Abstract
Cytolethal distending toxins (CDT) are potent cytotoxins of several Gram-negative pathogenic bacteria, including Escherichia coli, in which five types (CDT-I to CDT-V) have been identified so far. CDT-V is frequently associated with Shiga-toxigenic E. coli (STEC), enterohemorrhagic E. coli (EHEC) O157 strains, and strains not fitting any established pathotypes. In this study, we were the first to sequence and annotate a 31.2-kb-long, noninducible P2-like prophage carrying the cdt-V operon from an stx- and eae-negative E. coli O157:H43 strain of bovine origin. The cdt-V operon is integrated in the place of the tin and old phage immunity genes (termed the TO region) of the prophage, and the prophage itself is integrated into the bacterial chromosome between the housekeeping genes cpxP and fieF. The presence of P2-like genes (n = 20) was investigated in a further five CDT-V-positive bovine E. coli O157 strains of various serotypes, three EHEC O157:NM strains, four strains expressing other variants of CDT, and eight CDT-negative strains. All but one CDT-V-positive atypical O157 strain uniformly carried all the investigated genomic regions of P2-like phages, while the EHEC O157 strains missed three regions and the CDT-V-negative strains carried only a few P2-like sequences. Our results suggest that P2-like phages play a role in the dissemination of cdt-V between E. coli O157 strains and that after integration into the bacterial chromosome, they adapted to the respective hosts and became temperate.
INTRODUCTION
Cytolethal distending toxins (CDT) are considered prototypic inhibitory cyclomodulins (1, 2). Genes encoding CDTs are widely disseminated among Gram-negative pathogenic bacteria, including Escherichia coli, Campylobacter spp., Aggregatibacter actinomycetemcomitans, Haemophilus ducreyi, Salmonella enterica serovar Typhimurium, and Shigella spp. (3).
The holotoxin is a heterotrimer of three protein subunits, CdtA, CdtB, and CdtC. These are encoded by three adjacent, sometimes slightly overlapping genes (4). CdtB is the active subunit, possessing DNase activity and sharing homology with the mammalian DNase I (5). There is evidence that in case of Campylobacter spp., A. actinomycetemcomitans, and H. ducreyi, the other two subunits play a role in the transport of CdtB into the target cell (3). Upon entering the eukaryotic cell, CdtB causes DNA damage, which in turn causes cell cycle arrest between the G2 and M phases (6). Double-stranded DNA damage leads to the distension and subsequent death of the target cell (7). The characteristic distending transformation has been demonstrated on multiple cell lines by several studies (7, 8).
CDT was first identified in E. coli (Johnson and Lior) (9), and its production has been associated with several pathotypes, e.g., enterohemorrhagic (EHEC) and enteropathogenic (EPEC) (3). So far, five types have been associated with E. coli, termed CDT-I to CDT-V (4, 6, 10, 11, 12). The genomic localization of cdt alleles and their association with mobile genetic elements was reported by several groups. Accordingly, Pérès et al. localized cdt-III to a large conjugative virulence plasmid (6). cdt-I and cdt-IV are encoded by lambdoid prophages (13, 14), while the cdt-V operon is flanked by P2-like phage sequences (11, 14, 15, 16), but the corresponding nucleotide sequences deposited show only small portions of the phage genes repA (replication gene A) and Q (a capsid gene).
The presence of CDT-V in Shiga-toxigenic E. coli (STEC) strains of various serotypes, both of clinical (17, 18) and nonclinical (19) origin, has been reported. CDT-V has also been associated with strains of other serotypes and pathotypes associated with human diarrhea (16, 20), where it is the only known cytotoxin of the respective strains, underlining the importance of CDT-V as a virulence factor. Therefore, it is imperative to obtain more information on the potential mobility of the CDT-V-encoding operon in non-STEC pathotypes and determine whether it is phage associated.
The aim of this study was to characterize the P2-like phage sequence context flanking the cdt-V operon in strain T22, an E. coli O157:H43 strain of atypical pathotype (eae and stx negative), and to monitor the presence of characteristic regions in other pathogenic and nonpathogenic CDT-V-positive strains and in additional K-12 E. coli strains.
MATERIALS AND METHODS
Bacterial strains.
Strains used in this study are listed in Table 1. Strains were grown on lysogeny broth (LB) agar plates or bromothymol blue agar plates.
Table 1.
