Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2013 Aug;195(16):3743–3751. doi: 10.1128/JB.00279-13

Genetic and Physiological Responses of Bifidobacterium animalis subsp. lactis to Hydrogen Peroxide Stress

Taylor S Oberg a, Robert E Ward a, James L Steele b, Jeff R Broadbent a,✉
PMCID: PMC3754573  PMID: 23772066

Abstract

Consumer interest in probiotic bifidobacteria is increasing, but industry efforts to secure high cell viability in foods is undermined by these anaerobes' sensitivity to oxidative stress. To address this limitation, we investigated genetic and physiological responses of two fully sequenced Bifidobacterium animalis subsp. lactis strains, BL-04 and DSM 10140, to hydrogen peroxide (H2O2) stress. Although the genome sequences for these strains are highly clonal, prior work showed that they differ in both intrinsic and inducible H2O2 resistance. Transcriptome analysis of early-stationary-phase cells exposed to a sublethal H2O2 concentration detected significant (P < 0.05) changes in expression of 138 genes in strain BL-04 after 5 min and 27 genes after 20 min. Surprisingly, no significant changes in gene expression were detected in DSM 10140 at either time. Genomic data suggested that differences in H2O2 stress resistance might be due to a mutation in a BL-04 gene encoding long-chain fatty acid coenzyme A (CoA) ligase. To explore this possibility, membrane fatty acids were isolated and analyzed by gas chromatography-mass spectrometry (GC-MS). Results confirmed that the strains had significantly different lipid profiles: the BL-04 membrane contained higher percentages of C14:0 and C16:0 and lower percentages of C18:1n9. Alteration of the DSM 10140 membrane lipid composition using modified growth medium to more closely mimic that of BL-04 yielded cells that showed increased intrinsic resistance to lethal H2O2 challenge but did not display an inducible H2O2 stress response. The results show that deliberate stress induction or membrane lipid modification can be employed to significantly improve H2O2 resistance in B. animalis subsp. lactis strains.

INTRODUCTION

Bifidobacteria are Gram-positive rods of irregular shape with a G+C content of 55 to 67% and are part of the normal gastrointestinal flora in human infants and adults (1, 2). Bifidobacteria have been associated with several health-related benefits, including a decrease in severity of the side effects associated with use of antibiotics, reduced incidence of infection in patients receiving irradiation therapy, decrease in the duration of diarrhea due to various etiologies, reduced frequency of allergic reactions, and alleviation of constipation (3–8). Although no conclusive data regarding a minimal effective dose of probiotics in humans are available, results from clinical trials suggest a direct dose-effect correlation with probiotic efficacy (9, 10). This means that bifidobacteria likely need to be consumed at very high levels (>107 CFU) in bioactive foods to effect a probiotic outcome. At present, yogurt and fermented milks are the most common foods for delivery of probiotic bifidobacteria, but their incorporation into other foods is increasing. A major obstacle to production and storage of bioactive foods containing bifidobacteria is the susceptibility of these cells to oxidative stress. Bifidobacteria are anaerobic and therefore lack common enzymes for detoxification of oxidative free radicals produced in the cell, such as catalase and superoxide dismutase (11, 12, 13). However, previous research in our laboratory has demonstrated variability in the intrinsic and inducible resistance of bifidobacteria strains to hydrogen peroxide (H2O2) (14). The purpose of this study was to investigate the transcriptional and physiological responses of 2 closely related strains of Bifidobacterium animalis subsp. lactis, BL-04, a human fecal isolate, and DSM 10140, a strain originally isolated from French yogurt (12), to sublethal H2O2 exposure in an industrial growth medium. These strains were chosen based on their current use in industry as probiotics in bioactive foods, the availability of complete genome sequence information for both, and marked differences in their inducible and intrinsic H2O2 resistance (12, 14). Specifically, a 20-min exposure to a sublethal concentration (1.25 mM) of H2O2 was shown to significantly improve survival (P < 0.05) of B. animalis subsp. lactis BL-04, while survival of strain DSM 10140 was significantly decreased by this treatment (14). Additionally, B. animalis subsp. lactis BL-04 showed 2-fold-higher intrinsic H2O2 resistance than DSM 10140 (14).

MATERIALS AND METHODS

Culture conditions.

Bacterial strains were maintained as glycerol freezer stocks at −80°C, and working cultures were prepared by two successive transfers (1% inoculum [vol/vol]) into peptonized milk medium (MP5) (14) with anaerobic incubation at 37°C for 18 h. Batch cultures of each strain were prepared by dilution of the working culture to an absorbance at 600 nm (A600) of 1.0 in MP5 medium, inoculated at 1% (vol/vol) into 1 liter of MP5 in a New Brunswick BioFlo III fermentor (New Brunswick Scientific, Edison, NJ), and then incubated at 37°C with an agitation rate of 100 rpm to prevent sedimentation. A gas mixture of 5% CO2 and 95% N2 was continuously passed over the headspace of the fermenter to achieve anaerobic conditions, and the pH was maintained at 6.5 by automatic addition of 15% (vol/vol) NH4OH. The cultures were incubated until the cells reached early stationary-phase (approximately 12 h; ∼log 5.8) (14).

RNA isolation.

Cells from 5-ml samples grown under the conditions indicated above were harvested by centrifugation at 7,500 × g for 10 min. The cell pellets were suspended in 50 ml of prewarmed MP5 medium containing a sublethal H2O2 concentration of 1.25 mM and held at 37°C for 5 (T1) or 20 (T2) min (14). Immediately after treatment, 100 ml of RNAprotect bacterial reagent (Qiagen, Inc., Valencia, CA) was added to the cell suspensions to stop transcription and prevent mRNA degradation. A control sample was also prepared, which was not exposed to H2O2. Cells in RNAprotect were held at room temperature for 10 min, then collected by centrifugation at 9,500 × g for 10 min, and stored at −20°C until RNA isolation.

