Skip to main content
International Journal of Clinical and Experimental Pathology logoLink to International Journal of Clinical and Experimental Pathology
. 2013 Aug 15;6(9):1826–1838.

miRNA-9 expression is upregulated in the spinal cord of G93A-SOD1 transgenic mice

Fenghua Zhou 1, Yingjun Guan 2, Yanchun Chen 2, Caixia Zhang 2, Li Yu 2, Hailing Gao 2, Hongmei Du 2, Bing Liu 2, Xin Wang 3
PMCID: PMC3759489  PMID: 24040447

Abstract

The pathogenesis of amyotrophic lateral sclerosis (ALS) remains unclear. Accumulating evidence indicates that various miRNAs expressed in a spatially and temporally controlled manner in the nervous system have an important function in the development of neurodegenerative diseases. The present study aimed to determine the expression and cellular distribution of miRNA-9 in the spinal cord of G93A-SOD1 mutant mice at different time points (post-natal 95, 108 and 122 d). miRNA expression was evaluated by microarray analysis; differentially expressed miRNAs were validated by RT-qPCR. The cellular distribution of miRNA-9 was analyzed by in-situ hybridization. Microarray results indicated for the first time that various miRNAs were differentially expressed between the G93A-SOD1 mutant mice and the littermate control mice. miRNA-9 expression was upregulated at 95, 108, and 122 d as validated by microarray analysis, RT-qPCR, and ISH. ISH results also showed that the miRNA-9-positive cells mainly expressed in the cytoplasm were located in the dorsal horn and the ventral horn of the spinal cord. The majority of miRNA-9-positive cells were located in the ventral horn of the gray matter, the locus of neurodegeneration. These results indicated that the differential expression of miRNA-9 may have an important function in the pathogenesis of G93A-SOD1 transgenic mice.

Keywords: ALS, miRNA-9, differential expression

Introduction

Amyotrophic lateral sclerosis (ALS) is an adult-onset neurodegenerative disorder, which is characterized by the progressive and selective loss of motor neurons in the cerebral cortex, the brainstem, and the spinal cord [1,2]. However, effective treatments to reduce motor neuron degeneration are not yet available [3]. Sporadic (no family history) and genetic (inherited) forms of ALS have been reported. The majority of ALS cases are sporadic (SALS), and approximately 5 to 10% are familial (FALS). Mutations in the superoxide mutase 1 (SOD1) gene represent one of the most commonly identified causes of FALS, accounting for approximately 20% of the cases [4]. To date, the pathogenesis of ALS remains largely unknown.

microRNAs (miRNAs) are short (approximately 22 nucleotides in length), highly conserved, and single-stranded RNA molecules that regulate gene expression by either promoting the degradation or inhibiting the translation of target mRNAs [5]. miRNAs are involved in various physiological and pathological processes, such as tumorigenesis [1,6]. Studies [7-9] have demonstrated that miRNAs are associated with the development of the central nervous system and the pathogenesis of neurodegenerative diseases. However, few studies on miRNAs in ALS have been conducted. In the present study, the differential expression of miRNAs and the distribution of miRNA-9 in the spinal cord of G93A-SOD1 transgenic mice were investigated.

Materials and methods

Animals and tissues

Transgenic mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA). The mice express a low copy number of a mutant form of superoxide dismutase (SOD1) with glycine-93 replaced with alanine (G93A-SOD1), which can mimic the progression of human ALS symptoms. The mice in this study were housed under standard conditions: a constant temperature of 22 ± 1 °C; 40% relative humidity; 12 h / 12 h light/dark cycle; and free access to food and water. The mice were crossbred and PCR genotyping was performed using genomic DNA from the tails of newborn mice according to the genotyping protocol of Jackson Laboratory [10]. The Animal Ethics Committee of Weifang Medical University approved the experimental protocols. The mice were then divided in two groups: G93A-SOD1 transgenic and wild-type groups. The wild-type group was used as the control group. The mice from each group were sacrificed at early (95 d), middle (108 d), and late (122 d) stages. Spinal cord samples were collected immediately. Some of the samples were stored in liquid nitrogen for microarray analysis and RT-qPCR. The other samples were perfused intracardially with 4% paraformaldehyde in 0.1 M phosphate buffer and fixed in 4% paraformaldehyde for in-situ hybridization analysis.

Detection of miRNA expression

Exiqon miRCURYTM LNA array v.18.0 containing approximately 1200 capture probes and covering all of the mouse miRNAs was used to quantify genome-wide miRNA expression in the two groups. Each sample (1 μg) was 3-end-labeled with Hy3TM fluorescent labeling kit (Exiqon, Vedbaek) and hybridized on LNA arrays according to the manufacturer’s instructions. The slides were then scanned using Axon GenePix 4000B microarray scanner. The scanned images were imported in GenePix Pro 6.0 software (Axon) for grid alignment and data extraction. The replicated miRNAs were averaged and the miRNAs with intensities ≥ 30 in all of the samples were chosen to calculate the normalization factor. The differentially expressed miRNAs were identified by fold change filtering. Hierarchical clustering was performed to identify the distinguishable miRNA expression profiling among the samples by using MEV software (v4.6, TIGR).

RNA isolation and cDNA synthesis

RT-qPCR was performed to validate the microarray results. Total RNA was isolated from the spinal cord derived from G93A-SOD1 and wild-type mice by using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. The amount of RNA was quantified using an ND-1000 spectrophotometer (Nano-drop). RNA quality was verified by measuring the OD260/OD280 ratio. The total RNA (1 μg) was reverse transcribed to produce cDNA by using M-MLV transcriptase (Promega). The following primers were used in reverse transcription: (miRNA-9), 5’-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATACA-3’; (U6), 5’-CGCTTCACGAATTTGCGTGTCAT-3’. The SuperScript III cDNA synthesis reaction was diluted at a ratio of 1:2 by using sterile water for RT-qPCR.

RT-qPCR

Each qPCR was performed for miRNA-9 and U6 in a final volume of 20 μl. Endogenous U6 expression was used as the control treatment. The reaction system comprised different components. For miRNA-9, the following substances were used: 10 μl of 2× SoFast TMEva Green Supermix mix (BIO-RAD, Singapore); 1 μl of miRNA-9 primer assay; 4 μl of diluted cDNA, and 4 μl of sterile water. For U6, the following materials were used: 10 μl of 2× SoFast TMEvaGreen Supermix mix (BIO-RAD); 0.5 μl of U6 primer assay; 4 μl of diluted cDNA; and 5 μl of sterile water. The following primers were used in qPCR: (miRNA-9) sense, 5’-GGGTCTTTGGTTATCTAGC-3’; antisense, 5’-TGCGTGTCGTGGAGTC-3’; (U6) sense, 5’-GCTTCGGCAGCACATATACTAAAAT-3’; and antisense, 5’-CGCTTCACGAATTTGCGTGTCAT-3’. Amplification was performed using the following program cycle: initial melting temperature, 95 °C for 5 min followed by 40 cycles of 95 °C for 5 s; 60 °C for 30 s; 72 °C for 30 s; and 80 °C for 10 s. Each cDNA sample was analyzed in triplicate. The difference in the relative expression of miRNA-9 between ALS and wild-type mice was calculated using the 2-ΔΔCt method.