Strain | Serotype | Pathotypec | CDT type | Phylogenetic groupd | Presence/absenceb of: |
Reference | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Spacer Q | Spacer | cdtA spacer | cdtc-repA | P | P-Q | repA | repA distant | C | O | Short ORFs | Baseplate J | Tail | Terminase | D | FI | Capsid | Lysin | cpxP integrase | ogr-fieF | ||||||
T22a | O157:H43 | Atypical | V | B1 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | 23 |
T16a | O157:H43 | Atypical | V | B1 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | 23 |
T50a | O157:H43 | Atypical | V | B1 | + | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | 23 |
T34a | O157:H9 | Atypical | V | B1 | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | 23 |
T49a | O157:H37 | Atypical | V | B1 | − | + | + | + | + | + | + | + | + | + | + | + | + | + | + | − | + | + | + | + | 23 |
T4 | O157:H12 | Atypical | A | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 23 | |
B20 | O157:H12 | Atypical | A | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 23 | |
B47 | O157:NM | Atypical | B1 | − | − | − | − | + | + | + | + | + | + | + | + | + | + | + | − | − | + | + | + | 23 | |
B54 | O157:H12 | Atypical | A | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 23 | |
E6468/62 | O86:H34 | EPEC | I | ND | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 4 |
BM2-10 | O88 | Diarrheagenic | III | ND | − | − | − | − | − | − | − | + | − | − | − | − | + | − | − | − | − | − | − | − | 35 |
28C | O75:K95 | ExPEC | IV | ND | − | − | − | − | + | + | + | + | − | − | + | + | + | + | + | + | − | + | − | − | 14 |
703/88a | O157:NM | EHEC | V | D | − | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | − | + | − | − | 14 |
702/88a | O157:NM | EHEC | V | D | − | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | − | + | − | − | 14 |
493/89a | O157:NM | EHEC | V | D | − | + | + | + | + | + | + | + | − | + | + | + | + | + | + | + | + | + | − | − | 36 |
E2348/69 | O127:H6 | EPEC | B2 | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 37 | |
Sakai | O157:H7 | EHEC | D | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | − | 38 | |
C600 | K-12 | Commensal | ND | − | − | − | − | − | − | − | + | − | − | − | − | − | − | − | − | − | − | − | − | 39 | |
ER2738 | K-12 | Commensal | ND | − | − | − | − | − | − | − | + | − | − | − | − | − | − | + | − | − | − | − | − | 40 |
Strain was used in the phage induction experiments.
“Spacer” refers to the region between cdtA and capsid packaging protein gene Q, which has no associated function so far. “Short ORFs” refers to the region spanning 4 ORFs from a replication gene (repB) to a hypothetical zinc finger protein. +, presence; −, absence.
EPEC, enteropathogenic Escherichia coli; EHEC, enterohemorrhagic Escherichia coli; ExPEC, extraintestinal pathogenic Escherichia coli.
ND, not determined.
Cosmid clone library construction and screening.
Genomic DNA was isolated from strain T22 of E. coli O157:H43 with the Sigma genomic DNA kit (Sigma-Aldrich, St. Louis, MO). The preparation of the cosmid clone library was performed with the pWEB-TNC cosmid cloning kit (Epicentre, Madison, WI) according to the manufacturer's instructions, with the modification that genomic DNA was subjected to a partial digestion with restriction endonuclease MboI (Fermentas, Vilnius, Lithuania). All together, 1,000 transformant colonies were identified (cosmid library) and screened for the presence of cdt-V using the primers indicated in Table 2.
Table 2.
Primer name | Target gene(s) | Sequence 5′ to 3′ | Position (bp)a | Reference |
---|---|---|---|---|
FI_fw | Tail sheath monomer FI gene | TGCGTGTGGAAGACGGCACC | 24612–24631 | This study |
FI_rev | CGGCCTTGAGGGTTTCCGCAT | 25413–25433 | This study | |
Latecontrol_D_fw | Late control protein D gene | TTCGTGGCGCTGTCCTGACG | 29694–29713 | This study |
Latecontrol_D_rev | TGGAGAACTCCGCAACGCCC | 30448–30467 | This study | |
Terminase_fw | Terminase gene | GGGAGCCGAACGGATTGGCG | 10561–10580 | This study |
Terminase_rev | CTTGAGCACCGCATCCGCGA | 11298–11317 | This study | |
Capsid_fw | Capsid gene | CCGTCGGTCACCCAGACCCT | 12975–12994 | This study |
Capsid_rev | AGCGGCCAGCATTTCGCTGT | 13655–13636 | This study | |
Lysin_fw | Lysin gene | ATGCTGGCCGTGTCCGAAGG | 15834–15853 | This study |
Lysin_rev | CTGACCGTAACCGGCACCCG | 16204–16223 | This study | |
Tail_protein_fw | Phage tail gene | AGGGCGCTGACTGATGCCGT | 17271–17290 | This study |
Tail_protein_rev | AGCTCCATCGGGCGGGTGAC | 17655–17674 | This study | |
Baseplate_J_fw | Baseplate gene J | GGTTGCCCGTACCCTGACGC | 19335–19354 | This study |
Baseplate_J_rev | GACAGACGGATGTCGCGCCC | 19960–19979 | This study | |
L413C_specific_fw | C (repressor) | AGGATCCAGCCCTTTCTAAA | 1632–1651 | This study |
L413C_specific_rev | AATCCTTTTCGCGGAGTGG | 1243–1261 | This study | |
gpO_fw | Capsid scaffolding protein O gene | TTTCGTATCGGCGTTGAGG | 11984–12002 | This study |
gpO_rev | TGTTTTTCAGGCGGGTGAA | 12710–12728 | This study | |
cpxP2_fw | cpxP integrase gene | AGCCATATGTTCGACGGCAT | 4327924–4327943* | This study |
integrase_rev | AGGCCAGCGCCAAATTATTC | 439–458 | This study | |
P2_cdta_up_novel_fw | Spacer region gene | CCAAGAGCACGCCAGCACTGA | 8727–8747 | This study |
P2_cdta_up_novel_rev | TGGCAAATCTCCTTTGGGCTAGTG | 8261–8284 | This study | |
Cdta_up_novel_overlap_fw | cdtA spacer gene | TCAATCGCGTTTTGCACTCACGG | 8500–8522 | This study |
Cdta_up_novel_overlap_rev | AGGTCCAGCCCCGGGTAATGG | 8018–8038 | This study | |
P2_novel_overlap_fw | Capsid packaging protein Q spacer gene | ACAAGGGAAAGCCGACGGCAT | 9259–9279 | This study |
P2_novel_overlap_rev | TCAGTTATCGTCAGTGCTGGCGTGC | 8717–8741 | This study | |
Cdtc_P2_overlap_fw | cdtC replication gene A | CATACCTTCAACAACAGGTGCGGT | 6227–6250 | This study |