Cell pellets were thawed at room temperature and suspended in 900 μl of lysozyme solution (20 mg/ml in Tris-EDTA buffer) that also contained 20 U of mutanolysin (Sigma-Aldrich). Samples were incubated for 30 min at 37°C on a shaker incubator at 240 rpm, after which 20 μl of proteinase K (Omega Bio-Tek Inc., Norcross, GA) (20 mg/ml) was added and the samples were returned to the shaker/incubator for 30 min. The RNA was then isolated using an Aurum total RNA minikit (Bio-Rad, Hercules, CA) following the vendor's recommended procedures. The quantity of recovered RNA was measured with a NanoDrop 8000 spectrophotometer (ThermoFisher Scientific, Waltham, MA), and the quality of the RNA was assayed using an Agilent 2100 bioanalyzer (Agilent Technologies, Inc., Waldbronn, Germany). Samples that had sufficient quantities (>10 μg) of quality RNA were stored at −80°C until needed.

Synthesis and labeling of cDNA.

cDNA was synthesized and labeled as recommended by the Affymetrix (Santa Clara, CA) protocol for prokaryotic target preparation in the GeneChip expression analysis technical manual. The cDNA was fragmented into segments of approximately 50 to 100 bp using DNase I and labeled with GeneChip DNA labeling reagent (Affymetrix, Santa Clara, CA) and terminal deoxynucleotidyl transferase (Promega, Madison, WI). Fragmentation labeling efficiency was measured by gel shift assay.

DNA microarrays.

Sample hybridization was performed at the Center for Integrated Bio-systems at Utah State University against a custom Affymetrix bifidobacterial DNA microarray designed to include 1,761 shared plus unique chromosomal genes predicted to occur in B. animalis subsp. lactis BL-04 and DSM 10140 (12). The only predicted coding sequences not included in the microarray design were redundant transposases and rRNA genes. Hybridization was performed according to the Affymetrix protocol for prokaryotic target hybridization in the GeneChip expression analysis technical manual using a hybridization temperature of 50°C. The DNA microarrays were scanned using the HP GeneArray scanner (Affymetrix, Santa Clara, CA) to generate raw intensity values for each probe.

Statistical analysis of microarray data was performed using Bioconductor (www.bioconductor.org) in the open-source statistical platform R (www.r-project.org). The raw probe data were preprocessed using the RMA-MS method (15) and filtered to include only genes that had a high signal intensity and a low coefficient of variation. To test for differential expression, the preprocessed, filtered data were analyzed using the limma/eBayes method (16). Genes were determined to be significantly differentially expressed if they had a false discovery rate-corrected P value less than 0.05. The significantly differentially expressed genes were grouped according to function and by treatment times and strain.

Microarray validation.

To validate the microarray data, quantitative real-time PCR (RT-PCR) was performed for 6 different genes (Table 1) using cDNA produced after each treatment as described by Smeianov et al. (17). A log-fold change (LFC) was calculated between control and treatment samples and plotted against the LFC calculated from the microarray data. A positive LFC represents upregulation of a particular gene in treated cells versus the control, while a negative LFC reflects gene downregulation.

Table 1.

Target gene oligonucleotide primers for RT-PCR

Protein function (gene ID) Primer sequence
Amplicon size (bp) Annealing temp (°C)
Forward Reverse
Peroxiredoxin (Balac_0865) CCGTGTGAAGGCGTCGCAGT GCTCGGCTCGAGCGTTTCGT 91 61.5
Ribonucleotide reductase (Balac_0326) CACCACGCTCGCCGAGATCC TGCTCATCGTGATGCGCCCG 104 61.5
Long-chain acyl-CoA synthetase (Balac_1406) TCCAGGGCTACGGCCTGACC CGCCGGTGGGTGAGATACGC 123 61.5
DnaK (Balac_1557) ACGCCGCTGTCCCTCGGTAT ACGGCTGGTTGTCTTCGGCG 121 61.5
3-Oxoacyl-ACP reductase (Balac_0317) AAGCTCGTGCGTGACCTGGC TGGGGTCGTTCGCGTTCGTG 94 61.5
Multidrug resistance efflux pump (Balac_1405) TGCGTGGAAACCGGCGACTC CCGCCCACTTCGTTCTGCGT 149 61.5

Membrane fatty acid analysis.

To determine whether H2O2 exposure altered cytoplasmic membrane fatty acid (CMFA) composition, cells were grown in batch culture as described before and treated with a sublethal H2O2 concentration of 1.25 mM for 5 (T1) or 20 (T2) min. Cells in 20-ml samples were collected by centrifugation at 5,000 × g for 5 min and then washed twice with phosphate-buffered saline. Membrane fatty acids were then isolated from the pelleted cells according to the protocol of Sasser (18) and identified using gas chromatography as described previously (19). An untreated control sample was also prepared.

To determine the effect of exogenous fatty acids in the growth medium on CMFA composition, cells were grown to early stationary phase in MP5 broth containing 1% Tween 80 (C18:1n9), 1% Tween 20 (C12:0), or no exogenous fatty acid substrate. Bacteria in 20-ml samples were collected and analyzed as described above.

Inducible and intrinsic H2O2 resistance.