In situ hybridization

5-DIG labeled miRCURY LNA™ detection probe (Product no. 88078-01, sequence: TCATACAGCTAGATAACCAAAGA, Exiqon) was used for ISH to detect the miRNA-9 expression in the spinal cord. The samples were perfused intracardially with 4% paraformaldehyde in 0.1 M phosphate buffer and fixed in 4% paraformaldehyde overnight at 4 °C. The samples were then dehydrated in 30% sucrose/PB O/N at 4 °C and cut into 10 μm sections from OCT embedded FrFr blocks and mounted on clean, non-contaminated SuperFrost/Plus slides. The samples were air dried for 2 h. The sections were then fixed in 4% paraformaldehyde/PBS (pH 7.2) at 4 °C for 10 min, digested with proteinase K (Roche Diagnostics) at 10 μg/mL at 37 °C for 10 min, acetylated for 10 min, and dehydrated in fresh gradient ethanol solutions. The hybridization mixture was heated (probe final concentration: 25 nM) at 65 °C for 5 min and chilled on ice. The sections were applied with 5 μl of hybridization mix, hybridized overnight 53 °C, and covered with Nescofilm in a humidified chamber with 50% formamide, 1× SSC. The cover slips were removed from 5× SSC at room temperature (RT). The sections were washed twice for 30 min at 53 °C in 50% formamide and 0.1% Tween-20, 1× SSC. The sections were washed thrice for 15 min in 0.2× SSC and PBS at RT. The sections were then blocked in blocking solution with 10% heat-inactivated goat serum and 0.1% Tween-20 for 1 h at RT and finally incubated for 1.5 h at RT in anti-dioxygenine antibody (anti-DIG-PA Fab fragments, Roche Diagnostics) diluted to 1:800 with the blocking solution. After the sample was washed twice for 20 min with 0.1% Tween-20 in PBS, phosphatase activity was determined using nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate p-toluidine as the stabilized solution (Eurobio) for 5 h. The sections were finally mounted with 80% glycerol.

Statistical analysis

Data are presented as the mean ± standard deviation (SD). The homogeneity of variance was performed using SPSS 13.0 software. Independent sample t-tests were performed when normality and equality of variance were observed to compare the differences in miRNA-9 between ALS and wild-type mice. The significant level was defined as p < 0.05.

Results

Differential expression of miRNAs between the G93A-SOD1 transgenic mice and the wild-type mice

Among the 1227 detected miRNAs, 45, 67, and 205 miRNAs were upregulated by twofold and 78, 68, and 116 miRNAs were downregulated by twofold in the ALS transgenic mice than in the wild-type mice at 95, 108, and 122 d, respectively (Tables 1, 2,. 3, 4, 5 and 6).

Table 1.

miRNAs upregulated by more than twofold at 95 d

Name Fold change Name Fold change Name Fold change
mmu-miR-137-5p 2.452403 mmu-miR-532-5p 2.289189 mmu-miR-3970 2.793397
mmu-miR-695 2.783668 mmu-miR-1958 2.371464 mmu-let-7a-5p 3.236796
mmu-miR-10a-5p 2.111037 mmu-miR-33-5p 2.27027 mmu-miR-21a-5p 2.38365
mmu-miR-330-5p 2.085822 mmu-miR-92a-2-5p 2.601351 mmu-miR-488-3p 2.043919
mmu-miR-872-5p 2.008821 mmu-miR-107-3p 2.135071 mmu-miR-181b-5p 2.834276
mmu-miR-1953 5.809685 mmu-miR-1892 2.21982 mmu-miR-145a-5p 2.208494
mmu-miR-30a-5p 2.00104 mmu-miR-9-5p 2.18264 mmu-miR-323-3p 2.132593
mmu-miR-541-3p 2.531624 mmu-miR-137-3p 2.160253 mmu-miR-338-3p 3.961199
mmu-miR-5115 2.591717 mmu-miR-344b-3p 2.579673 mmu-miR-3068-3p 2.391892
mmu-miR-679-5p 2.714137 mmu-miR-219-5p 5.587106 mmu-miR-346-5p 2.65124
mmu-miR-136-5p 2.135088 mmu-miR-770-3p 2.01685 mmu-miR-214-3p 3.488871
mmu-miR-29b-3p 3.202007 mmu-miR-29c-3p 3.104722 mmu-miR-701-5p 2.211149
mmu-miR-5105 2.055702 mmu-miR-29a-3p 2.744773 mmu-miR-28a-5p 2.307286
mmu-miR-128-3p 2.706465 mmu-let-7f-5p 4.536757 mmu-miR-758-5p 3.254054
mmu-miR-883b-5p 2.334371 mmu-miR-18a-3p 2.041815 mmu-miR-380-3p 2.220855

Table 2.