Cdtc_P2_overlap_rev | TACCGGTTCCCACGCCTTCTG | 5591–5611 | This study | |
P2_short_orfs_fw | Short ORFs | CGCCGTCAGGTTGGCGCAA | 2367–2385 | This study |
P2_short_orfs_rev | AACCAGCGCAGAAGCACCGC | 3281–3300 | This study | |
ogr_fw | ogr-fieF | ACGTGAATTGCAGCGCCACG | 30840–30859 | This study |
fieF_rev | CCAGCGCCAGCAGAATTGCG | 4361610–4361629* | This study | |
P2_PQ_fw | Capsid packaging protein Q gene | AACACCGCAACCTGCGGCAA | 9974–9993 | This study |
P2_PQ_rev | CCACCAGTAAACATCCTCT | 9579–9597 | This study | |
P2_P_fw | Terminase protein P gene | AACCTGTTCATGTGTGAA | 10676–10693 | This study |
P2_P_rev | AACGAGCTGGTGATGTCGG | 10191–10209 | This study | |
P2_repA_fw | Replication gene A | TTTCGATAATCTGGTTACG | 4915–4933 | This study |
P2_repA_rev | TATGGTCATGTTGCTGGCGC | 4213–4232 | This study | |
P2_repA_ext_fw | Replication gene A distant region | TTGCTTCAAAGACTGACTG | 3376–3394 | This study |
P2_repA_ext_rev | GAAATGAACGACGTCGAACGT | 2298–2318 | This study | |
CDT-IIIs | cdt-VB | GAAAGTAAATGGAATATAAATGTCCG | 7291–7316 | 11 |
CDT-IIIas | TTTGTGTCGGTGCAGCAGGGAAAA | 6761–6784 | 11 |
The reference sequence for the primers indicated with an asterisk is CP002967 (whole genome of Escherichia coli strain W). Positions are given in reference to GenBank accession number KC618326.1, except where indicated otherwise.
Sequencing.
Cosmid DNA was isolated by using the alkaline lysis method (21), genomic DNA was isolated by using the GenElute bacterial genomic DNA kit (Sigma-Aldrich, St. Louis, MO), and both were sequenced at the Biological Research Center (Szeged, Hungary) by using the Ion Torrent Personal Genome Machine (PGM) next-generation sequencer as well as traditional Sanger-based capillary sequencing. The average coverage for the prophage region was 112×. Trimming and assembly were performed manually and by using CLC Genomics Workbench version 6.0.1. Nucleotide sequence analysis and searches for open reading frames (ORFs) and homologous DNA sequences in the EMBL and GenBank database libraries were performed with the tools available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) together with Vector NTI and CLC Bio Genomics Workbench softwares.
PCR screening for flanking regions.
E. coli strains representing different serotypes and pathotypes (Table 1) were tested by PCR for the presence of characteristic P2-like phage genes. Primers were designed with the aid of PrimerBLAST, available from the National Center for Biotechnology Information. The general PCR conditions were an initial denaturation of 3 min at 94°C and then 30 cycles of denaturation for 30 s at 94°C, followed by annealing for 30 s at 59 to 60°C (depending on the primer pair) and extension for 60 s at 72°C. The final extension time was 5 min. The primers used in the reactions are listed in Table 2.
Phage induction experiments.
Phage induction was carried out for the 8 strains marked in Table 1, using either mitomycin C (0.5 μg ml−1) or norfloxacin (1.25 μg ml−1) as inducing agents. Induction was also attempted by UV irradiation as described by Hertman and Luria (22), with the modification that doses were 15, 10, and 5 s long with a 30-W lamp. E. coli K-12 strains ER2738, C600, and Shigella sonnei strain 866 (19), kindly provided by Maite Muniesa, were used as indicator strains. As a positive control for phage induction, the E. coli O157:H7 strain 34, harboring an inducible Stx2 phage (23), was used.
Nucleotide sequence accession number.
The nucleotide sequence of the P2-like prophage has been deposited into GenBank (KC618326.1).
RESULTS
Characteristics of the P2-like prophage carrying the cdt-V cluster.
In order to determine the sequence of the cdt-V operon and its exact position in the genome of E. coli O157:H43 strain T22, a clone of the cosmid library positive for cdt-V, as well as the corresponding region of the genomic DNA, was sequenced, annotated, and deposited into GenBank. The length of the prophage containing the cdt-V operon is 31.2 kb. The cdt-V operon of strain T22 shows the highest nucleic acid similarity to the cdt operon of strain AH-10 (GenBank no. AB472839). The sequence of cdtB, coding for the active toxin subunit, is highly homologous to the AH-10-specific sequence, with only 4 synonymous single-nucleotide polymorphisms (SNPs). The CDT-V-encoding operon in strain T22 is flanked by P2-like prophage sequences. The majority of P2-like genes carried by T22 have the highest similarity to the bacteriophage L-413C (97% similarity on average at the nucleotide level; GenBank no. AY251033). The GC content of the cdt-V operon is 41%, whereas the prophage genes exhibit an average GC content of 53%. The structural organization of the P2-like phage genes is reminiscent of the P2-like prophage in E. coli strain W (GenBank no. CP002967). DNA sequence comparison between the P2-like sequences of strains T22 and W revealed that there is a high degree of nucleotide homology (94 to 99% identity) between their genes (Table 3). The tail fiber-encoding genes (ORFs 33 to 36) located in the region ranging from bp positions 20720 to 23571 are different from all published P2-like prophages. The respective phage tail fiber genes of the prophage in the genome of E. coli strain UMNK88 (accession no. CP002729; with the homologue of ORF 34 being present in two copies) are their closest homologues, with a nucleotide identity of 92 to 99%. The region between bp positions 22000 and 22192 is entirely missing in all other P2-like prophage sequences available in GenBank, whereas it is present in the prophage of UMNK88. The ORFs predicted in the P2-like prophage of E. coli O157 strain T22 are listed in Table 3.