Cells were grown to early stationary phase in MP5 medium with 1% Tween 80 or no added exogenous fatty acids, exposed to a sublethal H2O2 concentration of 1.25 mM for 20 or 60 min, and then challenged with a 30-min exposure to a lethal H2O2 concentration of 2.55 or 5.25 mM (14). Control cells that received no H2O2 treatment were also prepared. Samples were plated on MRS agar containing 0.05% filter-sterilized cysteine after 0 and 30 min and then incubated anaerobically at 37°C for 48 h before enumeration. Results are expressed as percent survival, which is calculated by dividing the log10 CFU/ml of surviving cells after 30 min by the log10 CFU/ml of cells after 0 min (14). The Student t test was used to identify significant differences (P < 0.05) between treatment means (20).

Microarray data accession number.

Microarray hybridization data have been deposited in Gene Expression Omnibus under accession number GSE44382.

RESULTS AND DISCUSSION

Influence of H2O2 stress on global gene expression.

To explore the cellular responses of B. animalis subsp. lactis strains to oxidative stress, we analyzed the transcriptional response of strains BL-04 and DSM 10140 after 5 or 20 min sublethal H2O2 exposure. B. animalis subsp. lactis BL-04 showed a total of 138 significant (P < 0.05) differentially expressed (DE) genes after a 5-min exposure and 27 DE genes after 20 min (Fig. 1). Among the DE genes detected after 5 or 20 min, 112 (81%) and 22 (82%), respectively, have an assigned function (Fig. 1; also, see Table S1 in the supplemental material). In contrast, strain DSM 10140 showed no statistically significant (P < 0.05) DE genes at either treatment time compared to control cells.

Fig 1.

Fig 1

Numbers of B. animalis subsp. lactis BL-04 genes, grouped according to functional category, that were significantly upregulated (black bars) or downregulated (white bars) after 1.25 mM H2O2 exposure for 5 min (A) or 20 min (B).

RT-PCR analysis of 6 selected genes was used to validate microarray data obtained from strain BL-04. As shown in Fig. 2, RT-PCR did not detect any contradictions between the two platforms, and there was a strong positive correlation (r2 = 0.83) between the fold change for gene induction or repression predicted from the microarray and the respective values determined by RT-PCR.

Fig 2.

Fig 2

Correlation of fold change values from DNA microarray and real-time quantitative PCR results. Fold change values were obtained for the 6 genes listed in Table 1. Symbols denote expression values from B. animalis subsp. lactis BL-04 cells after 5 min (open diamonds) or 20 min (filled diamonds) exposure to 1.25 mM H2O2. The best-fit curve is shown along with the calculated equation and r2 value.

Bifidobacterium spp. lack the most common genes associated with oxidative stress defense, such as superoxide dismutase and catalase. However, grouping of DE genes into predicted functional categories showed that exposure of BL-04 to an oxidative stress triggered upregulation of genes involved in the thioredoxin reductase system (Table 2). Under favorable conditions, this system functions with ribonucleoside reductase to use NADPH to reduce the 2′ OH group of ribose for deoxynucleotide production, as well as to maintain cytoplasmic redox for disulfide bond production in proteins (21, 22). During oxidative stress, however, cells can use thioredoxin reductase and peroxiredoxin to direct NADPH toward the removal of oxidative free radicals via the reduction of H2O2 and toxic lipid hydroperoxides (23–25). Schell et al. (26) suggested that these enzymes might be one of the primary defense mechanisms against oxidative stress in bifidobacteria, and other research has shown upregulation of thioredoxin, thioredoxin reductase, and peroxiredoxin genes in response to oxygen stress (27, 28). Interestingly, exposure to bile can also produce an oxidative stress response via generation of oxygen free radicals (29), and Sanchez et al. (30) found that bile stress induced a thioredoxin-dependent thiol peroxidase in B. animalis subsp. lactis. Collectively, our results and these prior data confirm that thioredoxin reductase (Balac_0866) and peroxiredoxin (Balac_0865) provide a primary defense mechanism against oxidative stress in B. animalis subsp. lactis.

Table 2.

Differentially regulated genes associated with oxidative stress response of B. animalis subsp. lactis BL-04