miRNAs downregulated by more than twofold at 95 d

Name Fold change Name Fold change Name Fold change
mmu-miR-27b-3p 0.476114 mmu-miR-193a-3p 0.279701 mmu-miR-3069-3p 0.384301
mmu-miR-146b-5p 0.428458 mmu-miR-186-5p 0.275878 mmu-miR-433-3p 0.196247
mmu-miR-487b-3p 0.478313 mmu-miR-337-3p 0.313496 mmu-miR-1843a-5p 0.415933
mmu-miR-340-5p 0.351139 mmu-miR-25-5p 0.325169 mmu-miR-127-5p 0.246626
mmu-miR-34c-5p 0.44376 mmu-miR-543-3p 0.176221 mmu-miR-106b-5p 0.336679
mmu-miR-139-5p 0.438943 mmu-miR-411-3p 0.208108 mmu-miR-96-5p 0.361927
mmu-miR-382-5p 0.279887 mmu-miR-3096a-3p 0.228304 mmu-miR-7a-5p 0.273277
mmu-miR-1843a-3p 0.412089 mmu-miR-466a-3p 0.49247 mmu-miR-466a-3p 0.404655
mmu-miR-29b-1-5p 0.419107 mmu-miR-34b-5p 0.300033 mmu-miR-331-3p 0.226319
mmu-miR-182-5p 0.138739 mmu-miR-434-5p 0.33917 mmu-miR-190a-3p 0.443964
mmu-miR-210-3p 0.232322 mmu-miR-99b-5p 0.175193 mmu-miR-3096a-5p 0.409574
mmu-miR-132-5p 0.371622 mmu-miR-495-3p 0.288044 mmu-miR-30c-1-3p 0.471495
mmu-miR-3094-3p 0.416216 mmu-miR-379-5p 0.226204 mmu-miR-34a-5p 0.416461
mmu-miR-342-5p 0.180964 mmu-miR-153-3p 0.256331 mmu-miR-455-3p 0.251744
mmu-miR-154-3p 0.452409 mmu-miR-129-5p 0.156382 mmu-miR-873a-5p 0.433559
mmu-miR-190a-5p 0.354376 mmu-miR-344-3p 0.346847 mmu-miR-1839-3p 0.283954
mmu-miR-674-5p 0.203119 mmu-miR-3069-5p 0.244422 mmu-miR-3475 0.488254
mmu-miR-212-3p 0.406146 mmu-miR-222-3p 0.178797 mmu-miR-339-5p 0.257378
mmu-miR-423-3p 0.46661 mmu-miR-3962 0.450364 mmu-miR-125b-2-3p 0.353998
mmu-miR-338-5p 0.342989 mmu-miR-1843b-5p 0.201995 mmu-miR-10b-3p 0.405634
mmu-miR-212-5p 0.383357 mmu-miR-219-2-3p 0.424644 mmu-miR-185-5p 0.223381
mmu-miR-467b-5p 0.360187 mmu-miR-125a-3p 0.431444 mmu-miR-146a-5p 0.28815
mmu-miR-298-5p 0.171883 mmu-miR-708-3p 0.256667 mmu-miR-143-3p 0.389059
mmu-miR-376a-3p 0.221935 mmu-miR-320-3p 0.33144 mmu-miR-652-3p 0.475185
mmu-miR-342-3p 0.362724 mmu-miR-22-3p 0.325647 mmu-miR-328-3p 0.41422
mmu-miR-30d-5p 0.419268 mmu-miR-195a-5p 0.288666 mmu-miR-154-5p 0.41497

Table 3.

miRNAs upregulated by more than twofold at 108 d

Name Fold change Name Fold change Name Fold change
mmu-miR-34c-3p 2.021835 mmu-miR-26b-5p 3.34617 mmu-miR-376a-3p 3.44564
mmu-miR-3068-5p 2.904925 mmu-miR-125a-5p 2.090313 mmu-miR-342-3p 11.08121
mmu-miR-665-3p 2.030384 mmu-miR-101b-3p 2.550437 mmu-miR-219-5p 5.073216
mmu-miR-151-5p 2.602618 mmu-miR-369-3p 2.406828 mmu-let-7d-5p 4.153295
mmu-miR-465a-5p 2.359133 mmu-miR-128-3p 9.513007 mmu-miR-155-3p 2.426607
mmu-miR-136-3p 2.516482 mmu-miR-148b-3p 4.393795 mmu-miR-34b-5p 4.448474
mmu-miR-10a-5p 2.711264 mmu-miR-33-5p 2.026692 mmu-miR-434-5p 2.278956
mmu-miR-181a-5p 4.833038 mmu-miR-30c-5p 2.643801 mmu-miR-101a-3p 2.115394
mmu-miR-30a-5p 4.727729 mmu-miR-708-5p 2.341402 mmu-miR-140-5p 6.475232
mmu-miR-151-3p 2.453423 mmu-miR-1949 2.130279 mmu-miR-377-3p 3.186687
mmu-let-7g-5p 5.099158 mmu-miR-210-3p 2.678186 mmu-miR-382-3p 2.993366
mmu-miR-744-5p 3.089307 mmu-miR-5099 3.283915 mmu-miR-26a-5p 3.481209
mmu-miR-183-5p 2.439446 mmu-miR-98-5p 2.275855 mmu-miR-99a-5p 2.218298
mmu-miR-487b-3p 2.050231 mmu-miR-190a-5p 2.904538 mmu-miR-29c-3p 3.181396
mmu-miR-101a-3p 4.40404 mmu-miR-335-5p 3.390922 mmu-miR-320-3p 2.008822
mmu-miR-1224-5p 2.698565 mmu-miR-127-3p 2.198304 mmu-let-7i-5p 2.472667
mmu-miR-299a-3p 2.703685 mmu-miR-384-3p 4.501741 mmu-miR-126-3p 7.362062
mmu-miR-326-3p 2.084344 mmu-miR-181a-1-3p 2.095356 mmu-miR-195a-5p 3.209104
mmu-miR-5112 2.420771 mmu-miR-192-5p 2.014765 mmu-miR-29a-3p 3.794807
mmu-miR-132-3p 3.406183 mmu-miR-9-5p 3.190483 mmu-miR-376b-3p 3.904807
mmu-miR-23a-3p 4.193261 mmu-miR-137-3p 13.387 mmu-miR-21a-5p 2.047187
mmu-miR-139-5p 2.806742 mmu-miR-344b-3p 3.249742 mmu-miR-344d-3p 2.494471
mmu-let-7d-3p 3.009084        

Table 4.

miRNAs downregulated by more than twofold at 108 d

Name Fold change Name Fold change Name Fold change
mmu-miR-711 0.420725 mmu-miR-718 0.474571 mmu-miR-3092-3p 0.311307
mmu-miR-149-5p 0.492498 mmu-miR-3102-3p.2-3p 0.436533 mmu-miR-3072-5p 0.363899
mmu-miR-543-5p 0.390038 mmu-miR-5103 0.387455 mmu-miR-3473c 0.486902
mmu-miR-1247-5p 0.450099 mmu-miR-27a-5p 0.483725 mmu-miR-5119 0.346658
mmu-miR-210-5p 0.47395 mmu-miR-204-5p 0.448887 mmu-miR-223-3p 0.463509
mmu-miR-5109 0.462526 mmu-miR-292-5p 0.498894 mmu-miR-710 0.487984
mmu-miR-302a-3p 0.398372 mmu-miR-1927 0.450318 mmu-miR-883a-5p 0.455241
mmu-miR-3067-5p 0.438496 mmu-miR-320-5p 0.458729 mmu-miR-3067-3p 0.272833
mmu-miR-466c-5p 0.499798 mmu-miR-196a-2-3p 0.495296 mmu-miR-34a-5p 0.345214
mmu-miR-21a-3p 0.478556 mmu-miR-671-5p 0.403675 mmu-miR-3059-5p 0.497316
mmu-miR-804 0.461477 mmu-miR-3085-3p 0.480417 mmu-miR-664-3p 0.489577
mmu-miR-296-5p 0.475431 mmu-miR-3110-5p 0.413173 mmu-miR-684 0.297214
mmu-miR-20b-5p 0.476646 mmu-miR-874-5p 0.48141 mmu-miR-20a-5p 0.414289
mmu-miR-18b-3p 0.390485 mmu-miR-433-3p 0.465635 mmu-miR-674-3p 0.392879
mmu-miR-1306-5p 0.447726 mmu-miR-344i 0.490352 mmu-miR-10b-3p 0.478392
mmu-miR-5620-3p 0.406891 mmu-miR-764-5p 0.260616 mmu-miR-877-3p 0.354168
mmu-miR-5131 0.291022 mmu-miR-127-5p 0.359889 mmu-miR-701-5p 0.37725
mmu-miR-351-5p 0.480091 mmu-miR-193b-3p 0.440898 mmu-miR-683 0.491099
mmu-miR-3066-3p 0.476217 mmu-let-7f-5p 0.456079 mmu-miR-1907 0.44802
mmu-miR-496a-5p 0.351145 mmu-miR-547-3p 0.25347 mmu-miR-1224-3p 0.459508
mmu-miR-1188-3p 0.456196 mmu-miR-3086-5p 0.254644 mmu-miR-3105-5p 0.37575
mmu-miR-324-3p 0.440787 mmu-miR-3092-5p 0.355693 mmu-miR-449c-3p 0.431572
mmu-miR-1193-3p 0.396077 mmu-miR-3544-3p 0.496269    