Table 3.
ORF | Feature or product of sequence | Position |
Size (bp) | No. of identical nt/total no. of nt, % identity | Reference accession no. | Strain | |
---|---|---|---|---|---|---|---|
Start | End | ||||||
1 | Integrase | 187 | 1167 | 981 | 980/981, 99 | CP002797.2 | NA114 |
2 | Immunity repressor | 1237 | 1530 | 294 | 294/294, 100 | AY251033.1 | Bacteriophage L-413C |
3 | Repressor, prophage excision | 1667 | 1939 | 273 | 273/273, 100 | CP002797.2 | NA114 |
4 | Unknown | 1915 | 2112 | 198 | 196/198, 99 | CP002797.2 | NA114 |
5 | DNA replication | 2109 | 2609 | 501 | 501/501, 100 | CP001368.2 | TW14359 |
6 | Unknown | 2673 | 2897 | 225 | 223/225, 100 | CP000800.1 | E24377A |
7 | Unknown | 2897 | 3199 | 303 | 290/303, 96 | CP002967.1 | W |
8 | Hypothetical zinc finger protein | 3199 | 3423 | 225 | 221/225, 98 | CP002185 | W |
9 | Unknown | 3420 | 3695 | 276 | 274/276, 99 | CP002967.1 | W |
10 | DNA replication | 3685 | 5982 | 2,298 | 2191/2262, 97 | CP002185 | W |
11 | Cytolethal distending toxin C subunit | 6058 | 6603 | 546 | 545/546, 99 | AB472839 | AH-10 |
12 | Cytolethal distending toxin B subunit | 6618 | 7427 | 810 | 809/810, 99 | AB472860 | AH-16 |
13 | Cytolethal distending toxin A subunit | 7424 | 8200 | 777 | 777/777, 100 | JF461073 | Bacteriophage fi125 |
14 | Hypothetical protein | 8779 | 8940 | 162 | 161/162, 99 | AB472870 | AH-26 |
15 | Phage-related capsid packaging protein | 8979 | 10013 | 1,035 | 1009/1035, 97 | CP000970 | SMS-3-5 |
16 | Phage terminase, ATPase subunit | 10014 | 11786 | 1,773 | 1724/1774, 97 | AY251033.1 | Bacteriophage L-413C |
17 | Phage capsid scaffolding protein | 11894 | 12814 | 921 | 896/921, 97 | CP002185 | W |
18 | Phage major capsid protein | 12873 | 13946 | 1,074 | 1060/1074, 97 | CP002185 | W |
19 | Phage terminase, endonuclease subunit | 13951 | 14693 | 744 | 727/744, 98 | AJ298566.1 | Bacteriophage 299 |
20 | Phage head completion, stabilization | 14793 | 15302 | 510 | 499/510, 98 | CP000970 | SMS-3-5 |
21 | Phage tail completion protein | 15302 | 15505 | 204 | 202/204, 99 | AY251033.1 | Bacteriophage L-413C |
22 | Phage holin | 15544 | 15789 | 246 | 246/246, 100 | AY251033.1 | Bacteriophage L-413C |
23 | Phage lysin | 15789 | 16286 | 498 | 492/498, 99 | CP002967.1 | W |
24 | Phage holin, endolysin | 16301 | 16726 | 414 | 420/426, 99 | CU928161 | S88 |
25 | Phage spanin, Rz | 16714 | 17139 | 426 | 412/426, 97 | CP000970 | SMS-3-5 |
26 | Phage outer membrane lipoprotein | 17126 | 17284 | 159 | 157/159, 99 | CP002967.1 | W |
27 | Phage tail protein | 17247 | 17714 | 468 | 461/468, 99 | CP002967.1 | W |
28 | Phage tail completion protein | 17707 | 18159 | 453 | 441/453, 97 | CP002967 | W |
29 | Baseplate assembly | 18226 | 18861 | 636 | 622/636, 98 | CP002967.1 | W |
30 | Baseplate assembly | 18858 | 19205 | 348 | 342/348, 98 | CU928162 | ED1a |
31 | Baseplate assembly | 19210 | 20118 | 909 | 890/909, 98 | CP001969 | IHE3034 |
32 | Phage tail fiber | 20111 | 20722 | 612 | 603/612, 99 | CP001368 | TW14359 |
33 | Phage tail fiber | 20719 | 22218 | 1,500 | 1437/1502, 96 | CP002729 | UMNK88 |
34 | Putative tail fiber assembly protein | 22218 | 22820 | 603 | 595/603, 99 | CP002729 | UMNK88 |
35 | Tail fiber assembly protein | 22792 | 23235 | 444 | 433/444, 98 | CP001368 | TW14359 |
36 | Hypothetical protein | 23256 | 23570 | 315 | 289/315, 92 | CP002729 | UMNK88 |
37 | Phage DNA invertase | 23713 | 24207 | 495 | 468/499, 94 | CP002967 | W |
38 | Phage tail sheath protein | 24362 | 25552 | 1,191 | 1173/1191, 98 | HE616528 | Shigella sonnei 53G |
39 | Phage tail tube protein | 25565 | 26083 | 519 | 518/519, 99 | CU928161 | S88 |
40 | Tail protein | 26140 | 26415 | 276 | 267/276, 97 | CP002516 | KO11 |
41 | Putative phage tail protein | 26412 | 26567 | 156 | 156/156, 100 | CP004009 | APEC O78 |
42 | Phage protein | 26560 | 29007 | 2,448 | 2390/2448, 98 | CU928162 | ED1a |
43 | gpU (tail protein) | 29022 | 29501 | 480 | 471/480, 98 | CP002967 | W |
44 | Gene D protein | 29501 | 30664 | 1,164 | 1137/1164, 98 | CU928161 | S88 |
45 | Putative positive regulator of lysis | 30671 | 30964 | 294 | 288/294, 98 | CP000970 | SMS-3-5 |
Positions refer to GenBank accession number KC618326.1. Homologies of 100% are in bold.
PCR scanning of P2-like genes.
The dissemination of characteristic cdt-V-flanking genes (n = 20) in a collection of CDT-producing and nonproducing strains was examined by PCR. At least one gene from each P2-like functional gene cluster was investigated. The list of results, together with the genotype of the strains, is given in Table 1. Fifteen out of 20 primer pairs designed specifically for the flanking regions (Table 2) yielded PCR products in all CDT-V-positive strains. The overlapping primer pairs covering the Q capsid gene and the spacer region between the Q gene and cdtA yielded only a PCR product in the O157:H43 strains tested, and the tail sheath monomer-encoding FI gene could be amplified only from strain T22 and the O157:NM CDT-V strains. Strains carrying different cdt types and the CDT-negative strains carried fewer P2-like genes. Interestingly, the CDT-negative atypical strain B47 and the CDT-IV-positive strain 28C were positive for 15 and 12 of the investigated sequences, respectively. Sequencing of the amplicons produced by the P2_PQ primer pair (Table 2) showed that in this 376-bp region of the Q capsid gene, there was a maximum of 14 SNPs, with only 3 of them leading to amino acid changes.
Phage induction experiments from CDT-V-positive strains.
In order to induce lysogenic bacteriophages and to isolate corresponding phage particles from the CDT-V-positive strains, phage induction experiments were carried out with 8 CDT-V-positive strains, marked in Table 1, by using UV light as well as mitomycin C and norfloxacin as inducing agents. Among CDT-V-positive strains, only EHEC O157:NM strains 702/88 and 493/89 released phages upon induction with mitomycin C, which were able to infect and lyse E. coli strain C600. PCR investigations revealed that none of these phages carried cdt-V genes (data not shown). These data indicate that the P2-like prophages harboring the cdt-V operon cannot be induced from these stx-negative and cdt-V-positive E. coli O157 strains.
DISCUSSION
We sequenced for the first time a whole P2-like prophage from the genome of E. coli O157:H43 strain T22 containing a cdt-V operon. The cdt-V sequence in strain T22 is highly similar to that of the cdt-V operon in strain AH-10 (16). Our results confirm and expand our knowledge based on previous reports that the cdt-V operon is flanked by P2-like phage sequences (12, 16) and on a more recent finding of an inducible P2-like phage carrying the cdt-V operon (19). The proximal P2-like regions in E. coli T22 are highly similar to the sequences published by the above-mentioned authors; however, in our study, the entire prophage genome was resolved and annotated. Among the lytic P2-like bacteriophages, phage L-413C (induced originally from a Yersinia pestis strain [24, 25]) has the highest homology compared to the prophage sequence of strain T22 (GenBank no. AY251033). Among other available prophage sequences, the P2-like prophage of E. coli O157:H7 strain TW14359 (GenBank no. CP001368.1) is the closest homologue. Compared to all the P2-like prophage sequences available in GenBank, the level of homology between the individual structure genes and their closest homologues is between 94 and 100% (Table 3). The Z/fun region in the original P2 phage, situated between the tail fiber gene G and the tail sheath gene FI, is known to host insertions of foreign genes (26). In the case of strain T22, the P2-like prophage does not contain a gene homologous to the G gene. Instead, the tail fiber genes between bp positions 20720 and 23571 (ORFs 33 to 36; see Table 3) seem to have a different origin in this strain, as they show only partial homology to P2-like phages or prophages, their closest homologues being tail fiber genes of a prophage carried by E. coli strain UMNK88. Among the flanking ORFs, ORF 32 corresponds to gene H (upstream of G) and ORF 37 to gene FI; therefore, the insertion of ORFs 33 to 36 occurred essentially in the Z/fun region, with the additional deletion of gene G. Nilsson and coworkers suggested site-specific recombination as a possible mechanism for the insertion of foreign genes in this region (27). The potential recombination of prophages in E. coli O157 was already reported (28), and it was also suggested that the mosaic structure of prophages is the result of extensive exchange of genetic material among different bacteriophages and also their hosts (13), like in the case of lambdoid prophages harboring the cdt-I and cdt-IV operons (13, 14). The genome sequencing project of strain T22 (29) confirmed that the integration site of the prophage is between the cpxP and fieF genes. This is the same site where P2-like prophages can be found in a further four E. coli strains according to publicly available GenBank entries (accession no. CP002967.1, CP002797.2, CP001969.1, and CP000970.1).
The integration site of the cdt-V operon within the prophage, the TO region, is known to be an integration hot spot for foreign genes in P2-like phages (26). This region is named after the phage immunity genes tin and old, encoded by the lytic phages in this region. It has been suggested that this site is a potential carrier of advantageous genes for the host (26). The carriage of a potent virulence-associated gene, like cdt-V, provides evidence for this notion. It also has to be mentioned that, so far, CDT-V is the only established virulence factor with its genes inserted into the TO region of P2-like prophages. In complete P2-like prophage sequences available in GenBank, the TO region is usually occupied by a gene coding for a hypothetical protein, or in the case of EHEC O157:H7 strain TW14359, the genes of a putative virulence factor, one of which shows partial homology to a eukaryotic serine esterase and a gene of Bacillus amyloliquefaciens (30). Genes encoding reverse transcriptases have been also reported in the TO regions of P2-like prophages found in the genomes of ECOR strains (31). The foreign origin of the cdt-V operon is also supported by the considerable difference between the GC content of the operon and the prophage (41% versus 53%).
The fact that no phages were detected from any of the induced cdt-V-positive strains, neither by induction with UV light, mitomycin C, or norfloxacin, is in harmony with current knowledge that P2-like phages are classified as noninducible in E. coli (26). This finding also suggests that the inducible prophages found in STEC strains (19) may represent an earlier evolutionary stage of the cdt-V-carrying P2-like prophages in E. coli and that the phages, which we were unable to induce, could have become temperated by adapting to the host organism.
The P2-like prophage sequences seem to be characteristic for the CDT-V-positive strains, with few differences that can be attributed to the adaptation processes in the various hosts. The presence of the L-413C-like C gene in the stx- and eae-negative O157 CDT-V strains, relative to EHEC CDT-V strains, can be explained with the high variability of this gene, which therefore can be used as a marker to identify and distinguish different P2-like phage variants (26). Our results suggest that while the stx-negative cdt-V O157:H43 strains uniformly contain a P2-like variant with an L-413C-like C gene, the P2-like prophages in the other strains may carry different variants of this gene, as they represent other evolutionary lineages of P2-like phages. It will be an important future task to evaluate whether different P2-like bacteriophage variants may be associated with individual E. coli clonal groups and/or with different virulence factors in their TO region. An interesting finding was the carriage of P2-like genes by strain 28C, an extraintestinal pathogenic E. coli strain, which harbors the cdt-IV operon flanked by lambda phage-like genes (14). This observation may indicate that the P2-like genes could be located elsewhere in the E. coli 28C genome. Alternatively, recombination between a P2-like and a lambdoid phage cannot be excluded. Another example of P2-like phages serving as vehicles for foreign DNA can apparently be found in the CDT-negative atypical O157:NM strain B47, which also carries most of the P2-like prophage genes investigated and is where the integration site between cpxP and fieF also seems to be occupied. Strain B47 probably also carries a nearly complete P2-like prophage similar to other investigated O157 CDT-V strains, with as-yet-unknown genes inserted into its integration hot spots. On the other hand, the PCRs specific for the integration site of the P2-like prophage were negative in the case of the O157:NM EHEC strains, suggesting a different integration site for the prophage in these isolates. The atypical O157 strains harboring P2-like genes are phylogenetically distinct from those that do not carry them. While the CDT-negative O157 strains (T4, B20, and B54; all representing the O157:H12 serotype) belong to phylogenetic group A, the CDT-positive O157 strains (T22, T16, T34, T49, T50), as well as strain B47, belong to phylogenetic group B1 (Table 1) (32).
It has been proposed that the presence of P2-like phage sequences suggests the common acquisition of the cdt-V operon in O157:NM EHEC strains after the lineage has diverged from the O157:H7 strains (12). While there is indeed a strong association between O157:NM strains and the presence of CDT-V (17, 19, 33), several strains from other serotypes, both from healthy cattle (23, 33) and from cases of human diarrhea (15, 16, 17, 34), express CDT-V. These findings, together with the results of our study, indicate that while the cdt-V genes are rather conserved, the carrier P2-like phages became diverse during the evolution of their hosts, and this event in most cases may have resulted in loss of their mobility. These facts suggest a more diverse evolutionary and/or transductional history of the cdt-V operon and its carrying of P2-like prophages. The highly conserved cdt-V operon within more variable and potentially inactivated bacteriophage genomes may result from selective pressure to maintain a functional cdt gene cluster and to stabilize this cargo determinant by inactivation of this bacteriophage genome. Further investigations of flanking regions and P2-like prophage sequences in CDT-V-positive strains are expected to help in clarifying the evolutionary background of the distribution of these variants.
ACKNOWLEDGMENT
This work was supported by the Hungarian Research Foundation (OTKA), grant number K 81252. U.D. was supported by the German Research Foundation (DO 789/4-1; SFB1009 TP B05).
Footnotes
Published ahead of print 14 June 2013
REFERENCES
- 1. Nougayrède J, Taieb F, De Rycke J, Oswald E. 2005. Cyclomodulins: bacterial effectors that modulate the eukaryotic cell cycle. Trends Microbiol. 13:103–110 [DOI] [PubMed] [Google Scholar]
- 2. Oswald E, Nougayrède J, Taieb F, Sugai M. 2005. Bacterial toxins that modulate host cell-cycle progression. Curr. Opin. Microbiol. 8:83–91 [DOI] [PubMed] [Google Scholar]
- 3. Jinadasa RN, Bloom SE, Weiss RS, Duhamel GE. 2011. Cytolethal distending toxin: a conserved bacterial genotoxin that blocks cell cycle progression, leading to apoptosis of a broad range of mammalian cell lineages. Microbiology 157:1851–1875 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Scott DA, Kaper JB. 1994. Cloning and sequencing of the genes encoding Escherichia coli cytolethal distending toxin. Infect. Immun. 62:244–251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Nesić D, Hsu Y, Stebbins CE. 2004. Assembly and function of a bacterial genotoxin. Nature 429:429–433 [DOI] [PubMed] [Google Scholar]
- 6. Pérès SY, Marchès O, Daigle F, Nougayrède JP, Herault F, Tasca C, De Rycke J, Oswald E. 1997. A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Mol. Microbiol. 24:1095–1107 [DOI] [PubMed] [Google Scholar]
- 7. Comayras C, Tasca C, Pérès SY, Ducommun B, Oswald E, De Rycke J. 1997. Escherichia coli cytolethal distending toxin blocks the HeLa cell cycle at the G2/M transition by preventing cdc2 protein kinase dephosphorylation and activation. Infect. Immun. 65:5088–5095 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Bielaszewska M, Sinha B, Kuczius T, Karch H. 2005. Cytolethal distending toxin from Shiga toxin-producing Escherichia coli O157 causes irreversible G2/M arrest, inhibition of proliferation, and death of human endothelial cells. Infect. Immun. 73:552–562 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Johnson WM, Lior H. 1988. A new heat-labile cytolethal distending toxin (CLDT) produced by Escherichia coli isolates from clinical material. Microb. Pathog. 4:103–113 [DOI] [PubMed] [Google Scholar]
- 10. Pickett CL, Cottle DL, Pesci EC, Bikah G. 1994. Cloning, sequencing, and expression of the Escherichia coli cytolethal distending toxin genes. Infect. Immun. 62:1046–1051 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Tóth I, Hérault F, Beutin L, Oswald E. 2003. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J. Clin. Microbiol. 41:4285–4291 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Janka A, Bielaszewska M, Dobrindt U, Greune L, Schmidt MA, Karch H. 2003. Cytolethal distending toxin gene cluster in enterohemorrhagic Escherichia coli O157:H− and O157:H7: characterization and evolutionary considerations. Infect. Immun. 71:3634–3638 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Asakura M, Hinenoya A, Alam MS, Shima K, Zahid SH, Shi L, Sugimoto N, Ghosh AN, Ramamurthy T, Faruque SM, Nair GB, Yamasaki S. 2007. An inducible lambdoid prophage encoding cytolethal distending toxin (Cdt-I) and a type III effector protein in enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 104:14483–14488 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Tóth I, Nougayrède JP, Dobrindt U, Ledger TN, Boury M, Morabito S, Fujiwara T, Sugai M, Hacker J, Oswald E. 2009. Cytolethal distending toxin type I and type IV genes are framed with lambdoid prophage genes in extraintestinal pathogenic Escherichia coli. Infect. Immun. 77:492–500 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Bielaszewska M, Fell M, Greune L, Prager R, Fruth A, Tschäpe H, Schmidt MA, Karch H. 2004. Characterization of cytolethal distending toxin genes and expression in Shiga toxin-producing Escherichia coli strains of non-O157 serogroups. Infect. Immun. 72:181–186 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Hinenoya A, Naigita A, Ninomiya K, Asakura M, Shima K, Seto K, Tsukamoto T, Ramamurthy T, Faruque SM, Yamasaki S. 2009. Prevalence and characteristics of cytolethal distending toxin-producing Escherichia coli from children with diarrhea in Japan. Microbiol. Immunol. 53:206–215 [DOI] [PubMed] [Google Scholar]
- 17. Friedrich AW, Lu S, Bielaszewska M, Prager R, Bruns P, Xu J, Tschäpe H, Karch H. 2006. Cytolethal distending toxin in Escherichia coli O157:H7: spectrum of conservation, structure, and endothelial toxicity. J. Clin. Microbiol. 44:1844–1846 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Osek J. 2005. Detection of cytolethal distending toxin genes in Shiga toxin-producing Escherichia coli isolated from different sources. Bull. Vet. Inst. Pulawy 49:153–156 [Google Scholar]
- 19. Allué-Guardia A, García-Aljaro C, Muniesa M. 2011. Bacteriophage encoding cytolethal distending toxin type V gene induced from nonclinical Escherichia coli isolates. Infect. Immun. 79:3262–3272 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Kim J, Kim J, Choo Y, Jang H, Choi Y, Chung J, Cho S, Park M, Lee B. 2009. Detection of cytolethal distending toxin and other virulence characteristics of enteropathogenic Escherichia coli isolates from diarrheal patients in Republic of Korea. J. Microbiol. Biotechnol. 19:525–529 [DOI] [PubMed] [Google Scholar]