Gene ID Predicted function Log fold change vs. controla
T1 T2
Balac_0326 Ribonucleoside diphosphate reductase beta chain (EC 1.17.4.1) 5.39 2.77
Balac_0327 Ribonucleoside diphosphate reductase alpha chain (EC 1.17.4.1) 4.23 NS
Balac_0328 NrdI protein/ribonucleotide reductase stimulatory protein 1.71 NS
Balac_0865 Peroxiredoxin (EC 1.11.1.15) 1.10 NS
Balac_0866 Thioredoxin reductase (EC 1.8.1.9) 1.84 1.19
Balac_0118 Oxidoreductase (EC 1.1.1.-) 1.40 NS
Balac_0120 Vanillate O-demethylase oxidoreductase/ferric reductase 1.59 NS
Balac_0121 Flavodoxin 2.14 NS
Balac_0123 Flavodoxin 1.54 NS
Balac_1314 Anaerobic ribonucleoside-triphosphate reductase-activating protein (EC 1.97.1.4) 1.05 NS
Balac_1315 Anaerobic ribonucleoside-triphosphate reductase (EC 1.17.4.2) 0.72 NS
Balac_0573 NTP pyrophosphohydrolases, including oxidative damage repair enzymes NS 1.34
Balac_0025 Oxidoreductase 0.56 NS
Balac_1337 MoxR-like ATPase (EC 3.6.3.-) −0.88 NS
Balac_0086 Penicillin-binding protein −0.74 NS
Balac_1247 DNA repair protein RecO −0.97 NS
Balac_1114 RecA protein 0.58 NS
Balac_1212 LexA repressor (EC 3.4.21.88) 0.60 NS
Balac_1437 Multidrug resistance protein B 0.52 −1.22
Balac_1555 DnaJ-class molecular chaperone NS −1.34
Balac_1556 GrpE protein 0.47 NS
Balac_0440 Acyl-coenzyme A:6-aminopenicillanic-acid-acyltransferase precursor (EC 2.3.1.-) NS −1.63
Balac_0441 Aminopeptidase C (EC 3.4.22.40) 0.76 NS
Balac_0442 Glutamate/gamma-aminobutyrate antiporter 0.74 −1.37
Balac_0443 Carboxypeptidase S1 (EC 3.4.16.6) 1.28 −1.27
Balac_0444 Amino acid permease 0.77 NS
Balac_1501 Sugar kinases, ribokinase family 3.03 2.41
Balac_1502 Tetracycline resistance permease/tetracycline efflux pump/MFS transporter 2.98 2.53
Balac_1503 Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) 2.79 2.54
Balat_0464 5′-Nucleotidase (EC 3.1.3.5) 1.05 NS
Balac_1081 RNase D (EC 3.1.26.3) 1.25 NS
Balac_1597 Raffinose transport system permease protein 3.46 NS
Balac_1598 Raffinose transport system permease protein 3.20 NS
Balac_1599 Raffinose-binding protein 3.12 NS
Balac_1601 α-Galactosidase (EC 3.2.1.22) 2.10 NS
Balac_1567 4-α-Glucanotransferase (EC 2.4.1.25) 3.13 NS
Balac_1568 α-Glucosidase (EC 3.2.1.20) 1.43 NS
Balac_1569 Multiple sugar transport system permease protein MsmG 2.58 NS
Balac_1570 Sugar transport system permease protein 2.55 NS
Balac_1572 Maltose/maltodextrin-binding protein 1.90 NS
Balac_1573 Trehalose-6-phosphate hydrolase (EC 3.2.1.93) 0.99 NS
a

NS, no significant change relative to control cells.

Transcriptome data also showed that ribonucleoside-diphosphate reductase alpha and beta chains (Balac_0326 and Balac_0327) were differentially expressed with a high LFC, as were several other genes (Balac_1501, Balac_1503, Balac_1081, and Balat_0464 [which corresponds to BL-04 gene Balac_0464]) involved in nucleotide turnover (Table 2). These genes encode proteins used for deoxynucleoside triphosphate (dNTP) production and to hydrolyze nucleic acids for DNA/RNA turnover and scavenging (31). Under H2O2 stress conditions, where peroxiredoxin consumes NADPH for detoxification (and therefore makes it less available for deoxyribonucleotide synthesis), the observed high-level induction of genes for nucleotide turnover could be a reflection of the need to maintain a constant pool of dNTPs to support excision and repair of oxidatively damaged DNA (21, 32, 33).

Additionally, there is an apparent operon in BL-04 (Balac_0440 to Balac_0444) that contains genes involved in protein degradation, which showed significant upregulation after 5 min (T1) and a significant downregulation after 20 min (T2) (Table 2). Previous research has shown that some bacteria utilize proteolytic enzymes to detoxify proteins that have been irreparably damaged by oxidative stress (34, 35). Our data suggest this operon might be used by BL-04 to perform a similar function.

Finally, 28 genes were associated with energy production or sugar transport in strain BL-04, with 19 (68%) of those genes being upregulated in response to H2O2 stress (Fig. 1). In this study, the DE genes involved in sugar metabolism with the highest LFC included those involved in raffinose (Balac_1597 to Balac_1601) and maltose transport and metabolism (Balac_1567 to Balac_1573) (see Table S1 in the supplemental material). The influence of these sugars on H2O2 resistance was not explored here, but other studies have suggested that complex carbohydrates can enhance bile salt resistance in bifidobacteria (36, 37).

Membrane fatty acid analysis.

Several studies have shown that cell envelope lipid composition plays a crucial role in bacterial response to environmental stresses (38–42). We therefore investigated the membrane fatty acid composition of BL-04 and DSM 10140 after H2O2 exposure. Analysis showed no significant change in membrane composition in BL-04 cells grown in medium containing 2.55 mM H2O2 for 5 min (T1) or 60 min (T2) compared to cells grown in control medium (Fig. 3). In contrast, strain DSM 10140 showed a significant decrease (P < 0.05) in C16:0 and a significant increase (P < 0.05) in C18:1n9 after exposure to 1.25 mM H2O2 (Fig. 3). Surprisingly, direct comparison between the bifidobacterium strains showed dramatic differences even in control cells, with BL-04 having 20% more C16:0 and 15 to 20% less C18:1n9. Both strains had similar total amounts of C16:1, with BL-04 having predominantly C16:1n7 and DSM 10140 having more C16:1n9 (Fig. 3). These differences are similar to those seen in other bacteria (43, 44, 45) and likely factor into the increased survival of BL-04 under oxidative stress compared to DSM 10140 (14).

Fig 3.

Fig 3

Membrane fatty acid composition for B. animalis subsp. lactis BL-04 (A) and DSM 10140 (B). The graphs show data from cells grown in MP5 medium with no H2O2 (control) and cells exposed to 1.25 mM H2O2 in MP5 broth for 5 or 20 min. Error bars correspond to the standard error of the mean (SEM). Means with the same letters within each strain are not significantly different (P < 0.05).

In an effort to identify the basis for the dramatic differences we observed in the gene expression profiles and membrane lipid composition of BL-04 versus DSM 10140, we reviewed the comparative genome analysis of these bacteria (12). The two strains are highly clonal, with only 39 coding single-nucleotide polymorphisms and 4 insertion/deletions totaling 443 bp. However, we found that one of these lesions produced a 45-bp deletion in a BL-04 gene (Balac_0771) predicted to encode a long-chain fatty acid coenzyme A (CoA) ligase. In other bacteria, this gene has been shown to activate exogenous long-chain fatty acids for incorporation into the cellular membrane (46) and therefore might result in a different membrane lipid profile for MP5-grown BL-04 compared to DSM 10140. To test whether this lesion affected the ability of BL-04 to incorporate exogenous fatty acids into its membrane, both strains were grown in MP5 medium modified to contain 1% Tween 80 (C18:1), 1% Tween 20 (C12:0), or no fatty acids; then lipids were extracted for membrane fatty acid analysis.

As shown in Fig. 4, DSM 10140 cells grown in MP5 with Tween 20 showed dramatically and significantly higher (P < 0.05) amounts of C12:0 and a significant decrease (P < 0.05) in the pooled total of C18:1n9 and its derivatives (C19:0 cyclic propanol [Cyc], C19:0 Cyc plasmalogens [Plas], and C18:1n9 Plas) (19) than cells grown in MP5 with no fatty acid supplementation (21.4% versus 35.7%, respectively). Conversely, when DSM 10140 cells were grown in MP5 containing Tween 80, their membranes showed significantly (P < 0.05) higher percentages of C18:1n9, as well as an increase in C18:1n9 Plas which was not significant, versus cells grown in MP5 without added fatty acid (Fig. 4). DSM 10140 cells grown in MP5 supplemented with Tween 20 or 80 also had significantly less (P < 0.05) C16:0 than cells grown in MP5 without fatty acids. These results confirm that DSM 10140 is able to efficiently incorporate exogenous fatty acids into its lipid membrane.

Fig 4.

Fig 4

Membrane fatty acid composition as a function of growth medium composition for B. animalis subsp. lactis BL-04 (A) and DSM 10140 (B) cells. The graphs show data from cells grown in MP5 medium with no exogenous fatty acids and cells grown in MP5 with 1% Tween 20 (C12:0) or 1% Tween 80 (C18:1n9). Error bars correspond to the standard error of the mean (SEM). Means with the same letters within each strain are not significantly different (P < 0.05).

In contrast to DSM 10140, membrane lipid profiles of BL-04 cells grown under the same conditions showed far less change in response to the exogenous fatty acid type, which supports our hypothesis that the 45-bp lesion in Balac_0771 impairs the function of its cognate enzyme. Supplementation with Tween 20, for example, did produce a significant increase (P < 0.05) in the membrane level of C12:0 relative to cells grown without added fatty acids, but the degree of change was substantially lower than that seen in DSM 10140 (from 5.2 to 6.8% in BL-04 versus 3.0 to 27.3% in DSM 10140). Additionally, levels of C18:1n9 and its derivatives were not significantly different (P > 0.05) from those in BL-04 cells grown without fatty acid supplementation (totals of 26.5% versus 27.5%, respectively) (Fig. 4). Growth of BL-04 in MP5 with Tween 80 did produce a significant increase (P < 0.05) in the concentration of C18:1n9 and its derivative fatty acids relative to cells grown in MP5 without fatty acids (totals of 38.1% versus 27.5%, respectively). These differences, which would have been present in stress-treated cells, could affect membrane fluidity and, potentially, transduction of environmental stress signals, either of which could explain the observed contrasts in intrinsic and inducible H2O2 stress resistance (14). As a whole, these data support our hypothesis that the mutation in the BL-04 long-chain fatty acid-CoA ligase limits the ability of this strain to incorporate certain exogenous fatty acids into its cytoplasmic membrane.

In our experiments with different exogenous fatty acids, we noted that DSM 10140 cells grown in MP5 containing no fatty acids had a gross lipid profile that most closely matched the lipid profile of BL-04 grown in medium containing Tween 80 (Table 3). Because membrane fluidity could influence the efficiency of environmental stress triggers, we wondered if an inducible stress response in DSM 10140 might be restored by modification of its membrane fatty acid composition to more closely match the profile of BL-04. To explore this possibility, DSM 10140 cells were grown in MP5 medium that contained no supplemented fatty acids, treated with a sublethal H2O2 concentration [1.25 mM], and subsequently exposed to a lethal H2O2 concentration [2.55 or 5.25 mM] (14). Results showed no significant change in survival after H2O2 challenge of induced versus control cells grown in MP5 with Tween 80 and a significant decrease in survival of induced cells compared to control cells grown in medium with no exogenous fatty acids (Fig. 5). As is also shown in Fig. 5, however, cells grown with no exogenous fatty acid had significantly greater survival (P < 0.05) after lethal challenge at 5.25 mM H2O2 than cells grown in MP5 with Tween 80 (Fig. 5B). The increase in intrinsic H2O2 resistance could be associated with the higher percentage of cyclic fatty acids in the membrane (47, 48). Previous studies have shown that in response to low pH and osmotic stress, cells modify their membranes through chain length, saturation, and cyclopropanation of fatty acids, which alters the transition temperature of the membrane and makes it less permeable to organic acids and salts (44, 45, 49). More importantly, cyclopropanation decreases the susceptibility of the cell membrane to lipid peroxidation by stabilizing the unsaturated bond through addition of a methyl group (50). These properties would make the membrane less permeable to oxidative free radicals and more resistant to lipid peroxidation.

Table 3.

Membrane fatty acid (FA) composition of B. animalis subsp. lactis strains grown with different exogenous FAs

Strain and treatment Mean % of each FA species in total cytoplasmic membrane lipid pool
Saturated/unsaturated
Cyclic Plasmologenc Saturatedd Unsaturatede
BL-04
    No Tween 18.81 22.03 62.35 37.65 1.66
    Tween 20a 11.71 16.04 70.07 29.93 2.34
    Tween 80b 16.61 30.52 49.87 50.13 0.99
DSM 10140
    No Tween 13.87 25.08 54.94 45.06 1.22
    Tween 20a 10.51 15.47 74.41 25.59 2.91
    Tween 80b 7.96 26.60 43.39 56.61 0.77
a

Polyoxyethylene(20) sorbitan monolaurate (C12:0).

b

Polyoxyethylene(20) sorbitan monooleate (C18:1).

c

Plasmologens (ether-linked lipids).

d

Percentage of saturated FAs in membrane, including cyclic FAs and plasmologens.

e

Percentage of unsaturated FAs in the membrane, including plasmologens.

Fig 5.

Fig 5

Experimental stress induction in B. animalis subsp. lactis DSM 10140. Graph shows percent survival of DSM 10140 cells after 20 min (A) or 60 min (B) exposure to a sublethal (1.25 mM) H2O2 followed by 30-min challenge at lethal concentrations of 2.55 mM H2O2 or 5.25 mM H2O2. White bars, cells grown in MP5 with no exogenous fatty acid (FA) source and no induction (control); hatched bars, cells grown with no exogenous FA source and given induction treatment; filled bars, cells grown in MP5 with Tween 80 as FA source and no induction (control); crosshatched bars, cells grown in MP5 with Tween 80 and given induction treatment. Each value is the mean of four replicates. Error bars correspond to the standard error of the mean (SEM). Means with the same letters within each strain are not significantly different (P < 0.05).

In summary, B. animalis subsp. lactis BL-04 and DSM 10140 are highly clonal yet display significant differences in their intrinsic and inducible resistance to H2O2 (14). Transcriptome data demonstrate H2O2 exposure triggers induction of an oxidative stress response in BL-04, but this mechanism is somehow impaired in DSM 10140. Genetic and membrane lipid data suggest that some of the differences in H2O2 resistance between these cells may be associated with membrane lipid composition, which in turn is affected by the activity of a long-chain fatty acyl-CoA ligase which is functional in DSM 10140 but impaired in BL-04. However, confirmation of this relationship will require functional studies involving genetic manipulation of B. animalis subsp. lactis, where genetic tools are only poorly developed. While efforts to restore an inducible H2O2 stress response in DSM 10140 via modification of its CMFA composition were unsuccessful, modification did significantly increase intrinsic H2O2 resistance. These data show deliberate H2O2 stress induction or membrane lipid modification can be used to significantly improve H2O2 resistance in B. animalis subsp. lactis.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This project was supported by National Research Initiative Grant no. 2006-35503-17194 from the USDA Cooperative State Research, Education, and Extension Service Improving Food Quality and Value Program and by the Utah Agricultural Experiment Station.

This communication is approved as UAES journal paper number 8523.

Peggy Steele, a member of James L. Steele's family, is employed by Dupont Inc., a supplier of bacterial cultures to the food industry.

Footnotes

Published ahead of print 14 June 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.00279-13.

REFERENCES

  • 1. Klaassens ES, Boesten RJ, Haarman M, Knol J, Schuren FH, Vaughan EE, De Vos WM. 2009. Mixed-species genomic microarray analysis of fecal samples reveals differential transcriptional responses of bifidobacteria in breast- and formula-fed infants. Appl. Environ. Microbiol. 75:2668–2676 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Vaughan E, Heilig H, Benamor K, Devos W. 2005. Diversity, vitality and activities of intestinal lactic acid bacteria and bifidobacteria assessed by molecular approaches. FEMS Microbiol. Rev. 29:477–490 [DOI] [PubMed] [Google Scholar]
  • 3. Chen C-C, Kong M-S, Lai M-W, Chao H-C, Chang K-W, Chen S-Y, Huang Y-C, Chiu C-H, Li W-C, Lin P-Y, Chen C-J, Li T-Y. 2010. Probiotics have clinical, microbiologic, and immunologic efficacy in acute infectious diarrhea. Pediatr. Infect. Dis. J. 29:135–138 [DOI] [PubMed] [Google Scholar]
  • 4. Dong P, Yang Y, Wang W- P. 2010. The role of intestinal bifidobacteria on immune system development in young rats. Early Hum. Dev. 86:51–58 [DOI] [PubMed] [Google Scholar]
  • 5. Zhang L-L, Chen X, Zheng P-Y, Luo Y, Lu G-F, Liu Z-Q, Huang H, Yang P-C. 2010. Oral Bifidobacterium modulates intestinal immune inflammation in mice with food allergy. J. Gastroenterol. Hepatol. 25:928–934 [DOI] [PubMed] [Google Scholar]
  • 6. Stanton CC, Gardiner GG, Meehan HH, Collins KK, Fitzgerald GG, Lynch PB, Ross RP. 2001. Market potential for probiotics. Am. J. Clin. Nutr. 73:476S–483S [DOI] [PubMed] [Google Scholar]
  • 7. Bermudez-Brito MM, Plaza-Díaz JJ, Muñoz-Quezada SS, Gómez-Llorente CC, Gil AA. 2012. Probiotic mechanisms of action. Ann. Nutr. Metab. 61:160–174 [DOI] [PubMed] [Google Scholar]
  • 8. Ishizuka A, Tomizuka K, Aoki R, Nishijima T, Saito Y, Inoue R, Ushida K, Mawatari T, Ikeda T. 2012. Effects of administration of Bifidobacterium animalis subsp. lactis GCL2505 on defecation frequency and bifidobacterial microbiota composition in humans. J. Biosci. Bioeng. 113:587–591 [DOI] [PubMed] [Google Scholar]
  • 9. Meance S, Cayuela C, Turchet P, Raimondi A, Lucas C, Antoine J-M. 2001. A fermented milk with a Bifidobacterium probiotic strain DN-173 010 shortened oro-fecal gut transit time in elderly. Microb. Ecol. Health Dis. 13:217–222 [Google Scholar]
  • 10. Reid G, Beuerman D, Heinemann C, Bruce AW. 2001. Probiotic Lactobacillus dose required to restore and maintain a normal vaginal flora. FEMS Immunol. Med. Microbiol. 32:37–41 [DOI] [PubMed] [Google Scholar]
  • 11. Vries W, Stouthamer AH. 1969. Factors determining the degree of anaerobiosis of Bifidobacterium strains. Arch. Microbiol. 65:275–287 [DOI] [PubMed] [Google Scholar]
  • 12. Barrangou R, Briczinski EP, Traeger LL, Loquasto JR, Richards M, Horvath P, Coûté-Monvoisin A-C, Leyer G, Rendulic S, Steele JL, Broadbent JR, Oberg T, Dudley EG, Schuster S, Romero DA, Roberts RF. 2009. Comparison of the complete genome sequences of Bifidobacterium animalis subsp. lactis DSM 10140 and Bl-04. J. Bacteriol. 191:4144–4151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ruiz L, Ruas-Madiedo P, Gueimonde M, los Reyes-Gavilán CG, Margolles A, Sánchez B. 2011. How do bifidobacteria counteract environmental challenges? Mechanisms involved and physiological consequences. Genes Nutr. 6:307–318 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Oberg TS, Steele JL, Ingham SC, Smeianov VV, Briczinski EP, Abdalla A, Broadbent JR. 2011. Intrinsic and inducible resistance to hydrogen peroxide in Bifidobacterium species. J. Ind. Microbiol. Biotechnol. 38:1947–1953 [DOI] [PubMed] [Google Scholar]
  • 15. Stevens JR, Ganesan B, Desai P, Rajan S, Weimer BC. 2008. Statistical issues in the normalization of multi-species microarray data, p 47–62 Proceedings of Conference on Applied Statistics in Agriculture, Kansas State University [Google Scholar]
  • 16. Scholtens D, von Heydebreck A. 2005. Analysis of differential gene expression studies, p 229–248 In Gentleman R, Carey V, Huber W, Irizarry R, Dudoit S. (ed), Bioinformatics and computational biology solutions using R and Bioconductor. Springer Science Business Media, Inc., New York, NY [Google Scholar]
  • 17. Smeianov VV, Wechter P, Broadbent JR, Hughes JE, Rodriguez BT, Christensen TK, Ardo Y, Steele JL. 2007. Comparative high-density microarray analysis of gene expression during growth of Lactobacillus helveticus in milk versus rich culture medium. Appl. Environ. Microbiol. 73:2661–2672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Sasser M. 1990. Identification of bacteria by gas chromatography of cellular fatty acids. Technical note 101. Midi, Inc., Newark, DE: http://www.microbialid.com/PDF/TechNote_101.pdf [Google Scholar]
  • 19. Oberg TS, Ward RE, Steele JL, Broadbent JR. 2012. Identification of plasmalogens in the cytoplasmic membrane of Bifidobacterium animalis subsp. lactis. Appl. Environ. Microbiol. 78:880–884 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Hayter A. 2007. Probability and statistics for engineers and scientists. Thompson Brooks/Cole, Belmont, CA [Google Scholar]
  • 21. Nordlund P, Reichard P. 2006. Ribonucleotide reductases. Annu. Rev. Biochem. 75:681–706 [DOI] [PubMed] [Google Scholar]
  • 22. Arnér ESJ, Holmgren A. 2000. Physiological functions of thioredoxin and thioredoxin reductase. Eur. J. Biochem. 267:6102–6109 [DOI] [PubMed] [Google Scholar]
  • 23. Reott MA, Parker AC, Rocha ER, Smith CJ. 2009. Thioredoxins in redox maintenance and survival during oxidative stress of Bacteroides fragilis. J. Bacteriol. 191:3384–3391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Meyer Y, Buchanan BB, Vignols F, Reichheld J-P. 2009. Thioredoxins and glutaredoxins: unifying elements in redox biology. Annu. Rev. Genet. 43:335–367 [DOI] [PubMed] [Google Scholar]
  • 25. Holmgren A. 1989. Thioredoxin and glutaredoxin systems. J. Biol. Chem. 264:13963–13966 [PubMed] [Google Scholar]
