens infected with S. Pullorum were pooled, adsorbed against antigens expressed in vitro, and used to screen an S. Pullorum genomic expression library. Forty-five proteins were screened out, and their functions were implicated in molecular biosynthesis and degradation, transport, metabolism, regulation, cell wall synthesis and antibiotic resistance, environmental adaptation, or putative functions. In addition, 11 of these 45 genes were assessed for their differential expression by quantitative real-time reverse transcription-PCR (RT-PCR), revealing that 9 of 11 genes were upregulated to different degrees under in vivo conditions, especially the regulator of virulence determinants, phoQ. Then, four in vivo-induced proteins (ShdA, PhoQ, Cse3, and PbpC) were tested for their immunoreactivity in 28 clinical serum samples from chickens infected with S. Pullorum. The rate of detection of antibodies against ShdA reached 82% and was the highest among these proteins. ShdA is a host colonization factor known to be upregulated in vivo and related to the persistence of S. Typhimurium in the intestine. Furthermore, these antigens identified by IVIAT warrant further evaluation for their contributions to pathogenesis, and more potential roles, such as diagnostic, therapeutic, and preventive uses, need to be developed in future studies.

INTRODUCTION

Salmonella enterica serovar Pullorum is the causative agent of pullorum disease in poultry, an acute systemic disease more common in young birds. Infected adults with a chronic carrier state rarely show significant clinical disease but experience decreased laying, loss of weight, diarrhea, and abnormalities of the reproductive tract (1). Although many countries are reported to be free of pullorum disease, it remains a major threat in countries such as China, where control measures are not efficient, or in those where the climatic conditions that favor the environmental spread of the pathogen (2). In the United States and European countries, elimination of pullorum disease was found to be difficult, as the increasing amount of extensive free-range rearing with poor or no floor disinfection and the presence of various wildlife vectors increase the risk of infection (3–5). The disease has also been frequently reported in developing countries, such as Mexico, Argentina, and China (2).

As a host-restricted Salmonella serovar, S. Pullorum belongs to serogroup D (possessing O antigens 1, 9, and 12 and nonflagellated:−:−) (6). In contrast to broad-host-range pathogens, S. Pullorum does not trigger an inflammatory response in the early stages of infection, and the lack of an inflammatory response is considered to prevent systemic disease and the elimination of pathogens from the site of infection (7, 8). It is speculated that S. Pullorum preferentially targets the bursa of Fabricius prior to eliciting intestinal inflammation. The persistence of S. Pullourum in spleen macrophages leads to infection of the reproductive tract and vertical transmission of the infection to eggs or progeny (7, 9). However, the immune response to S. Pullorum shows that high titers of anti-Salmonella IgG are produced by infected birds from 5 weeks postinfection onwards, in common with S. Typhimurium infection of mice. The high antibody titer indicates that a strong humoral response is driven by S. Pullorum infection to eliminate extracellular pathogens (9). High levels of maternal antibody to S. Pullorum in eggs from some infected hens have been detected. These antibodies are more likely to prevent multiplication of the bacteria within the eggs, increasing the chance of embryo survival and the hatching rate of infected chicks (9, 10). It has also been demonstrated that the antibody responses appear to be unaffected by the onset of sexual maturity in chickens (10). Although the strong humoral response has no effect in clearing intracellular bacteria, it plays an important role in preventing the disease from deteriorating and protecting the host from a new Salmonella infection.

Due to the importance of the antibody response in S. Pullorum infection, we applied the in vivo-induced (IVI) antigen technology (IVIAT) to screen out the antigens immunoreactive with convalescent-phase sera, which had been adsorbed against antigens expressed in vitro in S. Pullorum and Escherichia coli organisms. In this study, 45 putative IVI antigens were identified, and 11 genes were randomly selected for analysis by real-time PCR to confirm their upregulation in vivo. Furthermore, four antigens were selected and applied to clinical detection of S. Pullorum in 28 serum samples from S. Pullorum-infected chickens.

MATERIALS AND METHODS

Bacterial strains and plasmids.

Genomic DNA from S. Pullorum strain S06004 was used to construct a protein expression library. The S06004 strain is a nalidixic acid (Nal)-resistant clinical isolate obtained in 2006 from chickens with pullorum disease in the Jiangsu Province of China (11). E. coli DH5α and E. coli BL21(DE3) were used for plasmid cloning and recombinant protein expression, respectively. All strains were grown in vitro in Luria-Bertani (LB) medium and maintained at −70°C in LB medium containing 15% glycerol. Kanamycin (Km) and Nal were used at concentrations of 50 μg/ml and 30 μg/ml, respectively.

Construction of genomic expression libraries of strain S06004.

Genomic expression libraries were constructed by using pET30abc expression vectors (Novagen, Germany), which allow the cloning of inserts in each of three possible reading frames to generate fusion proteins under transcriptional control of a T7 promoter. Plasmid DNA was digested with BamHI and treated with calf intestinal alkaline phosphatase (TaKaRa, Japan). Genomic DNA from S. Pullorum strain S06004 was partially digested with Sau3AI, and fragments of 0.5 to 2.0 kb were gel purified. Then, each of the three vectors was separately ligated with the genomic DNA fragments to create three expression libraries, and each was transformed into E. coli DH5α and spread on LB plates containing Km. After overnight incubation at 37°C, colonies on the plates were collected by scraping, and plasmid DNA was purified by using a Qiagen plasmid midikit (Qiagen, Germany). Subsequently, the plasmid mixture was transformed into E. coli BL21(DE3) to generate genomic expression libraries. The resulting libraries were then assessed by PCR amplification of a random sample to determine the frequency and sizes of the inserts, and only libraries with >80% of the fragments falling between 0.5 and 2.0 kb were used in subsequent screening assays.

Convalescent-phase sera and control sera.

We obtained convalescent-phase sera from 10 individuals presenting to the Poultry Institute, Chinese Academy of Agricultural Sciences. In addition, S. Pullorum-positive sera were prepared from 3-week-old specific-pathogen-free (SPF) chickens immunized with strain S06004 whole-cell bacteria (1 × 109 CFU each taken orally). The titer of antibody against the strain was monitored by indirect enzyme-linked immunosorbent assay (ELISA) every week after challenge. Five convalescent-phase serum samples were collected from the recovered chickens and kept frozen at −20°C for IVIAT selection. The negative-control sera were obtained from healthy SPF chickens negative by ELISA and used as the negative control for IVIAT or ELISA.

Adsorption of sera.

Equal volumes of 15 convalescent-phase serum samples were pooled and extensively adsorbed with in vitro-grown S. Pullorum S06004 and with the expression host strain E. coli BL21(DE3). The serum adsorption protocol consisted of serial stages using S. Pullorum and E. coli whole cells, followed by adsorption with nondenatured and heat-denatured cell lysates as described previously (12). To assess the efficacy of each adsorption step, a 10-μl aliquot of serum from each step was analyzed with ELISA against whole S06004 cells and cell lysates.

Screening the antigenic proteins expressed in vivo by S. Pullorum.