- 21. Birnboim HC, Doly J. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513–1523 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Hertman I, Luria SE. 1967. Transduction studies on the role of a rec+ gene in the ultraviolet induction of prophage lambda. J. Mol. Biol. 23:117–133 [DOI] [PubMed] [Google Scholar]
- 23. Tóth I, Schmidt H, Kardos G, Lancz Z, Creuzburg K, Damjanova I, Pászti J, Beutin L, Nagy B. 2009. Virulence genes and molecular typing of different groups of Escherichia coli O157 strains in cattle. Appl. Environ. Microbiol. 75:6282–6291 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Larina VS, Anisimov PI, Adamov AK. 1970. A novel strain of plague bacteriophage for identification of Pasteurella pestis. Probl. Particularly Dangerous Infect. 11:132–136 [Google Scholar]
- 25. Garcia E, Chain P, Elliott JM, Bobrov AG, Motin VL, Kirillina O, Lao V, Calendar R, Filippov AA. 2008. Molecular characterization of L-413C, a P2-related plague diagnostic bacteriophage. Virology 372:85–96 [DOI] [PubMed] [Google Scholar]
- 26. Nilsson AS, Haggård-Ljungquist E. 2007. Evolution of P2-like phages and their impact on bacterial evolution. Res. Microbiol. 158:311–317 [DOI] [PubMed] [Google Scholar]
- 27. Nilsson AS, Karlsson JL, Haggård-Ljungquist E. 2004. Site-specific recombination links the evolution of P2-like coliphages and pathogenic bacteria. Mol. Biol. Evol. 21:1–13 [DOI] [PubMed] [Google Scholar]
- 28. Asadulghani M, Ogura Y, Ooka T, Itoh T, Sawaguchi A, Iguchi A, Nakayama K, Hayashi T. 2009. The defective prophage pool of Escherichia coli O157: prophage-prophage interactions potentiate horizontal transfer of virulence determinants. PLoS Pathog. 5:e10000408. 10.1371/journal.ppat.1000408 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Sváb D, Horváth B, Szűcs A, Maróti G, Tóth I. 2013. Draft genome sequence of an Escherichia coli O157:H43 strain isolated from cattle. Genome Announc. 1:e00263–13. 10.1128/genomeA.00263-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Kulasekara BR, Jacobs M, Zhou Y, Wu Z, Sims E, Saenphimmachak C, Rohmer L, Ritchie JM, Radey M, McKevitt M, Freeman TL, Hayden H, Haugen E, Gillett W, Fong C, Chang J, Beskhlebnaya V, Waldor MK, Samadpour M, Whittam TS, Kaul R, Brittnacher M, Miller SI. 2009. Analysis of the genome of the Escherichia coli O157:H7 2006 spinach-associated outbreak isolate indicates candidate genes that may enhance virulence. Infect. Immun. 77:3713–3721 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Odegrip R, Nilsson AS, Haggård-Ljungquist E. 2006. Identification of a gene encoding a functional reverse transcriptase within a highly variable locus in the P2-like coliphages. J. Bacteriol. 188:1643–1647 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Sváb D, Tóth I. 2012. Allelic types of long polar fimbriae in bovine and human Escherichia coli. O157 strains. Acta Vet. Hung. 60:1–15 [DOI] [PubMed] [Google Scholar]
- 33. Orth D, Grif K, Dierich MP, Würzner R. 2006. Cytolethal distending toxins in Shiga toxin-producing Escherichia coli: alleles, serotype distribution and biological effects. J. Med. Microbiol. 55:1487–1492 [DOI] [PubMed] [Google Scholar]
- 34. Bielaszewska M, Stoewe F, Fruth A, Zhang W, Prager R, Brockmeyer J, Mellmann A, Karch H, Friedrich AW. 2009. Shiga toxin, cytolethal distending toxin, and hemolysin repertoires in clinical Escherichia coli O91 isolates. J. Clin. Microbiol. 47:2061–2066 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. De Rycke J, Plassiart G. 1990. Toxic effects for lambs of cytotoxic necrotising factor from Escherichia coli. Res. Vet. Sci. 49:349–354 [PubMed] [Google Scholar]
- 36. Karch H, Böhm H, Schmidt H, Gunzer F, Aleksic S, Heesemann J. 1993. Clonal structure and pathogenicity of Shiga-like toxin-producing, sorbitol-fermenting Escherichia coli O157:H−. J. Clin. Microbiol. 31:1200–1205 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Iguchi A, Thomson NR, Ogura Y, Saunders D, Ooka T, Henderson IR, Harris D, Asadulghani M, Kurokawa K, Dean P, Kenny B, Quail MA, Thurston S, Dougan G, Hayashi T, Parkhill J, Frankel G. 2009. Complete genome sequence and comparative genome analysis of enteropathogenic Escherichia coli O127:H6 strain E2348/69. J. Bacteriol. 191:347–354 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11–22 [DOI] [PubMed] [Google Scholar]
- 39. Appleyard RK. 1954. Segregation of new lysogenic types during growth of a doubly lysogenic strain derived from Escherichia coli K12. Genetics 39:440–452 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Woodcock DM, Crowther PJ, Doherty J, Jefferson S, DeCruz E, Noyer-Weidner M, Smith SS, Michael MZ, Graham MW. 1989. Quantitative evaluation of Escherichia coli host strains for tolerance to cytosine methylation in plasmid and phage recombinants. Nucleic Acids Res. 17:3469–3478 [DOI] [PMC free article] [PubMed] [Google Scholar]