Table 5.

miRNAs upregulated by more than twofold at 122 d

Name Fold change Name Fold change Name Fold change
mmu-miR-711 2.32896 mmu-miR-678 3.872368 mmu-miR-377-3p 179.3738
mmu-miR-31-5p 2.533274 mmu-miR-669g 4.480121 mmu-miR-382-3p 2.885197
mmu-miR-103-3p 5.285574 mmu-miR-670-5p 4.910772 mmu-miR-26a-5p 3.440347
mmu-miR-1198-5p 2.528653 mmu-miR-467d-3p 5.19185 mmu-miR-374c-3p 2.945379
mmu-miR-1961 30.98079 mmu-miR-145a-3p 2.526941 mmu-miR-3081-5p 3.50498
mmu-miR-27b-3p 18.45688 mmu-miR-1949 3.034497 mmu-miR-296-3p 2.526625
mmu-miR-3066-5p 2.31918 mmu-miR-2861 3.601861 mmu-miR-467b-3p 3.343922
mmu-miR-96-3p 6.419321 mmu-miR-153-5p 7.510829 mmu-miR-3968 2.904469
mmu-miR-210-5p 7.216136 mmu-miR-1251-3p 7.230803 mmu-miR-5616-3p 5.676448
mmu-miR-350-3p 4.543493 mmu-miR-3091-3p 6.118372 mmu-miR-125a-3p 2.911635
mmu-miR-138-1-3p 4.547348 mmu-miR-3086-3p 3.337121 mmu-miR-466a-5p 2.196768
mmu-miR-5109 2.051979 mmu-miR-344e-3p 2.026537 mmu-let-7i-5p 3.376316
mmu-miR-10a-3p 6.047581 mmu-miR-709 3.271662 mmu-miR-505-5p 2.68932
mmu-miR-665-3p 2.318655 mmu-miR-3096b-5p 6.94822 mmu-miR-465c-5p 2.829785
mmu-miR-465a-5p 6.432397 mmu-miR-5099 2.541044 mmu-miR-206-3p 3.862473
mmu-miR-218-5p 4.521491 mmu-miR-467e-5p 2.55806 mmu-miR-99b-3p 3.148833
mmu-miR-695 3.717158 mmu-miR-98-5p 13.226 mmu-miR-1899 2.613095
mmu-miR-688 2.885817 mmu-miR-221-3p 2.531232 mmu-let-7c-5p 9.061984
mmu-miR-291b-3p 4.303074 mmu-miR-212-3p 2.484969 mmu-let-7e-5p 3.516478
mmu-let-7b-3p 6.085008 mmu-miR-130b-3p 6.847116 mmu-miR-3095-3p 5.609635
mmu-miR-3082-5p 2.352138 mmu-miR-200c-5p 5.341375 mmu-miR-3064-5p 45.63883
mmu-miR-5117-3p 2.985543 mmu-miR-423-3p 2.894901 mmu-miR-216b-3p 2.45094
mmu-miR-5616-5p 3.482754 mmu-miR-466d-5p 2.605069 mmu-miR-29a-3p 5.427003
mmu-miR-293-3p 8.437394 mmu-miR-668-5p 13.64906 mmu-miR-5107-5p 6.240363
mmu-miR-466c-5p 2.126331 mmu-miR-466n-3p 3.143261 mmu-miR-686 3.791119
mmu-miR-574-5p 3.488874 mmu-miR-467b-5p 7.416311 mmu-miR-693-5p 2.720883
mmu-miR-292-3p 4.438217 mmu-miR-5624-5p 4.839843 mmu-miR-375-3p 2.614048
mmu-miR-181a-5p 13.3904 mmu-miR-3963 2.914163 mmu-miR-3544-3p 15.35104
mmu-miR-466e-5p 5.671098 mmu-miR-425-3p 5.801479 mmu-miR-30c-1-3p 3.532289
mmu-miR-130a-3p 57.04854 mmu-miR-540-5p 4.883808 mmu-miR-378b 3.299737
mmu-miR-804 14.94782 mmu-miR-107-3p 5.57924 mmu-miR-3970 3.227847
mmu-miR-1953 5.237508 mmu-miR-122-3p 2.114285 mmu-miR-343 7.173264
mmu-miR-30a-5p 6.722681 mmu-miR-1892 7.617978 mmu-miR-712-5p 23.03883
mmu-miR-541-3p 3.076973 mmu-miR-1904 2.246417 mmu-miR-877-5p 5.172372
mmu-miR-216a-3p 4.261151 mmu-miR-137-3p 8.806756 mmu-miR-376b-3p 4.331379
mmu-miR-344c-5p 4.25928 mmu-miR-214-5p 3.644928 mmu-miR-710 6.820602
mmu-miR-532-3p 2.731047 mmu-miR-467c-3p 2.159236 mmu-let-7a-5p 19.70974
mmu-miR-5115 4.134992 mmu-miR-3060-5p 2.742718 mmu-miR-21a-5p 7.871505
mmu-miR-5120 5.739049 mmu-miR-1b-3p 4.869725 mmu-miR-301a-5p 6.460626
mmu-miR-679-5p 2.444481 mmu-miR-27a-5p 37.60953 mmu-miR-539-3p 2.589723
mmu-miR-27a-3p 123.1872 mmu-miR-410-3p 17.4879 mmu-miR-488-3p 2.507628
mmu-miR-136-5p 12.56823 mmu-miR-148b-5p 4.865344 mmu-miR-184-5p 2.007527
mmu-miR-183-5p 2.440657 mmu-miR-204-5p 10.10235 mmu-miR-697 3.568439
mmu-miR-29b-3p 26.68454 mmu-miR-742-3p 6.462112 mmu-miR-181b-5p 3.519909
mmu-miR-2136 23.82247 mmu-miR-219-5p 58.88691 mmu-miR-145a-5p 3.35676
mmu-miR-299a-3p 8.800208 mmu-miR-25-5p 3.688824 mmu-miR-362-3p 2.638234
mmu-miR-3474 2.005535 mmu-miR-713 4.168932 mmu-miR-20a-5p 8.967211
mmu-miR-133b-5p 77.61893 mmu-let-7d-5p 6.013307 mmu-miR-491-3p 3.594207
mmu-miR-714 9.375649 mmu-miR-344-5p 2.514492 mmu-miR-880-5p 10.76771
mmu-miR-5105 2.236839 mmu-miR-466a-5p 12.01022 mmu-miR-221-5p 2.914677
mmu-miR-5112 27.06149 mmu-miR-346-3p 6.306549 mmu-miR-338-3p 56.80957
mmu-miR-204-3p 2.780989 mmu-miR-3095-5p 3.169364 mmu-miR-325-5p 2.283128
mmu-miR-1895 2.540623 mmu-miR-5114 7.031087 mmu-miR-691 3.144771
mmu-miR-26b-5p 2.114402 mmu-miR-183-3p 6.621648 mmu-miR-196b-3p 3.309794
mmu-miR-3065-3p 4.03445 mmu-miR-669h-3p 3.024023 mmu-miR-3070b-3p 2.775335
mmu-miR-494-5p 2.356306 mmu-miR-331-5p 4.581953 mmu-miR-194-2-3p 18.43107
mmu-miR-106a-5p 65.00243 mmu-miR-677-5p 3.246786 mmu-miR-188-5p 54.30583
mmu-miR-128-3p 12.73167 mmu-miR-195a-3p 2.184063 mmu-miR-147-3p 4.566976
mmu-miR-761 9.989739 mmu-miR-463-3p 12.53996 mmu-miR-5624-3p 2.644001
mmu-miR-883b-5p 2.35211 mmu-miR-1957a 11.74711 mmu-miR-346-5p 4.163306
mmu-miR-542-3p 7.764003 mmu-miR-1894-3p 31.13534 mmu-miR-30b-3p 2.051475
mmu-miR-1958 6.32935 mmu-miR-1971 6.442928 mmu-miR-701-5p 5.823002
mmu-miR-1893 3.991812 mmu-miR-671-5p 10.50069 mmu-miR-28a-3p 7.908172
mmu-miR-466b-5p 3.301444 mmu-miR-499-3p 172.2427 mmu-miR-1907 5.036028
mmu-miR-7a-2-3p 2.046015 mmu-miR-107-5p 5.46512 mmu-miR-3105-5p 2.774986
mmu-miR-466m-5p 23.50902 mmu-miR-665-5p 3.522869 mmu-miR-489-5p 6.494757
mmu-miR-5625-3p 3.090129 mmu-miR-503-5p 3.001966 mmu-miR-5621-5p 8.468883
mmu-miR-29b-1-5p 3.860122 mmu-miR-140-5p 3.422258    
mmu-miR-743b-5p 10.07274 mmu-miR-142-3p 222.1103    

Table 6.

miRNAs downregulated by more than twofold at 122 d

Name Fold change Name Fold change Name Fold change
mmu-miR-495-5p 0.339321 mmu-miR-190a-5p 0.193533 mmu-miR-874-5p 0.398086
mmu-miR-3068-5p 0.247305 mmu-miR-10b-5p 0.266441 mmu-miR-3069-3p 0.361669
mmu-miR-290-3p 0.252711 mmu-miR-338-5p 0.138908 mmu-miR-652-5p 0.42407
mmu-miR-1843b-3p 0.37422 mmu-miR-135a-5p 0.24666 mmu-miR-433-3p 0.186811
mmu-miR-151-5p 0.453855 mmu-miR-712-3p 0.286408 mmu-miR-1843a-5p 0.378559
mmu-miR-291a-5p 0.38995 mmu-miR-127-3p 0.419585 mmu-miR-193b-3p 0.432846
mmu-miR-29a-5p 0.444011 mmu-miR-324-3p 0.320562 mmu-miR-7a-5p 0.473021
mmu-miR-3084-3p 0.106545 mmu-miR-138-5p 0.283583 mmu-miR-331-3p 0.346048
mmu-miR-28a-5p 0.311724 mmu-miR-144-3p 0.125605 mmu-miR-375-5p 0.340044
mmu-miR-361-5p 0.467213 mmu-miR-718 0.454415 mmu-miR-3072-5p 0.14226
mmu-miR-196a-1-3p 0.368253 mmu-let-7i-3p 0.377898 mmu-miR-3473c 0.350358
mmu-miR-296-5p 0.23509 mmu-miR-3102-3p.2-3p 0.246599 mmu-miR-451a 0.348975
mmu-let-7g-5p 0.347148 mmu-miR-3098-3p 0.350802 mmu-miR-483-3p 0.396762
mmu-miR-744-5p 0.164894 mmu-miR-370-3p 0.316776 mmu-miR-34a-5p 0.157207
mmu-miR-146b-5p 0.321076 mmu-miR-5103 0.253431 mmu-miR-3059-5p 0.293724
mmu-miR-325-3p 0.361389 mmu-miR-298-5p 0.330357 mmu-miR-3971 0.388255
mmu-miR-487b-3p 0.318543 mmu-miR-376a-3p 0.104594 mmu-miR-873a-5p 0.355127
mmu-miR-101a-3p 0.189311 mmu-miR-30d-5p 0.322125 mmu-miR-1943-3p 0.368966
mmu-miR-1224-5p 0.360472 mmu-miR-193a-3p 0.297904 mmu-miR-3475 0.238778
mmu-miR-431-5p 0.474967 mmu-miR-186-5p 0.460699 mmu-miR-3104-3p 0.280163
mmu-miR-615-5p 0.35682 mmu-miR-543-3p 0.282108 mmu-miR-92a-3p 0.493385
mmu-miR-3105-3p 0.422037 mmu-miR-411-3p 0.250887 mmu-miR-467a-5p 0.136188
mmu-miR-326-3p 0.394951 mmu-miR-155-3p 0.396201 mmu-miR-674-3p 0.487958
mmu-miR-23a-3p 0.461305 mmu-miR-5626-5p 0.33411 mmu-miR-125b-2-3p 0.254925
mmu-miR-340-5p 0.339629 mmu-miR-379-5p 0.288851 mmu-miR-10b-3p 0.211123
mmu-miR-34c-5p 0.074025 mmu-miR-153-3p 0.37579 mmu-miR-185-5p 0.357345
mmu-miR-139-5p 0.353424 mmu-miR-129-5p 0.469387 mmu-miR-143-3p 0.162113
mmu-let-7d-3p 0.362006 mmu-miR-3069-5p 0.430008 mmu-miR-652-3p 0.256424
mmu-miR-382-5p 0.19934 mmu-miR-1843b-5p 0.44958 mmu-miR-328-3p 0.347203
mmu-miR-491-5p 0.368848 mmu-miR-219-2-3p 0.243031 mmu-miR-541-5p 0.280503
mmu-miR-1843a-3p 0.130198 mmu-miR-3072-3p 0.372183 mmu-miR-379-3p 0.373429
mmu-miR-101b-3p 0.163835 mmu-miR-383-5p 0.393393 mmu-miR-9-3p 0.214284
mmu-miR-369-3p 0.49817 mmu-miR-3085-3p 0.241654 mmu-miR-324-5p 0.189889
mmu-miR-341-3p 0.444242 mmu-miR-5621-3p 0.2397 mmu-miR-741-3p 0.329126
mmu-miR-148b-3p 0.483882 mmu-miR-708-3p 0.195404 mmu-miR-154-5p 0.372162
mmu-miR-182-5p 0.289559 mmu-miR-320-3p 0.415748 mmu-miR-551b-3p 0.322774
mmu-miR-3107-5p 0.367641 mmu-miR-22-3p 0.384327 mmu-miR-329-5p 0.452029
mmu-miR-210-3p 0.305306 mmu-miR-195a-5p 0.262231 mmu-miR-361-3p 0.345876
mmu-miR-132-5p 0.366162 mmu-miR-3110-5p 0.267735    

Among the differentially expressed miRNAs, miRNA-9 is highly expressed in the nervous system. miRNA-9 is involved in proliferation and differentiation of neural stem cells (NSCs). In the G93A-SOD1 transgenic mice, expression changes in NSCs were detected. Therefore, miRNA-9 was chosen as the investigation target. Microarray results showed that miRNA-9 was upregulated at the three time points. Heat map and hierarchical clustering analysis showed a clear distinction between the transgenic group and the control group (Figure 1).

Figure 1.

Figure 1

Differential expression of miRNAs in the spinal cord of ALS and wild-type mice. A-C: Scatter plots of expressed miRNAs at 95, 108, and 122 d, respectively. D: Heat map and hierarchical clustering. The heat map diagram shows the result of the two-way hierarchical clustering of miRNAs. Each row represents an miRNA and each column represents a sample. The miRNA clustering tree is shown on the left and the sample clustering tree is shown on top. The color scale shown at the top illustrates the relative expression level of an miRNA in a specific slide: red represents a relatively high expression level; green represents relatively low expression levels.

miRNA target prediction

To investigate the possible mechanisms of miRNA-9 pathogenesis in ALS, we used miRanda, TargetScan, and Microcosm to search for the putative protein-coding gene targets of miRNA-9 (Figure 2). miRNA-9 was predicted to contain target sites in the TLX and Hes1. miRNA-9 could also regulate the proliferation and differentiation of NSCs by binding to the complementary sequences of the 3’ UTR.

Figure 2.

Figure 2

A: Network of miRNA-9 regulatory genes. B: Expression of miRNA-9 in the spinal cord of ALS and wild-type mice. Results of RT-qPCR indicate that the expression of miRNA-9 was upregulated (n = 3). *p < 0.05 vs. wild-type littermates.

Differential expression and distribution of miRNA-9 in the spinal cord of the ALS transgenic mice

RT-qPCR was performed to validate the microarray results. The results indicated that miRNA-9 levels in the transgenic mice were significantly higher than those in the control subjects at different time points (p < 0.05; Figure 2). The results of RT-qPCR were similar to the microarray results.

In-situ hybridization was performed to investigate the distribution of miRNA-9 in the spinal cord. The results indicated that miRNA-9 was localized in the cytoplasm of the positive cells. The miRNA-9-positive cells were mainly detected in the gray matter of the ventral horn and the dorsal horn of the spinal cord in ALS and wild-type mice at different time points. The majority of the miRNA-9-positive cells were located in the ventral horn of the gray matter, the locus of neurodegeneration. The number of miRNA-9-positive cells was significantly increased at post-natal 95, 108, and 122 d in the ALS mice compared with the wild-type mice (p < 0.05; Figure 3).

Figure 3.

Figure 3

Expression and cellular distribution of miRNA-9 in the spinal cord of ALS and wild-type mice. Results of ISH show that the miRNA-9-positive cells were mainly detected in the gray matter of the ventral horn and the dorsal horn of the spinal cord. The majority of the miRNA-9-positive cells were located in the ventral horn of the gray matter. A1-A3: Represent the distribution of miRNA-9-positive cells in the ALS mice at 95 d. B1-B3: Represent the distribution of miRNA-9-positive cells in the WT mice at 95 d. C1-C3: Represent the distribution of miRNA-9-positive cells in the ALS mice at 108 d. D1-D3: Represent the distribution of miRNA-9-positive cells in the WT mice at 108 d. E1-E3: Represent the distribution of miRNA-9-positive cells in the ALS mice at 122 d. F1-F3: Represent the distribution of miRNA-9-positive cells in the WT mice at 122 d. Scale bar = 200, 50, 20 μm. The total number of miRNA-9-positive cells was counted (n = 3). *p < 0.05 vs. wild-type littermates.

In addition to injury on the motor neurons in the spinal cord, injury on the motor neurons in the brain can occur in ALS, in which muscle atrophy and paralysis possibly occur. Therefore, the expression of miRNA-9 was also detected in the brain and the gastrocnemius. miRNA-9-positive cells were also detected in the cerebral cortex and the hippocampi but were not found in the gastrocnemius (data not shown).

Discussion

miRNAs have an important function in many cellular processes. miRNAs can interact with specific sequences of target mRNA (mainly in the 3’ UTR), recruiting the RNA-induced silencing complex (RISC). On the basis of complete or incomplete miRNA-mRNA complementation, miRNAs can lead to degradation or translational suppression of target mRNA [11]. Therefore, miRNAs are a part of a novel regulatory pathway [12].

Early studies on the development of the nervous system evaluated the consequences of the decrease in the Dicer gene (which results in the absence of mature miRNAs) during neurogenesis. In zebrafish, the complete absence of Dicer leads to critical defects in the general morphology of the central nervous system and the peripheral nervous system; neuronal differentiation is also impaired [13]. miRNAs also have an important function in the pathogenesis of neurodegenerative diseases such as Alzheimer’s [14], Parkinson’s [15], and Huntington’s diseases [16]. In ALS, a few studies on miRNAs have been reported. miRNA-206, a skeletal muscle-specific miRNA, delays the progression of ALS and promotes the regeneration of the neuromuscular synapses in mice [17]. In the present study, microarray results showed for the first time that numerous miRNAs were differentially expressed in the spinal cord at different time points in the G93A-SOD1 transgenic mice. The function of these differentially expressed miRNAs should be investigated in future studies.

miRNA-9 is highly expressed in the nervous system and conserved among species, exhibiting 100% similarity between Drosophila melanogaster and vertebrates [18]. Studies with different model systems have revealed that miRNA-9 regulates neurogenesis by acting on neural or non-neural cell lineages. For example, miRNA-9 suppresses the expression of TLX, an essential regulator of NSC self-renewal, and maintains the adult NSCs in an undifferentiated and self-renewable state, thereby regulating the proliferation and distribution of NSCs [19]. Increased miRNA-9 expression reduces the proliferation of the mouse NSCs and accelerates neural differentiation. Antisense knockdown of miRNA-9 leads to the proliferation of NSCs [20]. In addition, the overexpression of miRNA-9 decreases the levels of Hes1, which regulates proliferation and differentiation characteristics of NSCs. The overexpression of miRNA-9 also promotes cell cycle exit and neuronal differentiation. By contrast, the knockdown of miRNA-9 inhibits neuronal differentiation [21]. miRNA-9 can promote the neural differentiation of MSCs in the bone marrow by targeting Zfp521Z [22]. The loss of miRNA-9 suppresses proliferation but promotes the migration of hNPCs cultured in vitro [23]. These findings have indicated that miRNA-9 may regulate neural differentiation.

In ALS, the proliferation and differentiation of NSCs and neural progenitor cells (NPCs) have been debated. Previous studies demonstrated that an increase in the proliferation of NPCs is observed in the ependymal zone surrounding the central canal (EZ) in the spinal cord; increased de novo neurogenesis from NPCs is also observed during ALS-like disease onset and progression [24]. In another study, NSCs are intravenously engrafted in the central nervous system of ALS-affected animals and their wild-type counterparts, resulting in a higher cell grafting efficiency in the ALS animals than in the wild-type animals; the two main fates observed in these animals are neuronal and astrocytic [25]. In SOD1G93AG1H mice, the number of nestin-positive NPCs is greatly increased, the majority of nestin-positive NPCs co-expresses the astrocyte marker GFAP, and a small number of GFAP co-expresses the neuronal marker NeuN [26]. In wobbler mouse, the percentage of neurons obtained from in vitro differentiation of NPCs is significantly higher than that from the healthy mice [27].

Our results indicated that miRNA-9 levels were upregulated at 95, 108, and 122 d in the G93A-SOD1 transgenic mice compared with the control mice. The miRNA-9-positive cells were detected in the ventral horn and the dorsal horn of the spinal cord. The majority of miRNA-9-positive cells were located in the ventral horn of the spinal cord, the locus of neurodegeneration. However, the function of miRNA-9 as a regulator in the differentiation of NSCs and NPCs in ALS remains unclear. The increase in expression and the distribution characteristics of miRNA-9 may be involved in the differentiation of the neurons derived from NSCs and NPCs in ALS.

ALS is the third most common neurodegenerative disease occurring in adulthood (after Alzheimer’s and Parkinson’s diseases). To date, no effective therapies are available for patients with ALS. The transplantation of the NSCs derived from the central nervous system is a promising therapeutic strategy to treat ALS [28]. The directional differentiation of the NSCs into neurons should be determined and could promote effective treatment. Therefore, the regulatory mechanisms of miRNAs in the proliferation and differentiation of the NSCs should be elucidated to provide a new treatment method.

Acknowledgements

The microarray experiments were performed by KangChen Bio-tech, Shanghai, China. This study was supported by the National Natural Science Foundation of China (Grant No. 81271413), the Shandong Province Science and Technology Development Program of China (Grant No. 2012GSF11827), the Shandong Province Natural Science Foundation of China (Grant No. ZR2012HQ021), the Muscular Dystrophy Association (Grant Nos. 157511 and 254530), the ALS Therapy Alliance (Grant No. 2013D001622), the Shandong Province Taishan Scholar Project, and the Shandong Province Education Department of China (Grant Nos. J12LK51 and J11LF16).

Disclosure of conflict of interest

None.

References

  • 1.Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novel genes coding for small expressed RNAs. Science. 2001;294:853–858. doi: 10.1126/science.1064921. [DOI] [PubMed] [Google Scholar]
  • 2.Wei J, Wang F, Kong LY, Xu S, Doucette T, Ferguson SD, Yang Y, McEnery K, Jethwa K, Gjyshi O, Qiao W, Levine NB, Lang FF, Rao G, Fuller GN, Calin GA, Heimberger AB. miR-124 inhibits STAT3 signaling to enhance T cell-mediated immune clearance of glioma. Cancer Res. 2013;73:3913–26. doi: 10.1158/0008-5472.CAN-12-4318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chi L, Gan L, Luo C, Lien L, Liu R. Temporal Response of Neural Progenitor Cells to Disease Onset and Progression in Amyotrophic Lateral Sclerosis-Like Transgenic Mice. Stem Cells Dev. 2007;16:579–88. doi: 10.1089/scd.2006.0120. [DOI] [PubMed] [Google Scholar]
  • 4.Kulshreshtha D, Vijayalakshmi K, Alladi PA, Sathyaprabha TN, Nalini A, Raju TR. Vascular Endothelial Growth Factor Attenuates Neurodegenerative Changes in the NSC-34 Motor Neuron Cell Line Induced by Cerebrospinal Fluid of Sporadic Amyotrophic Lateral Sclerosis Patients. Neurodegener Dis. 2011;8:322–30. doi: 10.1159/000323718. [DOI] [PubMed] [Google Scholar]
  • 5.Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Res. 2006;34:D140–4. doi: 10.1093/nar/gkj112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Flynt AS, Lai EC. Biological principles of microRNA-mediated regulation: shared themes amid diversity. Nat Rev Genet. 2008;9:831–42. doi: 10.1038/nrg2455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.De Pietri Tonelli D, Pulvers JN, Haffner C, Murchison EP, Hannon GJ, Huttner WB. miRNAs are essential for survival and differentiation of newborn neurons but not for expansion of neural progenitors during early neurogenesis in the mouse embryonic neocortex. Development. 2008;135:3911–21. doi: 10.1242/dev.025080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wong HK, Veremeyko T, Patel N, Lemere CA, Walsh DM, Esau C, Vanderburg C, Krichevsky AM. De-repression of FOXO3a death axis by microRNA-132 and -212 causes neuronal apoptosis in Alzheimer’s disease. Hum Mol Genet. 2013;22:3077–92. doi: 10.1093/hmg/ddt164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sibley CR, Seow Y, Curtis H, Weinberg MS, Wood MJ. Silencing of Parkinson‘s disease-associated genes with artificial mirtron mimics of miR-1224. Nucleic Acids Res. 2012;40:9863–9875. doi: 10.1093/nar/gks712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chen Y, Guan Y, Liu H, Wu X, Yu L, Wang S, Zhao C, Du H, Wang X. Activation of the Wnt/beta-catenin signaling pathway is associated with glial proliferation in the adult spinal cord of ALS transgenic mice. Biochem Biophys Res Commun. 2012;420:397–403. doi: 10.1016/j.bbrc.2012.03.006. [DOI] [PubMed] [Google Scholar]
  • 11.Saugstad JA. MicroRNAs as effectors of brain function with roles in ischemia and injury, neuroprotection, and neurodegeneration. J Cereb Blood Flow Metab. 2010;30:1564–76. doi: 10.1038/jcbfm.2010.101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Smirnova L, Grafe A, Seiler A, Schumacher S, Nitsch R, Wulczyn FG. Regulation of miRNA expression during neural cell specification. Eur J Neurosci. 2005;21:1469–77. doi: 10.1111/j.1460-9568.2005.03978.x. [DOI] [PubMed] [Google Scholar]
  • 13.Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF. MicroRNAs regulate brain morphogenesis in zebrafish. Science. 2005;308:833–838. doi: 10.1126/science.1109020. [DOI] [PubMed] [Google Scholar]
  • 14.Lukiw WJ. Micro-RNA speciation in fetal, adult and Alzheimer‘s disease hippocampus. Neuroreport. 2007;18:297–300. doi: 10.1097/WNR.0b013e3280148e8b. [DOI] [PubMed] [Google Scholar]
  • 15.Wang G, van der Walt JM, Mayhew G, Li YJ, Zuchner S, Scott WK, Martin ER, Vance JM. Variation in the miRNA-433 binding site of FGF20 confers risk for Parkinson disease by overexpression of alpha-synuclein. Am J Hum Genet. 2008;82:283–9. doi: 10.1016/j.ajhg.2007.09.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Johnson R, Zuccato C, Belyaev ND, Guest DJ, Cattaneo E, Buckley NJ. A microRNA-based gene dysregulation pathway in Huntington‘s disease. Neurobiol Dis. 2008;29:438–45. doi: 10.1016/j.nbd.2007.11.001. [DOI] [PubMed] [Google Scholar]
  • 17.Williams AH, Valdez G, Moresi V, Qi X, McAnally J, Elliott JL, Bassel-Duby R, Sanes JR, Olson EN. MicroRNA-206 delays ALS progression and promotes regeneration of neuromuscular synapses in mice. Science. 2009;326:1549–1554. doi: 10.1126/science.1181046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Identification of tissue-specific microRNAs from mouse. Curr Biol. 2002;12:735–9. doi: 10.1016/s0960-9822(02)00809-6. [DOI] [PubMed] [Google Scholar]
  • 19.Shi Y, Chichung Lie D, Taupin P, Nakashima K, Ray J, Yu RT, Gage FH, Evans RM. Expression and function of orphan nuclear receptor TLX in adult neural stem cells. Nature. 2004;427:78–83. doi: 10.1038/nature02211. [DOI] [PubMed] [Google Scholar]
  • 20.Zhao C, Sun G, Li S, Shi Y. A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination. Nat Struct Mol Biol. 2009;16:365–71. doi: 10.1038/nsmb.1576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tan SL, Ohtsuka T, Gonzalez A, Kageyama R. MicroRNA9 regulates neural stem cell differentiation by controlling Hes1 expression dynamics in the developing brain. Genes Cells. 2012;17:952–61. doi: 10.1111/gtc.12009. [DOI] [PubMed] [Google Scholar]
  • 22.Han R, Kan Q, Sun Y, Wang S, Zhang G, Peng T, Jia Y. MiR-9 promotes the neural differentiation of mouse bone marrow mesenchymal stem cells via targeting zinc finger protein 521. Neurosci Lett. 2012;515:147–52. doi: 10.1016/j.neulet.2012.03.032. [DOI] [PubMed] [Google Scholar]
  • 23.Delaloy C, Liu L, Lee JA, Su H, Shen F, Yang GY, Young WL, Ivey KN, Gao FB. MicroRNA-9 coordinates proliferation and migration of human embryonic stem cell-derived neural progenitors. Cell Stem Cell. 2010;6:323–335. doi: 10.1016/j.stem.2010.02.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chi L, Ke Y, Luo C, Li B, Gozal D, Kalyanaraman B, Liu R. Motor neuron degeneration promotes neural progenitor cell proliferation, migration, and neurogenesis in the spinal cords of amyotrophic lateral sclerosis mice. Stem Cells. 2006;24:34–43. doi: 10.1634/stemcells.2005-0076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mitrecic D, Nicaise C, Gajovic S, Pochet R. Distribution, differentiation, and survival of intravenously administered neural stem cells in a rat model of amyotrophic lateral sclerosis. Cell Transplant. 2010;19:537–48. doi: 10.3727/096368910X498269. [DOI] [PubMed] [Google Scholar]
  • 26.Juan L, Dawei Z, Julie AD. Increased number and differentiation of neural precursor cells in the brainstem of superoxide dismutase 1(G93A) (G1H) transgenic mouse model of amyotrophic lateral sclerosis. Neurol Res. 2007;29:204–9. doi: 10.1179/174313206X152519. [DOI] [PubMed] [Google Scholar]
  • 27.DiFebo F, Curti D, Botti F, Biella G, Bigini P, Mennini T, Toselli M. Neural precursors (NPCs) from adult L967Q mice display early commitment to “in vitro” neuronal differentiation and hyperexcitability. Exp Neurol. 2012;236:307–18. doi: 10.1016/j.expneurol.2012.05.010. [DOI] [PubMed] [Google Scholar]
  • 28.Pandya RS, Mao LL, Zhou EW, Bowser R, Zhu Z, Zhu Y, Wang X. Neuroprotection for amyotrophic lateral sclerosis: role of stem cells, growth factors, and gene therapy. Cent Nerv Syst Agents Med Chem. 2012;12:15–27. doi: 10.2174/187152412800229152. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Clinical and Experimental Pathology are provided here courtesy of e-Century Publishing Corporation

RESOURCES