  • 26. Schell MA, Karmirantzou M, Snel B, Vilanova D, Berger B, Pessi G, Zwahlen M-C, Desiere F, Bork P, Delley M, Pridmore RD, Arigoni F. 2002. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc. Natl. Acad. Sci. U. S. A. 99:14422–14427 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Ruiz L, Gueimonde M, Ruas-Madiedo P, Ribbera A, De Los Reyes-Gavilan CG, Ventura M, Margolles A, Sanchez B. 2012. Molecular clues to understand the aerotolerance phenotype of Bifidobacterium animalis subsp. lactis. Appl. Environ. Microbiol. 78:644–650 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Xiao M, Xu P, Zhao J, Wang Z, Zuo F, Zhang J, Ren F, Li P, Chen S, Ma H. 2011. Oxidative stress-related responses of Bifidobacterium longum subsp. longum BBMN68 at the proteomic level after exposure to oxygen. Microbiology 157:1573–1588 [DOI] [PubMed] [Google Scholar]
  • 29. Begley MI, Gahan CGM, Hill C. 2005. The interaction between bacteria and bile. FEMS Microbiol. Rev. 29:625–651 [DOI] [PubMed] [Google Scholar]
  • 30. Sanchez B, Champomier-Verges M-C, Stuer-Lauridsen B, Ruas-Madiedo P, Anglade P, Baraige F, De Los Reyes-Gavilan CG, Johansen E, Zagorec M, Margolles A. 2007. Adaptation and response of Bifidobacterium animalis subsp. lactis to bile: a proteomic and physiological approach. Appl. Environ. Microbiol. 73:6757–6767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Versées W, Steyaert J. 2003. Catalysis by nucleoside hydrolases. Curr. Opin. Struct. Biol. 13:731–738 [DOI] [PubMed] [Google Scholar]
  • 32. Seeberg EE, Eide LL, Bjørås MM. 1995. The base excision repair pathway. Trends Biochem. Sci. 20:391–397 [DOI] [PubMed] [Google Scholar]
  • 33. Cooke MS. 2003. Oxidative DNA damage: mechanisms, mutation, and disease. FASEB J. 17:1195–1214 [DOI] [PubMed] [Google Scholar]
  • 34. Davies KJ, Lin SW. 1988. Degradation of oxidatively denatured proteins in Escherichia coli. Free Radic. Biol. Med. 5:215–223 [DOI] [PubMed] [Google Scholar]
  • 35. Cabiscol E, Tamarit J, Ros J. 2000. Oxidative stress in bacteria and protein damage by reactive oxygen species. Int. Microbiol. 3:3–8 [PubMed] [Google Scholar]
  • 36. Perrin S, Grill JP, Schneider F. 2000. Effects of fructooligosaccharides and their monomeric components on bile salt resistance in three species of bifidobacteria. J. Appl. Microbiol. 88:968–974 [DOI] [PubMed] [Google Scholar]
  • 37. Ruas-Madiedo P, Hernández-Barranco A, Margolles A, de Los Reyes-Gavilán CG. 2005. A bile salt-resistant derivative of Bifidobacterium animalis has an altered fermentation pattern when grown on glucose and maltose. Appl. Environ. Microbiol. 71:6564–6570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Vigh L, Escribá P, Sonnleitner A, Sonnleitner M, Piotto S, Maresca B, Horváth I, Harwood J. 2005. The significance of lipid composition for membrane activity: new concepts and ways of assessing function. Prog. Lipid Res. 44:303–344 [DOI] [PubMed] [Google Scholar]
  • 39. Zhang Y-M, Rock CO. 2008. Membrane lipid homeostasis in bacteria. Nat. Rev. Microbiol. 6:222–233 [DOI] [PubMed] [Google Scholar]
  • 40. Baysse C, O'Gara F. 2007. Role of membrane structure during stress signaling and adaptation in Pseudomonas, p 193–224 In Ramos J-L, Filloux A. (ed) Pseudomonas, vol. 5 Springer Science Business Media, Inc., New York, NY [Google Scholar]
  • 41. van Bokhorst-van de Veen H, Abee T, Tempelaars M, Bron PA, Kleerebezem M, Marco ML. 2011. Short- and long-term adaptation to ethanol stress and its cross-protective consequences in Lactobacillus plantarum. Appl. Environ. Microbiol. 77:5247–5256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Cotter PD, Hill C. 2003. Surviving the acid test: responses of gram-positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67:429–453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Ruiz LL, Sánchez BB, Ruas-Madiedo PP, de Los Reyes-Gavilán CGC, Margolles AA. 2007. Cell envelope changes in Bifidobacterium animalis ssp. lactis as a response to bile. FEMS Microbiol. Lett. 274:316–322 [DOI] [PubMed] [Google Scholar]
  • 44. Broadbent JR, Larsen RL, Deibel V, Steele JL. 2010. Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress. J. Bacteriol. 192:2445–2458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Muller JA, Ross RP, Sybesma WFH, Fitzgerald GF, Stanton C. 2011. Modification of the technical properties of Lactobacillus johnsonii NCC 533 by supplementing the growth medium with unsaturated fatty acids. Appl. Environ. Microbiol. 77:6889–6898 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Weimar JD, DiRusso CC, Delio R, Black PN. 2002. Functional role of fatty acyl-coenzyme A synthetase in the transmembrane movement and activation of exogenous long-chain fatty acids. J. Biol. Chem. 277:29369–29376 [DOI] [PubMed] [Google Scholar]
  • 47. Grogan D, Cronan J., Jr 1997. Cyclopropane ring formation in membrane lipids of bacteria. Microbiol. Mol. Biol. Rev. 61:429–441 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Montanari C, Sado Kamdem SL, Serrazanetti DI, Etoa FX, Guerzoni ME. 2010. Synthesis of cyclopropane fatty acids in Lactobacillus helveticus and Lactobacillus sanfranciscensis and their cellular fatty acids changes following short term acid and cold stresses. Food Microbiol. 27:493–502 [DOI] [PubMed] [Google Scholar]
  • 49. Wu C, Zhang J, Wang M, Du G, Chen J. 2012. Lactobacillus casei combats acid stress by maintaining cell membrane functionality. J. Ind. Microbiol. Biotechnol. 39:1031–1039 [DOI] [PubMed] [Google Scholar]
  • 50. Pradenas GA, Paillavil BA, Reyes-Cerpa S, Perez-Donoso JM, Vasquez CC. 2012. Reduction of the monounsaturated fatty acid content of Escherichia coli results in increased resistance to oxidative damage. Microbiology 158:1279–1283 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES