Abstract
EGFR and KRAS mutations correlate with response to tyrosine kinase inhibitors in patients with non-small cell lung carcinoma (NSCLC). We reported a hydrothermal pressure method of simultaneous deparaffinization and lysis of formalin-fixed paraffin embedded (FFPE) tissue followed by conventional chaotropic salt column purification to obtain high quality DNA for mutation analysis using PCR-base direct sequencing. This study assessed the feasibility of using this method to screen for exons 18-21 of EGFR and exon 2 of KRAS gene mutations in surgical resection and core needle biopsy specimens from 251 NSCLC patients. EGFR mutations were identified in 140 (55.8%) NSCLC patients (118 in adenocarcinoma, 11 in squamous cell carcinoma, 7 in adenocarcinoma and 4 in NSCLC-not otherwise specified), including four novel substitutions (L718M, A743V, L815P, V819E). EGFR mutations were frequently present in female patients (72 of 113, 63.7%) and NSCLC with adenocarcinoma component (125/204, 61.3%) with statistical significance. Twenty-one patients had multiple mutations at different exons of EGFR, in which seventeen patients had deletions in exon 19. KRAS mutations were found in 18 (7.2%) patients (15 in adenocarcinoma, 2 in squamous cell carcinoma and one in NSCLC-not otherwise specified), including an uncommon substitution G13C. Deparaffinization and lysis by hydrothermal pressure, coupled with purification and PCR-based sequencing, provides a robust screening approach for EGFR and KRAS mutation analysis of FFPE tissues from either surgical resection or core needle biopsy in clinical personalized management of lung cancer.
Keywords: EGFR, KRAS, FFPE, hydrothermal pressure, lung cancer, mutation analysis
Introduction
As a transmembrane receptor, epidermal growth factor receptor (EGFR) is a key regulator of epithelial cell proliferation. Excessive EGFR signaling upsets the balance between cell growth and apoptosis contributing to tumor genesis in a wide variety of solid tumors including non-small cell lung cancer (NSCLC) [1]. Somatic mutations in the tyrosine kinase domain (exons 18-21) of EGFR gene can bring about constitutive activation of EGFR tyrosine kinase activity. Most of these mutations, such as deletion mutations in exon 19 that affect the conserved LREA motif and a single amino acid substitution at codon 858 (Leucine to Argine; L858R) of exon 21, are associated with sensitivity to the small molecule tyrosine kinase inhibitors (TKIs), erlotinib and gefitinib. These drug-sensitive mutations are found in up to 60% of Asian patients with lung adenocarcinoma [2]. However, minor mutations, such as T790M and S768I, are associated with resistance to TKI therapy and have been reported in about 50% of patients with disease progression [3,4].
Approximately 15-20% of unselected NSCLC harbor mutations in the exon 2 of Kirsten rat sarcoma viral oncogene homolog (KRAS) [5-7]. Although most of current literatures suggest that EGFR and KRAS mutations are mutually exclusive [8], as a downstream signal molecule of EGFR pathway, KRAS mutation may be a predictor for primary resistance to TKIs therapy in NSCLC [9]. As a prognostic marker, KRAS mutations in resected NSCLC were associated with shorter overall survival than those with EGFR mutations. As a result, clinically adequate workup of lung cancer cannot be limited to histotype classification, but should include a series of molecular biology analyses (EGFR and KRAS) to define distinct subgroups with different responses to EGFR-targeted therapies [10].
Direct sequencing of PCR products corresponding to target sequences is a popular and acceptable approach to assess genetic mutation status [11,12]. However, using traditional DNA extraction methods, biopsy specimens usually provide suboptimal tumor material and frequently insufficient for routine molecular diagnosis in clinical pathology labs. Although the commercial nucleic acid extraction kits based on chaotropic salt purification mechanism are commonly used, analysis of DNA extracted from formalin-fixed paraffin embedded (FFPE) samples remains difficult, costly, biohazardous and time consuming. Unlike standard protease K digestion, Zhong et al has reported a reliable and efficient method of simultaneous deparaffinization and lysis of FFPE tissue using hydrothermal pressure to obtain high quality DNA for PCR and subsequent direct sequencing. As we previously described, the quality and integrity of extracted DNA have been certified by successful amplification of variable-sized amplicons in tissue samples archived from 0.2 to 22 years [13]. This is particular important to maximize the DNA recovery for mutation analyzing in FFPE tissues, especially small-sized bronchoscopic or transthoracic core needle biopsies. Here we screened for the mutations of EGFR exons 18-21 and KRAS exon 2 in 251 FFPE samples derived from surgical resections and core needle biopsies of NSCLC patients in routine clinical practice using a single assay on the principles of hydrothermal pressure extraction and direct sequencing.
Materials and methods
Patients and histological evaluation
Between January 2010 and October 2012, paraffin-embedded tissues from 251 patients with histologically confirmed NSCLC were obtained. Of these, 136 specimens were from surgical resection and 115 specimens were from core needle biopsies, in which 70 were from CT-guided transthoracic biopsy, 27 from bronchoscopic biopsy and 18 from metastatic lymph node biopsy. There were 113 women and 138 men. The median age was 65 (range, 21-88 years) and 93 patients (37.1%) were older than 70 years. This study was approved by the Peking University Institutional Review Board with the approval No. IRB00001052-10004.
The biopsy procedure was performed using an 18-gauge or 20-gauge Chiba aspiration needle. One to three separate needle insertions are typically needed to obtain biopsy samples approximately 0.5-0.75 inches long (approximately 1.2-2.0 cm) and 0.04-0.06 inches (approximately 0.1-0.15 cm) in diameter. After the surgery or biopsy, all the samples are immediately sent to the pathology laboratory for diagnosis. In our standard clinical protocols, immunohistochemistry staining was performed for establishing a precise diagnosis for each NSCLC patient. The original histopathologic diagnoses were reviewed and confirmed by two pathologists according to the 2004 WHO classification of lung tumors and the 2011 International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society (IASLC/ATS/ERS) lung adenocarcinoma classification. None of these patients had received tyrosine kinase inhibitor treatment or chemotherapy before mutation analysis.
DNA extraction and quantitation
For each sample, a total of 8 sections of 5 μm thickness and one corresponding hematoxylin and eosin (H.E.) stained section were obtained. One anatomic pathologist reviewed H.E. stained histological sections to exclude necrosis or hemorrhage and determine the quantity of tumor cells for molecular testing. In order to enrich tumor cells, the tumor foci from the marked areas were selectively scraped from the corresponding unstained FFPE sections and collected into 1.5 ml centrifuge tubes for DNA isolation. After manual dissection, samples contained more than 60% tumor cells as estimated from the H.E. stained slide.
As previously described by Zhong et al, genomic DNA was extracted from tumor tissue lysed by hydrothermal pressure [13]. Briefly, tissue samples were submerged into 250 μL lysis solution (0.1 M NaOH with 5% Chelex-100). Before capping, an orifice was created through the centrifuge tube cap by passing through a 23-gauge hypodermic needle (0.64 mm in diameter). Hydrothermal pressure treatment was performed for 30 minutes using a conventional pressure cooker at 80 Kilopascal (kPa) working pressure setting. After treatment, centrifuge tubes were centrifuged at 14000 rpm for 5 minutes at 4°C and 200 μL upper liquid phase was transferred into a new tube. Genomic DNA was extracted by adding 200 μL AL lysis buffer, a component of the Qiagen Blood and Tissue Kit (Qiagen Inc, Valencia, CA) and vortexed, followed by adding 200 μL 100% ethanol before transferring into the Qiagen purification column. The column was then washed and DNA was purified into instruction into 30 μL AE buffer according to the manufacturer’s instruction. DNA was quantified by spectrophotometric absorbance at 260 nm using the NanoDrop® apparatus (Thermo Scientific Inc., Wilmington, DE, USA).
Analysis of EGFR and KRAS mutations
The EGFR exons 18-21 and KRAS exon 2 were amplified by polymerase chain reaction (PCR) using Promega GoTaq® Hot Start Colorless Master Mixes (Promega Corporation, Madison, WI, USA). The specific primers and sizes of the expected amplicons are presented in Table 1. Genomic DNA of 50-100 ng was amplified in a 50 μL reaction containing 25 μL of Hot Start Colorless Master Mix and 5 μL of 10 μM primer mix. The PCR reaction consisted of 2 minutes at 95°C, followed by 40 cycles of 94°C for 30 seconds; 56°C for 40 seconds and 72°C for 1 minute, finished by 72°C for 7 minutes. Five microliter of the PCR product was analyzed by 1.2% agarose gel with 100 to 600 bp DNA marker. Gels were visualized on a BioRad Gel Doc 2000TM system and Quantity One software (BioRad, Hercules, CA, USA). The resulting PCR amplicons were purified and sequenced in both directions using the BigDye Terminator kit and an ABI Prism 3500 DNA Analyzer (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Mutant cases were validated by second independent PCR and sequencing. In every experiment, ddH2O substituted for DNA template was used as a negative control to rule out the possibility of contamination. The sequencing results were observed by ABI Sequence Scanner software and compared with the reference sequence of EGFR and KRAS gene from NCBI database to mark the position of nucleotide change.
Table 1.
Sequences of primers and PCR amplicons
| Gene | Exon | Primer Sequences (from 5’ to 3’) | Amplicons |
|---|---|---|---|
| EGFR | 18 | Forward: TTTCCAGCATGGTGAGGG | 263 bp |
| Reverse: ACAGCTTGCAAGGACTCT | |||
| EGFR | 19 | Forward: AGCATGTGGCACCATCTC | 224 bp |
| Reverse: AGACATGAGAAAAGGTGG | |||
| EGFR | 20 | Forward: CATGTGCCCCTCCTTCTG | 325 bp |
| Reverse: CTATCCCAGGAGCGCAGA | |||
| EGFR | 21 | Forward: AATTCGGATGCAGAGCTT | 293 bp |
| Reverse: TACAGCTAGTGGGAAGGC | |||
| KRAS | 2 | Forward: AACCTTATGTGTGACATGTTCTAAT | 232 bp |
| Reverse: CTGTATCAAAGAATGGTCCTGC |
Statistical evaluation
The associations between the presence of EGFR or KRAS mutations and the clinicalpathological characteristics were assessed by chi-square test using SPSS11.0 software package. A threshold of P < 0.05 was defined as statistically significant.
Results
Morphological diagnosis and immunoprofile
Histological type of each patient was determined by a combination of morphology and immunohistochemical profile according to the NCCN Guidelines® for Non-Small Cell Lung Cancer (Version 3.2012) and the guidelines for the diagnosis of adenocarcinoma published by IASLC/ATS/ERS. In the case of adenocarcinoma, diagnosis was confirmed by expression of TTF-1, Napsin A or CK7 and negativity for CK5/6 and p63. Histological characteristic and expression of p63 favored squamous cell carcinoma diagnosis. CD56, Chromogramin A and synaptophysin were used to identify neuroendocrine tumors. Undifferentiated NSCLC by morphology that also lacked expression of differentiation markers TTF-1, Napsin A or p63 resulted in the diagnosis of NSCLC-NOS (not otherwise specified). Based on these criteria, 193 of the 251 patients (76.9%) were diagnosed with adenocarcinoma, 37 (14.7%) with squamous cell carcinoma, 11 (4.4%) with adenosquamous cell carcinoma, 10 (4.0%) with NSCLC-NOS. In small biopsy specimens, adenosquamous cell carcinoma was not diagnosed because of inadequate sampling.
Mutations analysis
All 251 FFPE samples were successfully tested by hydrothermal pressure extraction and PCR amplification of amplicons ranging from 224 to 325 bp. The PCR products were subject to direct Sanger sequencing and all produced informative data for mutation analysis.
Mutations in the EGFR gene were detected in 140 of 251 NSCLC patients (55.8%). Details of the mutations detected in EGFR gene are listed in Table 2. Deletions were almost detected in exon 19, while a short in-frame deletion (c.2127_2129 del AAC) in exon 18 was found in one patient with adenocarcinoma. Deletions in exon 19 and L858R substitution in exon 21 were the hotspots mutations with the higher frequency 75.0% (105 of 140) and 22.1% (31 of 140). As shown in Figure 1, infrequent point mutations were also found in exon 18-20 and other codons of exon 21, in which most mutations had been collected by Catalogue of Somatic Mutations in Cancer (COSMIC). Other four less common single amino acid substitutions, one in exon 18 (L718M) and three in exon 20 (A743V, L815P, V819E), were not previously reported or found in the SNP database. It is unlikely that the novel mutations detected in this study are due to PCR artifacts, as all mutations were confirmed in separate amplifications and no mutations were detected in negative control.
Table 2.
EGFR mutations detected in non-small cell lung carcinoma patients
| Histology | EGFR | Number of cases | |
|---|---|---|---|
|
| |||
| Mutation (Amino Acid) | Exon | ||
| Adenocarcinoma | E709K + E746_A750 del | 18, 19 | 2 |
| Adenocarcinoma | E709_T710 delins D | 18 | 1 |
| Adenocarcinoma | L718M + E746_A750 del | 18, 19 | 1 |
| Adenocarcinoma | G719C | 18 | 1 |
| Adenocarcinoma | G719A + L747S | 18, 19 | 1 |
| Adenocarcinoma | G719A + R776S | 18, 20 | 1 |
| Adenocarcinoma | G719S + S768I | 18, 20 | 1 |
| Adenocarcinoma | P741L | 19 | 1 |
| Adenocarcinoma | A743V | 19 | 1 |
| Adenocarcinoma | E746_A750 del | 19 | 62 |
| Adenocarcinoma | E746_A750 del + A767V | 19, 20 | 1 |
| Adenocarcinoma | E746_A750 del + L788F + V802I | 19, 20 | 1 |
| Adenocarcinoma | E746_A750 del + V819E | 19, 20 | 1 |
| Adenocarcinoma | E746_A750 del + L858R | 19, 21 | 5 |
| Adenocarcinoma | E746_A750 del + L858W + E868V | 19, 21 | 1 |
| Adenocarcinoma | E746_T751 delins A | 19 | 2 |
| Adenocarcinoma | E746_S752 delins V | 19 | 4 |
| Adenocarcinoma | L747_T751 del | 19 | 1 |
| Adenocarcinoma | L747_T751 del + S768I | 19, 20 | 1 |
| Adenocarcinoma | L747_S752 del | 19 | 1 |
| Adenocarcinoma | L747_P753 delins S | 19 | 4 |
| Adenocarcinoma | S753_I759 del | 19 | 1 |
| Adenocarcinoma | S768I + L858R | 20, 21 | 1 |
| Adenocarcinoma | G857E | 21 | 1 |
| Adenocarcinoma | L858R | 21 | 21 |
| Adenosquamous carcinoma | E746_A750 del | 19 | 1 |
| Adenosquamous carcinoma | E746_A750 del + Y801C | 19, 20 | 1 |
| Adenosquamous carcinoma | E746_A750 del + L858R | 19, 21 | 1 |
| Adenosquamous carcinoma | L858R | 21 | 3 |
| Adenosquamous carcinoma | L861Q | 21 | 1 |
| NSCLC, not otherwise specified | L718M | 18 | 1 |
| NSCLC, not otherwise specified | E746_A750 del | 19 | 3 |
| Squamous cell carcinoma | G719D + E746_A750 del | 18, 19 | 1 |
| Squamous cell carcinoma | E746_A750 del | 19 | 9 |
| Squamous cell carcinoma | E746_A750 del + L815P | 19, 20 | 1 |
Figure 1.

Sequence chromatograms displaying partial types of EGFR uncommon mutations found in this study. The amino acid changes were corresponded to the codon alternations as following: L718M (CTG→ATG) in exon 18; P741L (CCC→CTC), A743V (GCT→GTT) and L747S (TTA→TCA) in exon 19; A767V (GCC→GTC), R776S (CGC→AGC) and Y801C (TAT→TGT) in exon 20; G857E (GGG→GAG) and E868V (GAA→GTA) in exon 21.
As shown in Table 2, twenty-one patients (21 of 140, 15.0%) had multiple mutations in different exons of EGFR gene, in which 17 patients were adenocarcinomas, two were adenosquamous carcinomas and two were squamous cell carcinomas. Seventeen patients (17/21, 81.0%) had both deletion in exon 19 and point mutation in other exon. In these patients, six harbored L858R substitution in exon 21 as the simultaneous mutation. S768I was found in three adenocarcinoma patients with simultaneous sensitive mutation G719A, L747_T751 deletion and L858R respectively. But T790M mutation in exon 20 was not detected in our patient cohort. Repeating the extraction, amplification and sequencing protocol from the same FFPE tissue block confirmed all multiple mutations.
KRAS gene mutations were found in 18 of 251 (7.2%) NSCLC patients. Single amino acid substitutions involving codon 12 and 13 of KRAS were identified in fifteen and three patients respectively (Table 3). The most common mutations were G12D (6/18, 33.3%) and G12C (6/18, 33.3%). An uncommon mutation G13C was found in an adenocarcinoma patient.
Table 3.
KRAS mutations detected in non-small cell lung carcinoma
| Histology | KRAS | Number of cases | |
|---|---|---|---|
|
| |||
| Mutation (Amino Acid) | Exon | ||
| Adenocarcinoma | G12A | 2 | 2 |
| Adenocarcinoma | G12C | 2 | 4 |
| Adenocarcinoma | G12D | 2 | 5 |
| Adenocarcinoma | G13C | 2 | 1 |
| Adenocarcinoma | G13D | 2 | 3 |
| Squamous cell carcinoma | G12C | 2 | 1 |
| Squamous cell carcinoma | G12D | 2 | 1 |
| NSCLC, not otherwise specified | G12C | 2 | 1 |
Association of EGFR and KRAS mutations with clinical features
Table 4 summarized the patient characteristics for all patients as well as the frequency of EGFR or KRAS gene mutations in each category. As reported previously, EGFR mutations were more frequent in female patients (72 of 113, 63.7%) than in male patients (68 of 138, 49.3%) (p = 0.022). The frequencies of EGFR mutation were higher in adenocarcinomas (118/193, 61.1%) and adenosquamous carcinomas (7/11, 63.6%), compared with those in NSCLC-NOS (4/10, 40.0%) and squamous cell carcinomas (11/37, 29.7%). If considering the adenocarcinoma and adenosquamous carcinoma as one group, its mutation frequency were significant higher than that of the other non-adenocarcinoma group (squamous cell carcinoma and NSCLC-NOS) (p = 0.0002).
Table 4.
Distribution of patients with molecular results according to clinical and pathologic factors
| Variable | No. | EGFR | KRAS | ||
|---|---|---|---|---|---|
|
|
|||||
| Mutation (%) | P | Mutation (%) | P | ||
| Gender | |||||
| Male | 138 | 68 (49.3) | 0.022# | 13 (9.4) | 0.127 |
| Female | 113 | 72 (63.7) | 5 (4.4) | ||
| Age | |||||
| ≤ 70 | 154 | 85 (55.2) | 0.815 | 13 (8.4) | 0.326 |
| > 70 | 97 | 55 (56.7) | 5 (5.2) | ||
| Histology | |||||
| Adenocarcinoma + Adenosquamous | 204 | 125 (61.3) | 0.000# | 15 (7.4) | 0.935 |
| Squamous cell carcinoma + NSCLC-NOS* | 47 | 15 (31.2) | 3 (6.4) | ||
| Sampling procedures | |||||
| Core needle biopsy | 115 | 72 (62.6) | 0.059 | 9 (7.8) | 0.712 |
| Surgical resection | 136 | 69 (50.7) | 9 (6.6) | ||
| Derivation of tumor | |||||
| Primary carcinoma | 233 | 132 (56.7) | 0.315 | 18 (7.7) | 0.453 |
| Metastatic carcinoma^ | 18 | 8 (44.4) | 0 (0) | ||
Refers to not-otherwise specified;
Refers to P < 0.05;
Refers to tumor samples from lymph node biopsy.
There was no significant difference between the mutation frequency of core needle biopsy and surgical resection samples (p = 0.059). Core biopsies may provide reliable samples for the mutation analysis of NSCLC. But most of the squamous cell carcinoma samples with EGFR mutation (9 of 11, 81.8%) and all the four NSCLC-NOS samples with EGFR mutation were from core needle biopsy. This indicated that the possibility of an adenocarcinoma component could not be excluded because of incomplete sampling. In the core biopsy samples, 18 were metastatic tumors from jugular lymph nodes and EGFR mutations was found in 8 samples (8/18, 44.4%). However, there was no statistical difference between the mutation frequencies of primary and metastatic tumors.
KRAS mutation was detected in fifteen adenocarcinoma patients (15/193, 7.8%), two squamous cell carcinoma patients (2/37, 5.4%) and one NSCLC-NOS (1/10, 10.0%). We also examined the relationship between the presence of KRAS mutation and the preceding clinicopathologic parameters, but no significant difference was found (Table 4).
Discussion
The potential of new molecular techniques to search for biomarkers, such as EGFR and KRAS, in predicting response to therapy could improve the treatment and survival of lung carcinoma [14,15]. Instead of invasive staging procedures, CT-guided needle biopsies of peripheral primary lung tumors or metastatic tumors in lymph nodes have been proven useful to diagnose lung carcinomas or stage patients. Increasing data supports that core biopsies may provide reliable samples for the biological characterization of NSCLC [16]. Therefore, mutation analysis of both resection and biopsy NSCLC samples in the initial pre-treatment evaluation are the standard clinical procedures in our hospital.
Using standard extraction procedures and sequencing, Chen et al and Zhuang et al reported that EGFR gene mutations were found in fresh-frozen CT-guided biopsies from 12 of 17 (70.6%) adenocarcinoma patients and 23 of 43 (53.5%) NSCLC patients respectively [17,18]. As the reported sensitivity of direct sequencing is 20-25%, therefore, cancer cell enrichment by the manual dissection of the morphologically confirmed cell population based on H & E staining on FFPE slide should be performed to assure the sensitivity of mutation detection. FFPE slide is likely to be more suitable than fresh-frozen sample for NSCLC tissues in somatic mutation analysis.
There are currently a number of methods that have been developed to detect EGFR mutations in FFPE small samples. Some real time PCR assays with Amplification Refractory Mutation System (ARMS) or locked nucleic acid probe screen for specific mutation with sensitivities of 1%-10%. But using traditional protease K digestion and ethanol-precipitating extraction, Ellison et al reported that 215 of 433 NSCLC FFPE samples yielded detectable amount of genomic DNA for EGFR gene analysis by ARMS. On the other hand, nine mutations, neither L858R nor delE746-A750, could only be detected by sequencing but not ARMS [19]. Loop-hybrid mobility shift assay was adopted by Nakajima et al to successfully analyze EGFR mutation in 93.5% of primary lung cancer samples obtained by EBUS-TBNA [20]. Other strategies that rely on techniques such as high resolution melting and denaturing high performance liquid chromatography detect most mutations without specifying the precise amino acid substitution.
There is currently no general agreement on which of these represents the best method for mutation analysis in NSCLC. However, strategies based on DNA amplification and direct sequencing are the most comprehensive as they can screen not only for known but also novel mutations. It is recommended that at least 40% tumor cells need to be present with more than 20% mutant DNA for efficient mutation screening relying on standard PCR and sequencing protocols [21]. In our routine clinical practice, manual dissection of tumor cells from tissue slides marked by anatomic pathologist was performed prior to DNA extraction.
Although the FFPE samples are adequate for PCR-based mutation analysis, DNA extraction remains difficult and costly as a result of crosslink introduced by the fixation and embedding. Although commercially available, current protocols with xylene deparaffinization and protease K digestion are generally manual, biohazardous and time consuming. The hydrothermal pressure approach with chaotropic column purification may significantly resolve such problems and produce comparable quantity and better quality of DNA [13]. Here we report the feasibility of this rapid extraction procedure for screening EGFR and KRAS mutations in FFPE tissue samples by Sanger sequencing. Complete evaluation of exons 18-21 of EGFR and exon 2 of KRAS were performed in all of clinical biopsy and resection samples.
Our extraction procedure involves hydrothermal pressure treatment in 0.1 M NaOH with 5% Chelex-100. Instead of the xylene deparaffinization and protease K digestion, the hydrothermal pressure process with alkaline lysis buffer disrupt cell membranes and retrieve the cross-link of DNA in one step and reduce potential tissue loss. Chelex-100, a chelating resin, is popular used to successfully extract DNA from many forensic samples. Schuurbier et al used the 2 μg/μL proteinase K digestion with 5% Chelex-100 and successfully analyzed 77% of all FFPE cellblock samples by standard PCR and sequencing of exons 18-21 of EGFR [22]. Chelex-100 accommodates PCR-quality products by ensuring the complete removal of PCR inhibitors (contaminating metal ions that catalyze the digestion of DNA). After centrifuging, the resin and cellular debris were separated from the supernatant containing the released DNA. With the chaotropic column purification, high quantity and better quality of DNA would be sufficient for amplification and sequencing.
Using this extraction method and PCR-based sequencing, we found EGFR gene mutations in 140 of 251 (55.8%) NSCLC samples. This mutation frequency was slightly higher than those in the results of two previous large studies that examined hundreds of Chinese NSCLC patients using scorpions amplified refractory mutation system or the SurPlex®-xTAG70plex platform, 49.8% and 41.0% respectively [23,24]. Four of the mutations (L718M, A743V, L815P and V819E) detected in our patient cohort were novel and more other less common mutations (such as L747S, R776S, P741L, A767V, G857E, Y801C and so on) would not have been detected by ARMS assay. Distinguishing novel EGFR mutations that are clinically relevant from those that are functionally silent or artifacts is clearly important, particularly as diverse responses to EGFR tyrosine kinase inhibitor (TKI) therapy of patients with NSCLC harboring uncommon EGFR mutations were recently reported. According to Wu et al, the less common mutations at codon G719 and L861, which were found in five patients of our study, would be sensitive to EGFR TKI therapy [25]. But the adenocarcinoma patient simultaneously harbored another mutation at the codon 747 (L747S) or codon 768 (S768I) has been linked to acquired resistance to TKI therapy. We also identified 19 patients with doublet mutations and two patients with triplet mutations in different exons. Doublet mutations accounted for 6%of EGFR mutations, with approximately half of these occurring at five codons: E709, G719, S768, T790 and L861 [26]. The exon 19 deletion, which has been linked to favorable response to gefitinib, was the most common mutation in the patients with multiple mutations (17/21, 81.0%) in present study. It is much regretted that we have no information regarding the responsiveness of our multiple mutations to TKI therapy.
In this study we also found KRAS mutations in fifteen lung adenocarcinoma patients and three other NSCLC patients. The frequency of KRAS mutations in Chinese NSCLC samples analyzed in this study (18/251, 7.2%) is in keeping with previous studies that reported KRAS mutation frequency of up to 8%, predominantly in adenocarcinomas (7.1% and 9.9% respectively) [23,24]. The frequency of EGFR mutations in Chinese NSCLC patients is similar to that in East Asian patients [27,28], but higher than that in Caucasian populations, and the frequency of KRAS mutation is quite opposite [5]. Importantly, KRAS mutations are associated with lack of response to EGFR inhibitor therapy in NSCLC [8]. This provides a rationale to predict relatively high response rates to EGFR-TKIs in Chinese patients, based on the relatively high EGFR mutation rate and low KRAS mutation rate. Taken together, our results demonstrate that by combining EGFR and KRAS mutation analysis in NSCLC patients, decisions on appropriateness of EGFR TKI therapy can be made in half of our patient cohort.
In conclusion, deparaffinization and lysis by hydrothermal pressure offers an unprecedented simplicity and speed of DNA release from FFPE tissue. After purification, high quality DNA can be sufficient for PCR-based direct sequencing. This method offers opportunities for rapid nucleic acid extraction for EGFR and KRAS mutation analysis of FFPE NSCLC specimens from either surgical resection or core needle biopsy in clinical diagnostic practice. Continual detection of novel EGFR mutations may also be useful in screening for molecular abnormality related to primary or acquired EGFR resistance.
Disclosure of conflict of interest
None.
References
- 1.Hynes NE, Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 2005;5:341–354. doi: 10.1038/nrc1609. [DOI] [PubMed] [Google Scholar]
- 2.Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N, Sunpaweravong P, Han B, Margono B, Ichinose Y, Nishiwaki Y, Ohe Y, Yang JJ, Chewaskulyong B, Jiang H, Duffield EL, Watkins CL, Armour AA, Fukuoka M. Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med. 2009;361:947–957. doi: 10.1056/NEJMoa0810699. [DOI] [PubMed] [Google Scholar]
- 3.Riely GJ, Politi KA, Miller VA, Pao W. Update on epidermal growth factor receptor mutations in non-small cell lung cancer. Clin Cancer Res. 2006;12:7232–7241. doi: 10.1158/1078-0432.CCR-06-0658. [DOI] [PubMed] [Google Scholar]
- 4.Hirsch FR, Bunn PA Jr. EGFR testing in lung cancer is ready for prime time. Lancet Oncol. 2009;10:432–433. doi: 10.1016/S1470-2045(09)70110-X. [DOI] [PubMed] [Google Scholar]
- 5.Riely GJ, Kris MG, Rosenbaum D, Marks J, Li A, Chitale DA, Nafa K, Riedel ER, Hsu M, Pao W, Miller VA, Ladanyi M. Frequency and distinctive spectrum of KRAS mutations in never smokers with lung adenocarcinoma. Clin Cancer Res. 2008;14:5731–5734. doi: 10.1158/1078-0432.CCR-08-0646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.De Luca A, Normanno N. Predictive biomarkers to tyrosine kinase inhibitors for the epidermal growth factor receptor in non-small-cell lung cancer. Curr Drug Targets. 2010;11:851–864. doi: 10.2174/138945010791320773. [DOI] [PubMed] [Google Scholar]
- 7.Mao C, Qiu LX, Liao RY, Du FB, Ding H, Yang WC, Li J, Chen Q. KRAS mutations and resistance to EGFR-TKIs treatment in patients with non-small cell lung cancer: a meta-analysis of 22 studies. Lung Cancer. 2010;69:272–278. doi: 10.1016/j.lungcan.2009.11.020. [DOI] [PubMed] [Google Scholar]
- 8.Pao W, Wang TY, Riely GJ, Miller VA, Pan Q, Ladanyi M, Zakowski MF, Heelan RT, Kris MG, Varmus HE. KRAS mutations and primary resistance of lung adenocarcinomas to gefitinib or erlotinib. PLoS Med. 2005;2:e17. doi: 10.1371/journal.pmed.0020017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hammerman PS, Janne PA, Johnson BE. Resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small cell lung cancer. Clin Cancer Res. 2009;15:7502–7509. doi: 10.1158/1078-0432.CCR-09-0189. [DOI] [PubMed] [Google Scholar]
- 10.Benesova L, Minarik M, Jancarikova D, Belsanova B, Pesek M. Multiplicity of EGFR and KRAS mutations in non-small cell lung cancer (NSCLC) patients treated with tyrosine kinase inhibitors. Anticancer Res. 2010;30:1667–1671. [PubMed] [Google Scholar]
- 11.Nakajima T, Yasufuku K. How I do it--optimal methodology for multidirectional analysis of endobronchial ultrasound-guided transbronchial needle aspiration samples. J Thorac Oncol. 2011;6:203–206. doi: 10.1097/JTO.0b013e318200f496. [DOI] [PubMed] [Google Scholar]
- 12.Dacic S. EGFR assays in lung cancer. Adv Anat Pathol. 2008;15:241–247. doi: 10.1097/PAP.0b013e31817bf5a9. [DOI] [PubMed] [Google Scholar]
- 13.Zhong HH, Liu Y, Wu BQ, Hui P. Deparaffinization and lysis by hydrothermal pressure (pressure cooking) coupled with chaotropic salt column purification: a rapid and efficient method of DNA extraction from formalin-fixed paraffin-embedded tissue. Diagn Mol Pathol. 2013;22:52–58. doi: 10.1097/PDM.0b013e318263f092. [DOI] [PubMed] [Google Scholar]
- 14.Hasan RK, Wulfkuhle JD, Liotta LA, Petricoin EF. Molecular technologies for personalized cancer management. JAMA. 2004;291:1644–1645. doi: 10.1001/jama.291.13.1644. [DOI] [PubMed] [Google Scholar]
- 15.Liu Y, Xu ML, Zhong HH, Heng WJ, Wu BQ. EGFR mutations are more frequent in well-differentiated than in poor-differentiated lung adenocarcinomas. Pathol Oncol Res. 2008;14:373–379. doi: 10.1007/s12253-008-9113-1. [DOI] [PubMed] [Google Scholar]
- 16.Meert AP, Martin B, Verdebout JM, Paesmans M, Berghmans T, Ninane V, Sculier JP. Correlation of different markers (p53, EGF-R, c-erbB-2, Ki-67) expression in the diagnostic biopsies and the corresponding resected tumors in non-small cell lung cancer. Lung Cancer. 2004;44:295–301. doi: 10.1016/j.lungcan.2003.12.009. [DOI] [PubMed] [Google Scholar]
- 17.Chen CM, Chang JW, Cheung YC, Lin G, Hsieh JJ, Hsu T, Huang SF. Computed tomography-guided core-needle biopsy specimens demonstrate epidermal growth factor receptor mutations in patients with non-small-cell lung cancer. Acta Radiol. 2008;49:991–994. doi: 10.1080/02841850802294410. [DOI] [PubMed] [Google Scholar]
- 18.Zhuang YP, Wang HY, Shi MQ, Zhang J, Feng Y. Use of CT-guided fine needle aspiration biopsy in epidermal growth factor receptor mutation analysis in patients with advanced lung cancer. Acta Radiol. 2011;52:1083–1087. doi: 10.1258/ar.2011.110150. [DOI] [PubMed] [Google Scholar]
- 19.Ellison G, Donald E, McWalter G, Knight L, Fletcher L, Sherwood J, Cantarini M, Orr M, Speake G. A comparison of ARMS and DNA sequencing for mutation analysis in clinical biopsy samples. J Exp Clin Cancer Res. 2010;29:132. doi: 10.1186/1756-9966-29-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nakajima T, Yasufuku K, Suzuki M, Hiroshima K, Kubo R, Mohammed S, Miyagi Y, Matsukuma S, Sekine Y, Fujisawa T. Assessment of epidermal growth factor receptor mutation by endobronchial ultrasound-guided transbronchial needle aspiration. Chest. 2007;132:597–602. doi: 10.1378/chest.07-0095. [DOI] [PubMed] [Google Scholar]
- 21.Pao W, Ladanyi M. Epidermal growth factor receptor mutation testing in lung cancer: searching for the ideal method. Clin Cancer Res. 2007;13:4954–4955. doi: 10.1158/1078-0432.CCR-07-1387. [DOI] [PubMed] [Google Scholar]
- 22.Schuurbiers OC, Looijen-Salamon MG, Ligtenberg MJ, van der Heijden HF. A brief retrospective report on the feasibility of epidermal growth factor receptor and KRAS mutation analysis in transesophageal ultrasound- and endobronchial ultrasound-guided fine needle cytological aspirates. J Thorac Oncol. 2010;5:1664–1667. doi: 10.1097/JTO.0b013e3181f0bd93. [DOI] [PubMed] [Google Scholar]
- 23.An SJ, Chen ZH, Su J, Zhang XC, Zhong WZ, Yang JJ, Zhou Q, Yang XN, Huang L, Guan JL, Nie Q, Yan HH, Mok TS, Wu YL. Identification of enriched driver gene alterations in subgroups of non-small cell lung cancer patients based on histology and smoking status. PLoS One. 2012;7:e40109. doi: 10.1371/journal.pone.0040109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Xu J, He J, Yang H, Luo X, Liang Z, Chen J, Cai Z, Xu J, Ren-Heidenreich L. Somatic mutation analysis of EGFR, KRAS, BRAF and PIK3CA in 861 patients with non-small cell lung cancer. Cancer Biomark. 2011-2012;10:63–69. doi: 10.3233/CBM-2012-0233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wu JY, Yu CJ, Chang YC, Yang CH, Shih JY, Yang PC. Effectiveness of tyrosine kinase inhibitors on “uncommon” epidermal growth factor receptor mutations of unknown clinical significance in non-small cell lung cancer. Clin Cancer Res. 2011;17:3812–3821. doi: 10.1158/1078-0432.CCR-10-3408. [DOI] [PubMed] [Google Scholar]
- 26.Chen Z, Feng J, Saldivar JS, Gu D, Bockholt A, Sommer SS. EGFR somatic doublets in lung cancer are frequent and generally arise from a pair of driver mutations uncommonly seen as singlet mutations: one-third of doublets occur at five pairs of amino acids. Oncogene. 2008;27:4336–4343. doi: 10.1038/onc.2008.71. [DOI] [PubMed] [Google Scholar]
- 27.Tam IY, Chung LP, Suen WS, Wang E, Wong MC, Ho KK, Lam WK, Chiu SW, Girard L, Minna JD, Gazdar AF, Wong MP. Distinct epidermal growth factor receptor and KRAS mutation patterns in non-small cell lung cancer patients with different tobacco exposure and clinicopathologic features. Clin Cancer Res. 2006;12:1647–1653. doi: 10.1158/1078-0432.CCR-05-1981. [DOI] [PubMed] [Google Scholar]
- 28.Kosaka T, Yatabe Y, Endoh H, Kuwano H, Takahashi T, Mitsudomi T. Mutations of the epidermal growth factor receptor gene in lung cancer: biological and clinical implications. Cancer Res. 2004;64:8919–8923. doi: 10.1158/0008-5472.CAN-04-2818. [DOI] [PubMed] [Google Scholar]