Immunoscreening was used to screen the genomic expression libraries as described previously (13). First, an aliquot of each library was diluted and spread on LB plates containing Km to achieve approximately 500 colonies per plate. After overnight incubation at 37°C, the colonies on the plates were lifted onto a nitrocellulose membrane and then plated onto LB plates containing Km and isopropyl-β-d-thiogalactoside (IPTG; 1 mM) to induce expression of insert DNA at 37°C. After 4 h of incubation, the membrane was placed on chloroform-soaked blotting paper for 15 min to partially lyse the bacteria and release the expressed proteins. The membrane was removed and blocked with 5% skim milk before being subsequently incubated overnight with adsorbed sera at a 1:1,000 (vol/vol) dilution at room temperature. The clones that reacted with serum antibodies were detected using peroxidase-conjugated rabbit anti-chicken IgY (IgG) antibody (Sigma) at a 1:1,000 dilution, and immunoblots were developed using an enhanced chemiluminescence (ECL) kit (Thermo). The reactive clones were recovered from the master plates and confirmed to be immunoreactive to the adsorbed sera compared to the reactivity of E. coli BL21(DE3) containing pET30 vectors with no insert in a whole-colony immunoblot assay. Plasmids in positive clones were purified and sequenced for the DNA inserts by using pET30-specific primers (12).

Prediction of function of antigens identified by IVIAT.

Homology analysis of screened sequences was performed using the NCBI BLAST program (http://blast.ncbi.nlm.nih.gov). Functional classification was based on published studies for S. enterica and predictive models using the Clusters of Orthologous Groups database (http://www.ncbi.nlm.nih.gov/COG/) and the Pfam database (http://www.sanger.ac.uk/Software/Pfam). The cellular localizations of these proteins were predicted using the PSORTb, v20, program (http://www.psort.org/psortb/).

Gene expression analysis by quantitative real-time PCR.

Gene expression was tested by subjecting the RNA of the bacteria recovered from infected chickens to quantitative real-time PCR, and the results were compared to those obtained for bacteria grown under laboratory conditions. The in vitro culture used for RNA extraction was obtained by overnight cultivation of strain S06004 in LB broth. Three-week-old SPF Hailand chickens were inoculated intravenously with S06004 in order to analyze their gene expression under in vivo conditions. As our previous study showed that it is difficult to isolate and purify enough bacterial RNA from Salmonella Pullorum-infected chicken tissues, including liver and spleen, when S. Pullorum is inoculated through the oral route, we chose intravenous inoculation for isolation of RNA from bacterial pathogens in blood. Blood samples from 15 to 20 chickens were collected at 24 h and 48 h postinoculation (p.i.), centrifuged at 2,000 rpm to remove blood cells, and then repelleted at 12,000 rpm to collect bacterial cells. Total bacterial RNA was isolated using an RNAprep bacterial kit (Tiangen, China) and treated with RNase-free DNase I (TaKaRa, Japan). Reverse transcription (RT) of DNase I-treated RNA to cDNA was conducted by using a PrimeScript RT reagent kit (Perfect Real Time; TaKaRa, Japan) according to the manufacture's instruction. Two negative controls, one with no RNA template and the other without reverse transcriptase, were used for cDNA synthesis and DNase I treatment.

Quantitative real-time PCR (qPCR) was performed by using a 7500 system (ABI), employing SYBR Premix Ex Taq II (Perfect Real Time; TaKaRa, Japan). The qPCR was performed in a final volume of 20 μl containing 12 μl Premix Ex Taq II, 0.8 μl of each primer, 0.4 μl carboxy-X-rhodamine reference dye II, 2 μl cDNA template, and 6 μl double-distilled water (ddH2O). The qPCR protocol was as follows: hot start at 95°C for 30 s, followed by 45 cycles of 95°C for 5 s and 60°C for 34 s. To normalize the results of quantification of the test genes, the gmk housekeeping gene was used as a control. On the basis of the functional classification of all these 45 proteins, 11 genes were selected for the PCR analysis, and the primers designed are listed in Table 1. All templates were examined in triplicate, and nontemplate controls were additionally included. The results of qPCR were calculated by determination of the 2−ΔΔCT (where CT is the threshold cycle) (relative expression [RE]) level.

Table 1.

Primers used for real-time PCR analysis

Gene Primer code Primer sequence (5′–3′) Annealing temp (°C) Size of PCR product (bp)
traV traVU ACGAACTCCGACTTTGAATG 55.0 105
traVL CTTTACCGTCTCAGGTTGCT 54.6
trkH trkHU TTCTTATCGTGGTGCTGTTC 53.4 178
trkHL AAGAGAATGGCGTGCGGT 58.5
gatD gatDU GTCAGCGGGATGATTTGC 56.5 101
gatDL TCGTCCAACGCCATCAGTA 57.7
pbpC pbpCU CGCTCGCTGAATCTGCCT 59.4 209
pbpCL AGTTTCGCCGCTTTCCCA 61.3
emrB emrBU CAGGCTGGTCACGTTCAG 54.5 163
emrBL GGAGAGCGTAATGGTGGTC 54.9
dapA dapAU ATAATGTGCCGTCCCGTA 54.1 97
dapAL CCTGTCGCCTCTTTGATAG 53.0
adhE adhEU GGTATGGGCATCGTGGAAG 58.3 101
adhEL TCAGACAGCACACCGCAG 56.0
stbC stbCU ATGCCAATAGCAACCAGAGC 57.8 102
stbCL CGCCCAGCGACAGAATAC 57.0
yhaN yhaNU CGACACTATCGCAATGGCTA 57.2 173
yhaNL CCACAATCCCTTCGTTTCC 57.5
deoR deoRU TGCTGGAAGTTTCGGTGATG 59.2 126
deoRL GCGGCATATTGGTTGAAGAC 58.1
phoQ phoQU TACCCTACGACCAGGACAAG 55.0 149
phoQL CCTCTTTCTGTGTGGGATGC 57.6
gmk gmkU TTGGCAGGGAGGCGTTT 59.1 65
gmkL GCGCGAAGTGCCGTAGTAAT 60.6

Evaluation of serum IgG responses to purified ShdA, PhoQ, Cse3, and PbpC by Western blotting using convalescent-phase sera from different Chinese chicken lines infected by S. Pullorum.

To identify the immunoreactivity of the IVI proteins, four genes, shdA, phoQ, cse3, and pbpC, were selected and expressed as S-tagged fusion proteins. The primer sequences designed are listed in Table 2. We cloned the whole open reading frames (ORFs) of cse3 and pbpC into the pET30a(+) expression vector. The functional C-terminal 280 amino acids of the predicted ShdA sequence and the C-terminal 272 amino acids of PhoQ were cloned for expression. The expression of four proteins in E. coli BL21(DE3) was induced with 1 mM IPTG at 37°C. The ShdA-containing cells were lysed by sonication and purified using an Ni-nitrilotriacetic acid (NTA) His·Bind purification kit (Novagen, Germany) under nondenaturing conditions to obtain a final 35.9-kDa product. The fused proteins Cse3, PhoQ, and PbpC were purified under denaturing conditions to yield 31.1-kDa, 36.6-kDa, and 87.5-kDa proteins, respectively. Immune responses to the purified proteins in 28 convalescent-phase serum samples from four chicken lines confirmed to be infected by S. Pullorum were evaluated by Western blotting. In this study, serum was used at a 1:1,000 dilution. The immune responses to peroxidase-conjugated rabbit anti-chicken IgG at a dilution of 1:1,500 and 3,3′-diaminobenzidine (DAB; Sigma) substrate were used for detection.

Table 2.

Primers used for expression of four IVI proteins

Gene Primer code Primer sequence (5′–3′) Size of PCR product (bp)
cse3 cse3F CCATGGGCATGTATCTCTCAAGAATAAC 661
cse3R CTCGAGGTCGTCTCCGGGTTTG
phoQ phoQF CAGAATTCGGAGCTTACGCCCTATCGAG 831
phoQR GCCTCGAGTTCCTCTTTCTGTGTGGGA
pbpC pbpCF AGGAATTCGCTCAATGAGGTCCAT 2217
pbpCR TACTCGAGATTCAAAATTAACCGCAGC
shdA shdAF GAGAATTCGGCCGATGGCAGCGTATGG 827
shdAR CGCTCGAGCAGATCGCCAAAGTCATTGC

Animal protocols. All animal experimental protocols were approved by the institute and carried out according to the guidelines established by the Ministry of Science and Technology (Beijing, China).

RESULTS

Identification of S. Pullorum antigens by IVIAT.

An inducible expression library containing approximately 150,000 clones was used for screening; 325 immunoreactive clones were selected during the primary screening. Following the second round of screening, a total of 56 clones remained and a strong positive reaction with the adsorbed sera was identified. Plasmids in these clones were extracted and sequenced to identify the inserted DNA fragments. Sequence analysis showed that most positive clones expressed only a portion of the genes. The weight of the expressed fusion protein speculated by the DNAStar program according to the sequenced DNA fragments was confirmed by SDS-PAGE analysis. However, some positive clones carried multiple expressible ORFs, which were also identified by SDS-PAGE. All these 56 clones encoded 45 unique proteins; therefore, some clones encoded the same proteins. The 45 putative in vivo-induced antigens are listed in Table 3. The functions of the genes identified by IVIAT were predicted by BLAST analysis with the NCBI protein database. According to the function analysis, these 45 IVI proteins were classified into seven categories: molecular biosynthesis and degradation, transport, metabolism, regulator, cell wall synthesis and antibiotic resistance, environmental adaptation, and phage-related and putative functions. Some of these proteins have been proven to play an important role in virulence. Protein PhoQ, a component of the PhoP/PhoQ regulation system, has been proven to be involved in regulating expression of many virulence-related proteins in many Gram-negative bacteria (14, 15). Protein ShdA is a host colonization factor required for the persistence of the pathogen in the host intestine. Protein TraV, a component of the type IV secretion system (T4SS), is a plasmid conjugative transfer pilus assembly protein (16). The T4SS is located in Salmonella virulence plasmids and encodes many virulence proteins involved in the pathogenesis of the bacteria.

Table 3.

Proteins identified by IVIAT in S. Pullorum

General function and IVIAT-selected clone Gene/protein/specific function Bacterial cell sublocalization
Molecular biosynthesis and degradation
    P3 pyrB/aspartate carbamoyltransferase catalytic subunit/pyrimidine biosynthesis, belongs to the aspartate carbamoyltransferase/ornithine transcarbamylase family Cytoplasm
    P24 dapA/dihydrodipicolinate synthase/lysine biosynthesis, diaminopimelate biosynthesis Cytoplasm
    P32 gltB/glutamate synthase (NADPH) large chain precursor/glutamate biosynthetic process Cytoplasm
    P41 SSPA1281/GlpM family protein/alginate biosynthesis Cytoplasmic membrane
    P42 treY/malto-oligosyltrehalose synthase Cytoplasm
    P28 rep/ATP-dependent DNA helicase/DNA replication and repair Cytoplasm
Transport
    P30 SPUL_0726/amine ABC transporter/periplasmic amine-binding protein Cytoplasmic membrane
    P8 kefA/potassium efflux protein/participates in the regulation of osmotic pressure changes within the cell, potassium ion transport Cytoplasmic membrane
    P9 trkA/potassium transport protein/part of the constitutive potassium transport systems trkG and trkH, required for resistance to antimicrobial peptides, potassium ion transport Cytoplasmic membrane
    P13 oppC/oligopeptide transporter subunit/membrane component of ABC superfamily, part of the binding-protein-dependent transport system for oligopeptides, peptide and protein transport Cytoplasmic membrane
    P23 malX/PTS, maltose- and glucose-specific IIBC component/phosphoenolpyruvate-dependent sugar PTS, sugar transport Cytoplasmic membrane
    P26 trkH/trk system potassium uptake protein/belongs to the trkH potassium transport family, potassium ion transport Cytoplasmic membrane
    P39 setB/sugar efflux transporter B/belongs to the major facilitator superfamily SET transporter family, sugar transport Cytoplasmic membrane
Metabolism
    P4 gatD/galactitol-1-phosphate dehydrogenase/oxidation reduction, belongs to the zinc-containing alcohol dehydrogenase family Cytoplasm
    P35 narV/nitrate reductase 2, gamma subunit Cytoplasmic membrane
    P15 adhE/fused acetaldehyde CoA dehydrogenase, iron-dependent alcohol dehydrogenase, pyruvate-formate lyase deactivase Cytoplasm
    P36 yncB/putative NADP-dependent oxidoreductase Cytoplasm
    P44 agp/glucose-1-phosphatase/inositol phosphatase Periplasm
    P27 hypF/(NiFe) hydrogenase maturation protein/acylphosphatase activity, transcription regulator activity Cytoplasm
    P37 folE/GTP cyclohydrolase I/belongs to the GTP cyclohydrolase I family, one-carbon metabolic process, tetrahydrofolate biosynthetic process Cytoplasm
    P38 aceF/dihydrolipoamide acetyltransferase/dihydrolipoyllysine residue acetyltransferase activity Cytoplasm
Regulator
    P5 SG3640/putative DeoR-family transcriptional regulator Unknown
    P7 gatR/galactitol utilization operon transcriptional repressor Cytoplasm
    P33 phoQ/sensor protein PhoQ/virulence sensor histidine kinase Cytoplasmic membrane
Cell wall synthesis and antibiotic resistance
    P6 mrcB/PBP 1b/peptidoglycan glycosyltransferase, cell wall biogenesis or degradation, peptidoglycan synthesis Cytoplasmic membrane
    P19 pbpC/PBP 1c/peptidoglycan biosynthetic process, cell wall biogenesis or degradation Cytoplasmic membrane
    P20 emrB/multidrug resistance protein B/translocase that confers resistance to substances of high hydrophobicity; antibiotic resistance, transport Cytoplasmic membrane
    P22 lpxD/UDP-3-o-(3-hydroxymyristoyl) glucosamine N-acyltransferase/lipid A biosynthesis, antibiotic resistance; belongs to the transferase hexapeptide repeat family, lpxD subfamily Cytoplasmic membrane
Environmental adaptation
    P21 cse3/CRISPR-associated protein, Cse3 family/allows acquisition of resistance against bacteriophage, RNA interference-like mechanism Unknown
    P2 yhjJ/putative Zn-dependent peptidase, metalloendopeptidase activity, belongs to the peptidase M16 family Periplasm
    P11 traV/type IV conjugative transfer system protein/plasmid transfer protein Cell outer membrane
    P17 yaeJ/putative tRNA hydrolase domain protein/hydrolase, translational termination Unknown
    P25 cstA/carbon starvation protein A/cellular response to starvation Cytoplasmic membrane
    P31 dnaJ/DNA damage-inducible protein, actively participates in the response to hyperosmotic and heat shock by preventing aggregation of stress-denatured proteins and disaggregating proteins Cytoplasm
    P34 ybeS/putative molecular chaperone/DnaJ family Unknown
    P40 shdA/succinate dehydrogenase flavoprotein subunit, host colonization factor Cell outer membrane
    P43 stbC/outer membrane fimbrial usher protein/involved in biosynthesis of pilus in Gram-negative bacteria Cell outer membrane
Putative function
    P16 STM0479/putative transposase Cytoplasm
    P18 gpV/baseplate assembly protein V Unknown
    P1 SeAq_B0585/hypothetical protein Unknown
    P10 yeaL/putative inner membrane protein Cytoplasmic membrane
    P12 yhaN/hypothetical protein Cytoplasm
    P14 STM1542/putative zinc-binding dehydrogenase Cytoplasmic membrane
    P29 yqiK/putative uncharacterized protein Cytoplasmic membrane
    P45 SARI_04264/hypothetical protein Cytoplasmic membrane

Comparison of IVI proteins identified in S. Pullorum to proteins screened from other S. enterica serovars or bacteria by IVIAT.

Of the 45 proteins identified in this study, many proteins were screened from other Gram-negative and Gram-positive bacteria by IVIAT (12, 17–21), such as ShdA in S. Typhi, PhoQ and FolE in E. coli O157:H7, and AdhE in E. coli CFT073 (a uropathogenic E. coli [UPEC] strain). In addition, some genes with similar function or involved in the same pathway were identified in these pathogens. The proteins implicated in general metabolic processes essential for bacterial survival were screened from these bacteria. Both AdhP and AdhE represent enzymes involved in acetyl coenzyme A (acetyl-CoA) metabolism, hydrogenase, and additional respiratory components related to the reduction of nitrate (20). Penicillin-binding proteins 1c (PBP 1c) and PBP 1a are penicillin-binding proteins involved in peptidoglycan synthesis and are essential for cell morphology and division. Mutation of pbp1A in group A streptococci reduced the bacterial survival rate in the host cells (17). TraV and TraG belong to the T4SS involved in plasmid transfer. Interestingly, diverse ABC-type transporters involved in the transport of different biological molecules were identified as IVI proteins in all these six pathogens. In addition, the transporters belonging to the phosphotransferase system (PTS), involved in the transport of small molecules, were also identified in most of these pathogens by IVIAT.

Analysis of IVI gene expression during in vivo infection.

Quantitative real-time PCR was used to verify the identified genes that were expressed or upregulated in vivo. Of the 45 putative IVI genes, 11 (traV, gatD, pbpC, stbC, deoR, emrB, dapA, phoQ, trkH, adhE, yhaN) were selected for further analysis of gene expression by real-time PCR. These genes were randomly chosen according to their function, such as involvement in cell metabolism, regulation, antibiotic resistance, and transport, in order to maximize the variety of genes. In addition, the guanylate kinase (gmk) gene was chosen as the reference (22, 23). The expression levels of these genes were tested under in vivo conditions (challenge with bacterial cells via intravenous inoculation and measurement of gene expression at 24 h and 48 h). The data were compared to results for RNA extracted from strain S06004 cultured in vitro under the same conditions initially used to adsorb the sera. As shown in Fig. 1, 9 of 11 genes detected were expressed in vivo under the conditions tested. With the exception of stbC and traV, which were expressed at 24 h but not at 48 h, the other nine genes were expressed at both stages postinoculation in vivo. Of the 11 analyzed genes, the type III secretion system regulator phoQ showed the highest level of expression compared to its level of expression in vitro. Six other genes, namely, pbpC, deoR, trkH, yhaN, gatD, and emrB, were obviously upregulated during in vivo infection relative to the level of expression of the corresponding gene in vitro.

Fig 1.

Fig 1

In vivo gene expression at 24 h and 48 h relative to the expression in vitro by real-time PCR analysis. SPF Hailand chickens were inoculated intravenously with strain S06004, and bacterial cells recovered from blood at 24 h and 48 h were considered in vivo-grown bacteria. Then, the total bacterial RNA was extracted and analyzed by real-time PCR, and gene expression in vivo was compared with gene expression in vitro. Total bacterial RNA extracted from strain S06004 grown in LB broth medium under the same conditions initially used to adsorb the sera was considered the template to assay the in vitro expression levels of the 11 identified genes. The gene expression level was determined by comparing the in vivo RNA expression with in vitro expression. The standard deviations for two chickens each are presented for blood collected at 24 h and 48 h.

Evaluation of immune responses to four IVI proteins: ShdA, PhoQ, Cse3, and PbpC.

Among the 45 IVI proteins identified, ShdA and PhoQ have been proved to be virulence factors in Salmonella. PbpC has a potential role in antibiotic resistance, and Cse3 was confirmed to be a component of the bacterial immune system with activity against bacteriophages. To evaluate the antigenic reactivity of the proteins identified by IVIAT, these four IVI proteins were selected for further analysis. First, the four proteins were expressed in E. coli BL21(DE3) and purified using an Ni-NTA His·Bind purification kit. SDS-PAGE analysis showed that there was only one specific band for purified proteins ShdA, PhoQ, and Cse3, but the purified PbpC had some nonspecific bands representing proteins with sizes smaller than the size of the band of interest. Twenty-eight clinical serum samples were then used to detect their immunoreactivity. Among the four IVI proteins, ShdA showed the strongest immunoreactivity to the serum samples (Fig. 2). Western blot analysis revealed that the ShdA antibody was detected in 23/28 (82%) serum samples, PhoQ antibody was detected in 19/28 (68%) samples, PbpC antibody was detected in 18/28 (64%) samples, and Cse3 antibody was detected in only 16/28 (57%) samples.

Fig 2.

Fig 2

Detection by Western blotting of the immunoreactivity to four IVI proteins in clinical serum samples infected by S. Pullorum. The four IVI proteins (ShdA, PhoQ, Cse3, and PbpC) were expressed in E. coli BL21(DE3) and purified using an Ni-NTA His·Bind purification kit. The responses of the clinical serum samples to these proteins were visualized by Western blotting. Results for 14 of the 28 clinical serum samples tested in this study are shown. The rate of reactivity to ShdA was the highest among the reactivities to the four proteins in this assay. an, bai, qing, and xian, Chinese chicken lines AnKa, BaiEr, QingYuanMa, and XianJu, respectively. The number following the chicken line reflects the different convalescence-phase serum samples that we obtained from the different infected chickens.

DISCUSSION

S. Pullorum is the main cause of considerable economic importance in the poultry industry, particularly in developing countries with a poultry industry. The pathogen not only can cause high mortality rates among young chicks but also persists for a long period in the spleen and the reproductive tract, leading to the infection of eggs or progeny (24). Although the high titers of circulating antibodies that are present cannot clear the pathogens residing in macrophages, these antibodies still play an important role in eradicating extracellular bacteria, and maternal antibody may prevent multiplication of the bacteria within the eggs. IVIAT is a useful method allowing us to identify the bacterial immunogenic proteins involved in S. Pullorum infection and helping us to develop new diagnostic targets or measures to control pullorum disease (25, 26).

In this study, 45 IVI proteins participating in different pathways of bacterial survival and infection were identified. After comparison with IVI proteins screened in other pathogens and identification by real-time PCR, some proteins showed significant importance and a potential role in S. Pullorum infection.

Virulence-related proteins.

Among the virulence-related IVI proteins, four proteins were reported to play a role in Salmonella virulence. Protein ShdA, which is a succinate dehydrogenase flavoprotein subunit, is a host colonization factor (27, 28). The shdA gene is known to be required for the persistence of S. Typhimurium in the murine cecum and for efficient and prolonged shedding of the organism within the feces. The protein was not expressed when S. Typhimurium was cultivated under standard conditions in vitro, but the pathogen was detected with anti-ShdA antiserum in thin sections from the ceca of mice infected with S. Typhimurium (28). Further analysis showed that ShdA is a surface-localized, fibronectin-binding protein whose expression is induced in vivo in the murine cecum. Homology analysis showed that ShdA is a member of the autotransporter family, as the conserved C terminus is predicted to form a pore through which a passenger domain involved in binding host macromolecules is transported to the bacterial surface (28, 29). In this study, we expressed the C-terminal sequence and identified its immunoreactivity to sera from chickens infected by S. Pullorum. The results showed that anti-ShdA IgG was detectable in 82% of clinical serum samples, indicating that the protein may be a very strong antigenic determinant during S. Pullorum infection. Interestingly, the protein was also identified as an IVI protein in another host-restricted Salmonella serotype Typhi strain by IVIAT analysis (12). However, the potential diagnostic significance of anti-ShdA immune responses requires further evaluation.

Another virulence-related protein, PhoQ, belongs to members of the PhoP-PhoQ two-component regulatory system family (14). PhoQ is a membrane-bound sensor kinase that phosphorylates PhoP to either activate or repress target gene transcription. The PhoP/PhoQ system regulates several pathogenic properties of Salmonella spp., including adaptation to a low-Mg2+ and a low-pH environment, survival within macrophages, entrance into epithelial cells, and bacterium-induced immunosuppression (15, 30, 31). The system governs expression of at least 40 genes, which constitute approximately 1% of the genes in the Salmonella genome (15). The PhoP-activated gene pagC regulated by the PhoP/PhoQ system was identified as an IVI virulence protein in S. Typhi, and the PagC antibody was detected in sera from 11 of 14 patients, which shows that it has the potential to be developed as a diagnostic antigen (12). Interestingly, PhoQ was also confirmed to be an IVI protein of E. coli O157:H7, as identified by the use of IVIAT (18). In this study, PhoQ was detected in 68% of serum samples, which implies that the protein is not an ideal diagnostic antigen candidate or that the N-terminal amino acids that we did not express have the potential to be antigenic determinants. However, the real-time PCR results confirmed that a high level of PhoQ expression in vivo (Fig. 1) is required for expression of many effector proteins during the infection process.

Another two virulence-related proteins identified were DnaJ and YbeS, which belong to the DnaJ family. DnaJ (HSP40) is a chaperone of S. Typhimurium needed for the invasion of epithelial cells and survival within macrophages. The protein forms a chaperone machinery with cochaperones DnaK and GrpE and is involved in many cellular responses, such as DNA replication, protein transport, autoregulation of heat shock responses, and so on. The chaperone machinery can help many unfolded proteins with proper folding and mediate the degradation of misfolded proteins (32). Immunization of DnaJ protected 70% of mice against lethal challenge by S. Typhimurium infection, indicating the possible use of DnaJ as a candidate vaccine against typhoid (33).

Proteins involved in macromolecular biosynthesis and metabolism.

Proteins involved in biosynthesis and metabolism are essential for bacterial survival and growth in vivo, a feature imperative for bacterial infection. Many enzymes involved in fermentation of carbon compounds were identified, such as adhE, which is expressed under anaerobic conditions and plays an essential role in alcoholic fermentation (34). However, the real-time PCR did not detect the expression of adhE (Fig. 1), because the bacteria that we isolated were from blood. Interestingly, AdhE and/or another alcohol dehydrogenase, AdhP, was identified in E. coli by IVIAT (18, 21), and the adhP of UPEC displayed substantial upregulation in human urine (21). So, it is speculated that adhE or adhP is expressed under anaerobic conditions in vivo. IVIAT also indentified enzymes involved in the synthesis of cell molecules, including amino acids, pyrimidine, and alginate. These results are consistent with those discovered using IVIAT with other organisms (12, 17–21), including identical proteins and proteins with a similar function, such as folE, which is a GTP cyclohydrolase I essential for folate synthesis (35), and narV, narY, and narW, which are located in the narZYWV locus encoding nitrate reductase 2 and are involved in the biochemical reaction of reducing nitrate (36).

We were also intrigued by the observation that four identified IVI proteins were predicted to be involved in cell wall synthesis and antibiotic resistance. Among these proteins, the two proteins MrcB and PbpC represent PBP 1b and PBP 1c, respectively. Penicillin-binding proteins are a broad group of membrane-associated macromolecules involved in peptidoglycan biosynthesis, cell wall development, cell division, and antibiotic resistance (37, 38). E. coli PBP 1b is a bifunctional transglycosylase (TG) containing TG and transpeptidase (TP) domains (39). TP is the target for the two most important classes of antibiotics: β-lactams (e.g., penicillin and methicillin) and glycopeptides (e.g., vancomycin). Furthermore, TG is a multidomain membrane protein essential for cell synthesis, meaning that the protein is an excellent target for the development of new antibiotics (40). PBP 1c is a penicillin-insensitive protein whose synthesis is required for the initiation of cell division. The involvement of PBP 1c in the formation or discrete modification of the septal and the lateral peptidoglycan wall of E. coli has been confirmed, and it may play a role in mediating the bacterium-host interaction in Pasteurella multocida and Brucella abortus (41). With the help of these proteins, bacteria undergo morphological transformations in response to starvation, stress, or host environmental changes. In this study, the normal antibody detection rate (64%) of PbpC showed that the protein was an important factor involved in S. Pullorum infection, and it has the potential to be developed for use in the prevention or therapy of pullorum disease. EmrB is a membrane translocase with 14 suggested transmembrane domains and homology to the major facilitator superfamily (MFS) transporters (42). The EmrAB-TolC complex, comprised of EmrB, EmrA, and TolC, is a tripartite efflux system responsible for the export of drugs in Gram-negative bacteria. EmrB contains multiple drug binding sites for the direct transport of drugs from the cytoplasm to the exterior of the cell (43). LpxD is an acyltransferase catalyzing lipid A biosynthesis and is a target for new antibiotic development (42). Mutation of lpxD is known to confer hypersensitivity to hydrophobic antibiotics, such as rifampin. Without LpxD, the bacteria fail to grow because they are not able to make lipid A, and the cells might accumulate the LpxC product, UDP-3-O-(acyl)-GlcN, which is toxic; therefore, LpxD was considered a superior target for antibiotic design (42). Apparently, these four IVI proteins are closely related to peptidoglycan metabolism, which is essential for bacterial integrity and shape in host cells and the environment. As the prevalence of antibiotic resistance is a considerable threat in the control of S. Pullorum, these proteins could be new antibiotic targets.

Another protein that attracted our attention is related to Stb fimbrial synthesis. stbC encodes an outer membrane fimbrial usher protein for Stb fimbrial synthesis (44). Interestingly, the adjacent gene of stbC, stbD, was confirmed to be an IVI gene in S. Typhi (12). In addition, both stbC and stbD were identified to be virulence-related genes in S. Typhimurium by signature-tagged mutagenesis. Mutation of stbC or stbD in S. Typhimurium attenuated the pathogenicity of the pathogen in pigs, further demonstrating that the two genes play an important role in Salmonella infection (45).

Transport protein family screened from almost all pathogens studied until now by IVIAT.

The transport protein family includes diverse ABC-type transporters, PTSs, and transport proteins involved in the transport of various molecules. Both KefA and TrkH belong to mechanosensitive channels playing an essential role in the regulation of turgor pressure in bacteria (46, 47). KefA is a potassium efflux protein participating in the regulation of osmotic pressure changes within the cell (47). The trk potassium uptake system proteins TrkA and TrkH are required for resistance to antimicrobial peptides and Salmonella infection, including epithelial cell invasion and the expression and secretion of effector proteins of the SPI1-encoded T3SS (46). Upregulation of trkH confirmed that the gene is expressed in vivo and could be further analyzed for its potential role in S. Pullorum invasion (Fig. 1). MalX, which belongs to the PTS transporters, is a maltose- and glucose-specific IIBC component involved in sugar transport and has been confirmed to be a virulence determinant related to the persistence of E. coli strains in the intestinal microbiota (48). SetB, which belongs to the MFS, is an efflux transporter for sugars, such as lactose and glucose (49). OppC, part of the binding-protein-dependent transport system (oppABCD) for oligopeptide transport, belongs to the ABC-type superfamily of transporters (50). Another peptide transporter, CstA, assists the cell in escaping carbon starvation. Glucose depletion caused the 6-fold higher expression of CstA, which helps the cell respond to environmental stresses (51). TraV, located in a plasmid harboring type IV pilus biogenesis proteins, is required for various processes of conjugation, including pilus formation, conjugative DNA transfer, and regulation of transfer gene expression (52). All these transport proteins play important roles in different processes of bacterial survival and infection in the host.

Regulators.

Different regulators participate in the expression of diverse genes and help the cell adapt to the changing environment. Besides the regulator of virulence determinants PhoQ, two other regulators were identified as IVI proteins. The first belongs to the DeoR family of transcriptional regulators. The DeoR-type regulators contain at least 14 members in E. coli, of which 7 have defined functions and the rest are defined on the basis of sequence similarities (53). These regulators act as repressors in sugar metabolism, but further study has revealed that some DeoR regulators are involved in the cell response to environmental stress, such as superoxide stress and osmotic upshift (54). The second is gatR, which encodes a transcriptional repressor for the gat operon, involved in galactitol metabolism. Another gat operon gene, gatD, which plays an important role in galactitol metabolism, was also screened out in this study, and qPCR analysis showed that the genes were upregulated at both 24 h and 48 h postinfection. The gene encodes an NAD-dependent galactitol-1-phosphate dehydrogenase converting galactitol-1-phosphate into d-tagatose 6-phosphate (55).

Proteins with putative functions.

Nine proteins were assigned to proteins with putative functions. In addition, one protein that attracted us was Cse3, which is related to the bacterial immune system that is considered a hot spot and that has been both reported and studied recently. Cse3 is a component of the cascade complex belonging to the CRISPR-Cas (CASS) system, which is confirmed to be involved in bacterial immunity against bacteriophages and other invading foreign DNA elements (56). As an endonuclease, Cse3 cleaves the precursor CRISPR RNA (pre-crRNA) transcript to yield effector RNAs, which can block the site in the DNA or RNA of foreign genetic elements (57, 58). Mutation of cse3 causes accumulation of pre-crRNA, indicating that the protein plays an important role in crRNA processing and CRISPR interference (58). Although the high degree of polymorphism of CRISPR has been used in the molecular typing of bacteria, the function of this CRISPR-Cas system in infection and immunity of pathogens is still unclear (59). In our study, antibody to the Cse3 protein was detected in 57% of serum samples, which implies that it is not an extremely ideal target for use in the diagnosis and therapy of S. Pullorum infection. However, the expression of Cse3 during the bacterium-host interaction presents a new question about the relationship between bacterial immunity and Salmonella infection.

In conclusion, IVIAT identified in S. Pullorum strain S06004 45 immunogenic bacterial proteins expressed in vivo and reactive with convalescent-phase sera from chickens infected with S. Pullorum. Some of these antigens have been identified to be IVI proteins in other Gram-negative bacteria (PhoQ, ShdA, and AdhE) and were confirmed to be virulence-related proteins (PhoQ and ShdA). The immunoreactivity of these proteins (ShdA, PhoQ, Cse3, and PbpC) to clinical serum samples implies that these antigens warrant focused evaluation for possible contributions to the host specificity of S. Pullorum infection and indicate that these proteins may be candidates for therapeutic antigens, vaccines, or diagnostic targets.

ACKNOWLEDGMENTS

This study was supported by the National High Technology Research and Development Program of China (2011AA10A212), the Key Program of National Natural Science Foundation of China (31230070), the National Natural Science Foundation of China (31201905), The 333 Project in Jiangsu Province (BRA2011141), and the Natural Science Fund for Colleges and Universities in Jiangsu Province (11KJB230002).

Footnotes

Published ahead of print 17 June 2013

REFERENCES

  • 1.Shivaprasad HL. 2000. Fowl typhoid and pullorum disease. Rev. Sci. Tech. 19:405–424 [DOI] [PubMed] [Google Scholar]
  • 2.Barrow PA, Freitas Neto OC. 2011. Pullorum disease and fowl typhoid—new thoughts on old diseases: a review. Avian Pathol. 40:1–13 [DOI] [PubMed] [Google Scholar]
  • 3.Davies RH, Wray C. 1995. Mice as carriers of Salmonella enteritidis on persistently infected poultry units. Vet. Rec. 137:337–341 [DOI] [PubMed] [Google Scholar]
  • 4.Davies RH, Wray C. 1995. The role of the lesser mealworm beetle (Alphitiobius diaperinus) in carriage of Salmonella enteritidis. Vet. Rec. 137:407–408 [DOI] [PubMed] [Google Scholar]
  • 5.Davies RH, Breslin M. 2003. Persistence of Salmonella enteritidis phage type 4 in the environment and arthropod vectors on an empty free-range chicken farm. Environ. Microbiol. 5:79–84 [DOI] [PubMed] [Google Scholar]
  • 6.Christensen JP, Olsen JE, Bisgaard M. 1993. Ribotypes of Salmonella enterica serovar Gallinarum biovars gallinarum and pullorum. Avian Pathol. 22:725–738 [DOI] [PubMed] [Google Scholar]
  • 7.Henderson SC, Bounous DI, Lee MD. 1999. Early events in the pathogenesis of avian salmonellosis. Infect. Immun. 67:3580–3586 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Eckmann L, Kagnoff MF. 2001. Cytokines in host defense against Salmonella. Microb. Infect. 3:1191–1200 [DOI] [PubMed] [Google Scholar]
  • 9.Wigley P, Berchieri A, Jr, Page KL, Smith AL, Barrow PA. 2001. Salmonella enterica serovar Pullorum persists in splenic macrophages and in the reproductive tract during persistent disease-free carriage in chickens. Infect. Immun. 69:7873–7879 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Wigley P, Hulme SD, Powers C, Beal RK, Berchieri A, Jr, Smith A, Barrow P. 2005. Infection of the reproductive tract and eggs with Salmonella enterica serovar Pullorum in the chicken is associated with suppression of cellular immunity at sexual maturity. Infect. Immun. 73:2986–2990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Geng SZ, Jiao XA, Pan ZM, Chen XJ, Zhang XM, Chen X. 2009. An improved method to knockout the asd gene of Salmonella enterica serovar Pullorum. J. Biomed. Biotechnol. 2009:646380. 10.1155/2009/646380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Harris JB, Baresch-Bernal A, Rollins SM, Alam A, LaRocque RC, Bikowski M, Peppercorn AF, Handfield M, Hillman JD, Qadri F, Calderwood SB, Hohmann E, Breiman RF, Brooks WA, Ryan ET. 2006. Identification of in vivo-induced bacterial protein antigens during human infection with Salmonella enterica serovar Typhi. Infect. Immun. 74:5161–5168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 14.Groisman EA. 2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol. 183:1835–1842 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kato A, Groisman EA. 2008. The PhoQ/PhoP regulatory network of Salmonella enterica. Adv. Exp. Med. Biol. 631:7–21 [DOI] [PubMed] [Google Scholar]
  • 16.Feng Y, Liu J, Li YG, Cao FL, Johnston RN, Zhou J, Liu GR, Liu SL. 2012. Inheritance of the Salmonella virulence plasmids: mostly vertical and rarely horizontal. Infect. Genet. Evol. 12:1058–1063 [DOI] [PubMed] [Google Scholar]
  • 17.Salim KY, Cvitkovitch DG, Chang P, Bast DJ, Handfield M, Hillman JD, de Azavedo JC. 2005. Identification of group A Streptococcus antigenic determinants upregulated in vivo. Infect. Immun. 73:6026–6038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.John M, Kudva IT, Griffin RW, Dodson AW, McManus B, Krastins B, Sarracino D, Progulske-Fox A, Hillman JD, Handfield M, Tarr PI, Calderwood SB. 2005. Use of in vivo-induced antigen technology for identification of Escherichia coli O157:H7 proteins expressed during human infection. Infect. Immun. 73:2665–2679 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hang L, John M, Asaduzzaman M, Bridges EA, Vanderspurt C, Kirn TJ, Taylor RK, Hillman JD, Progulske-Fox A, Handfield M, Ryan ET, Calderwood SB. 2003. Use of in vivo-induced antigen technology (IVIAT) to identify genes uniquely expressed during human infection with Vibrio cholerae. Proc. Natl. Acad. Sci. U. S. A. 100:8508–8513 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gu H, Zhu H, Lu C. 2009. Use of in vivo-induced antigen technology (IVIAT) for the identification of Streptococcus suis serotype 2 in vivo-induced bacterial protein antigens. BMC Microbiol. 9:201. 10.1186/1471-2180-9-201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vigil PD, Alteri CJ, Mobley HL. 2011. Identification of in vivo-induced antigens including an RTX family exoprotein required for uropathogenic Escherichia coli virulence. Infect. Immun. 79:2335–2344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.López-Garrido J, Casadesús J. 2010. Regulation of Salmonella enterica pathogenicity island 1 by DNA adenine methylation. Genetics 184:637–649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Thiennimitr P, Winter SE, Winter MG, Xavier MN, Tolstikov V, Huseby DL, Sterzenbach T, Tsolis RM, Roth JR, Bäumler AJ. 2011. Intestinal inflammation allows Salmonella to use ethanolamine to compete with the microbiota. Proc. Natl. Acad. Sci. U. S. A. 108:17480–17485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Shivaprasad HL, Barrow PA. 2008. Pullorum disease and fowl typhoid, p 620–634 In Saif YM, Fadley AM. (ed), Diseases of poultry, 12th ed. Iowa State University Press, Ames, IA [Google Scholar]
  • 25.Handfield M, Brady LJ, Progulske-Fox A, Hillman JD. 2000. IVIAT: a novel method to identify microbial genes expressed specifically during human infections. Trends Microbiol. 8:336–339 [DOI] [PubMed] [Google Scholar]
  • 26.Rollins SM, Peppercorn A, Hang L, Hillman JD, Calderwood SB, Handfield M, Ryan ET. 2005. In vivo induced antigen technology (IVIAT). Cell. Microbiol. 7:1–9 [DOI] [PubMed] [Google Scholar]
  • 27.Kingsley RA, van Amsterdam K, Kramer N, Baumler AJ. 2000. The shdA gene is restricted to serotypes of Salmonella enterica subspecies I and contributes to efficient and prolonged fecal shedding. Infect. Immun. 68:2720–2727 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kingsley RA, Santos RL, Keestra AM, Adams LG, Bäumler AJ. 2002. Salmonella enterica serotype Typhimurium ShdA is an outer membrane fibronectin-binding protein that is expressed in the intestine. Mol. Microbiol. 43:895–905 [DOI] [PubMed] [Google Scholar]
  • 29.Kingsley RA, Keestra AM, de Zoete MR, Bäumler AJ. 2004. The ShdA adhesin binds to the cationic cradle of the fibronectin 13FnIII repeat module: evidence for molecular mimicry of heparin binding. Mol. Microbiol. 52:345–355 [DOI] [PubMed] [Google Scholar]
  • 30.Navarre WW, Halsey TA, Walthers D, Frye J, McClelland M, Potter JL, Kenney LJ, Gunn JS, Fang FC, Libby SJ. 2005. Co-regulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ. Mol. Microbiol. 56:492–508 [DOI] [PubMed] [Google Scholar]
  • 31.Thompson JA, Liu M, Helaine S, Holden DW. 2011. Contribution of the PhoP/Q regulon to survival and replication of Salmonella enterica serovar Typhimurium in macrophages. Microbiology 157:2084–2093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Takaya A, Tomoyasu T, Matsui H, Yamamoto T. 2004. The DnaK/DnaJ chaperone machinery of Salmonella enterica serovar Typhimurium is essential for invasion of epithelial cells and survival within macrophages, leading to systemic infection. Infect. Immun. 72:1364–1373 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sagi SS, Paliwal P, Bansal A, Mishra C, Khan N, Mustoori SR, IIavazhagan G, Sawhney RC, Banerjee PK. 2006. Studies on immunogenicity and protective efficacy of DnaJ of Salmonella Typhi against lethal infection by Salmonella Typhimurium in mice. Vaccine 24:7135–7141 [DOI] [PubMed] [Google Scholar]
  • 34.Nnyepi MR, Peng Y, Broderick JB. 2007. Inactivation of E. coli pyruvate formate-lyase: role of AdhE and small molecules. Arch. Biochem. Biophys. 459:1–9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.El Yacoubi B, Bonnett S, Anderson JN, Swairjo MA, Iwata-Reuyl D, de Crécy-Lagard V. 2006. Discovery of a new prokaryotic type I GTP cyclohydrolase family. J. Biol. Chem. 281:37586–37593 [DOI] [PubMed] [Google Scholar]
  • 36.Blasco F, Iobbi C, Ratouchniak J, Bonnefoy V, Chippaux M. 1990. Nitrate reductases of Escherichia coli: sequence of the second nitrate reductase and comparison with that encoded by the narGHJI operon. Mol. Gen. Genet. 222:104–111 [DOI] [PubMed] [Google Scholar]
  • 37.Chambers HF. 1999. Penicillin-binding protein-mediated resistance in pneumococci and staphylococci. J. Infect. Dis. 179(Suppl 2):S353–S359 [DOI] [PubMed] [Google Scholar]
  • 38.Popham DL, Young KD. 2003. Role of penicillin-binding proteins in bacterial cell morphogenesis. Curr. Opin. Microbiol. 6:594–599 [DOI] [PubMed] [Google Scholar]
  • 39.Goffin C, Ghuysen JM. 1998. Multimodular penicillin-binding proteins: an enigmatic family of orthologs and paralogs. Microbiol. Mol. Biol. Rev. 62:1079–1093 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sung MT, Lai YT, Huang CY, Chou LY, Shih HW, Chen WC, Wong CH, Ma C. 2009. Crystal structure of the membrane-bound bifunctional transglycosylase PBP1b from Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 106:8824–8829 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Derouaux A, Wolf B, Fraipont C, Breukink E, Nguyen-Distèche M, Terrak M. 2008. The monofunctional glycosyltransferase of Escherichia coli localizes to the cell division site and interacts with penicillin-binding protein 3, FtsW, and FtsN. J. Bacteriol. 190:1831–1834 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kim HJ, Lee CR, Kim M, Peterkofsky A, Seok YJ. 2011. Dephosphorylated NPr of the nitrogen PTS regulates lipid A biosynthesis by direct interaction with LpxD. Biochem. Biophys. Res. Commun. 409:556–561 [DOI] [PubMed] [Google Scholar]
  • 43.Tanabe M, Szakonyi G, Brown KA, Henderson PJ, Nield J, Byrne B. 2009. The multidrug resistance efflux complex, EmrAB from Escherichia coli forms a dimer in vitro. Biochem. Biophys. Res. Commun. 380:338–342 [DOI] [PubMed] [Google Scholar]
  • 44.Chuang YC, Wang KC, Chen YT, Yang CH, Men SC, Fan CC, Chang LH, Yeh KS. 2008. Identification of the genetic determinants of Salmonella enterica serotype Typhimurium that may regulate the expression of the type 1 fimbriae in response to solid agar and static broth culture conditions. BMC Microbiol. 8:126. 10.1186/1471-2180-8-126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Carnell SC, Bowen A, Morgan E, Maskell DJ, Wallis TS, Stevens MP. 2007. Role in virulence and protective efficacy in pigs of Salmonella enterica serovar Typhimurium secreted components identified by signature-tagged mutagenesis. Microbiology 153:1940–1952 [DOI] [PubMed] [Google Scholar]
  • 46.Su J, Gong H, Lai J, Main A, Lu S. 2009. The potassium transporter Trk and external potassium modulate Salmonella enterica protein secretion and virulence. Infect. Immun. 77:667–675 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.McLaggan D, Jones MA, Gouesbet G, Levina N, Lindey S, Epstein W, Booth IR. 2002. Analysis of the kefA2 mutation suggests that KefA is a cation-specific channel involved in osmotic adaptation in Escherichia coli. Mol. Microbiol. 43:521–536 [DOI] [PubMed] [Google Scholar]
  • 48.Ostblom A, Adlerberth I, Wold AE, Nowrouzian FL. 2011. Pathogenicity island markers, virulence determinants malX and usp, and the capacity of Escherichia coli to persist in infants' commensal microbiotas. Appl. Environ. Microbiol. 77:2303–2308 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Liu JY, Miller PF, Willard J, Olson ER. 1999. Functional and biochemical characterization of Escherichia coli sugar efflux transporters. J. Biol. Chem. 274:22977–22984 [DOI] [PubMed] [Google Scholar]
  • 50.Weinberg MV, Maier RJ. 2007. Peptide transport in Helicobacter pylori: roles of dpp and opp systems and evidence for additional peptide transporters. J. Bacteriol. 189:3392–3402 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dubey AK, Baker CS, Suzuki K, Jones AD, Pandit P, Romeo T, Babitzke P. 2003. CsrA regulates translation of the Escherichia coli carbon starvation gene, cstA, by blocking ribosome access to the cstA transcript. J. Bacteriol. 185:4450–4460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Gilmour MW, Gunton JE, Lawley TD, Taylor DE. 2003. Interaction between the IncHI1 plasmid R27 coupling protein and type IV secretion system: TraG associates with the coiled-coil mating pair formation protein TrhB. Mol. Microbiol. 49:105–116 [DOI] [PubMed] [Google Scholar]
  • 53.Perez-Rueda E, Collado-Vides J. 2000. The repertoire of DNA-binding transcriptional regulators in Escherichia coli K-12. Nucleic Acids Res. 28:1838–1847 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Weber A, Jung K. 2002. Profiling early osmostress-dependent gene expression in Escherichia coli using DNA macroarrays. J. Bacteriol. 184:5502–5507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Nobelmann B, Lengeler JW. 1996. Molecular analysis of the gat genes from Escherichia coli and of their roles in galactitol transport and metabolism. J. Bacteriol. 178:6790–6795 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Brouns SJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJ, Snijders AP, Dickman MJ, Makarova KS, Koonin EV, van der Oost J. 2008. Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321:960–964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Gesner EM, Schellenberg MJ, Garside EL, George MM, Macmillan AM. 2011. Recognition and maturation of effector RNAs in a CRISPR interference pathway. Nat. Struct. Mol. Biol. 18:688–692 [DOI] [PubMed] [Google Scholar]
  • 58.Sashital DG, Jinek M, Doudna JA. 2011. An RNA-induced conformational change required for CRISPR RNA cleavage by the endoribonuclease Cse3. Nat. Struct. Mol. Biol. 18:680–687 [DOI] [PubMed] [Google Scholar]
  • 59.Hale CR, Majumdar S, Elmore J, Pfister N, Compton M, Olson S, Resch AM, Clover CV, III, Graveley BR, Terns RM, Terns MP. 2012. Essential features and rational design of CRISPR RNAs that function with the Cas RAMP module complex to cleave RNAs. Mol. Cell 45:292–302 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES