Abstract
Objective
To identify the vectors and reservoirs of cutaneous leishmaniasis in the endemic focus of Farashband, Fars Province, South of Iran.
Methods
Sticky papers and Sherman trap were used for collection of sand flies and rodents, respectively. Polymerase chain reaction (PCR) of kDNA, ITS1-rDNA were used for identification of Leishmania parasite in sand flies as well as rodents.
Results
Totally 2 010 sand flies were collected and the species of Phlebotomus papatasi Scopoli was the common specimen in outdoors and indoors places. PCR technique was employed on 130 females of Phlebotomus papatasi. One of them (0.76%) was positive to parasite Leishmania major (L. major) and one specimen (0.76%) was positive to Leishmania infantum. Microscopic investigation on blood smear of the animal reservoirs for amastigote parasites revealed 16 (44%) infected Tatera indica. Infection of them to L. major was confirmed by PCR against kDNA loci of the parasite.
Conclusions
The results indicated that Phlebotomus papatasi was the dominant species circulating two species of parasites including L. major and Leishmania infantum among human and reservoirs. Furthermore, Tatera indica is the only main host reservoir for maintenance of the parasite source in the area.
Keywords: Leishmania infantum, Leishmania major, Vector, Reservoir, Iran
1. Introduction
Cutaneous leishmaniasis (CL) is a worldwide public health and a social problem in many developing countries. It can affect skin and mucous membranes, and is caused by different Leishmania species widespread in 98 countries in the New and Old World.
Old World cutaneous leishmaniasis is present in many endemic areas in North Africa, the Mediterranean, the Middle East, the Indian subcontinent and Central Asia. The species responsible for Old World cutaneous leishmaniasis are mainly Leishmania major (L. major) and Leishmania tropica (L. tropica). Leishmania infantum (L. infantum). Leishmania donovani (L. donovani) can also cause localized CL but are observed less frequently in the Mediterranean areas. Diffuse CL is uncommon and is caused by Leishmania aethiopica in Africa[1],[2].
There are several reports indicating occurrence of CL due to L. major in Iran[3]–[6]. CL is reported from 55% of the 31 provinces in Iran[7]. The annual incidence of cutaneous leishmaniasis has gradually increased in Iran and about 30 000 cases has been reported in 2011 (unpublished data). This increaseing outbreak is related to human-sand fly-rodent contacts, itself probably the product of the development of irrigation schemes and the spread of human populations into the habitats of the vector and the rodents that act as reservoir hosts.
Based on animal reservoir hosts there are four foci of disease in Iran[3]. The first one has been located in central and northeast of Iran, where Rhombomys opimus Lichtenstein and Phlebotomus papatasi Scopoli (P. papatasi) play important roles as reservoirs and vectors of the disease[3]. The second foci are located in the west and southwest of Iran, where Tatera indica Hardwicke (T. indica) is replaced with Rhombomys opymus as a reservoir and P. papatasi as a vector[8]. Baluchistan province, in the southeast of Iran is considered as the third focus of L. major and Meriones hurrianae Jordon has been approved as its natural reservoir host[9]. The most rural areas of Fars province in southern Iran can be considered as the L. major focus where Meriones libycus Lichtenstein is the primary and main reservoir host of the disease, while Rhombomys opimus and T. indica were absent and P. papatasi is considered as the proven vector of L. major[4],[5].
Farashband district of Fars province in the south of Iran is an important L. major focus and this study was performed to study the epidemiology of the disease in the region. The main objectives were to determine the sand flies species responsible for most transmission of L.major to human, as well as to determine the main host reservoir of the disease.
2. Material and methods
2.1. Study area
The study was carried out in Farashband city located in Farahband County, Fars province in southern Iran. The capital of the county is Farashband. At the 2006 census, the county's population was 38 679, in 8 474 families. The county is subdivided into two districts: the Central district and Dehram district with three cities: Farashband, Nujin, and Dehram. Farashband city is located at an altitude of 775 m above sea level. Farashband's climate has distinct seasons, and is overall classed as a semi-arid climate. Summers are hot, with an average of 37.8 °C. Winters are cool, with average low temperatures below freezing in December and January. Around 250-3 000 mm of rain falls each year.
2.2. Sand flies collection and identification
Sand flies were collected from indoors (bedroom, guestroom, and toilet) as well as outdoors (rodent burrows, wall cracks) biweekly using sticky papers in the city with L. major cases during the summer of 2011. For each collection time, 300 sticky traps were set up during the sand flies high active period (July-September) in the ten selected places of city. Collected sand fly specimens were washed once in 1% detergent then twice in sterile distilled water. Each specimen was then dissected in a drop of fresh sterile normal saline by cutting off the head and abdominal terminalia with sterilized forceps and disposable needles. The rest of the body was stored in the sterile Eppendorf® micro tubes for DNA extraction. Specimens were mounted on glass slides using Puri's medium and identified using the identification keys for species within Larrousius group and for species of other groups and subgenera[10]–[12].
2.3. DNA extraction
DNA was extracted by using the Bioneer® Genomic DNA Extraction Kit. Extraction was carried out by grinding of individual sand fly in a micro tube using glass pestle following the kit protocol and stored at 4 °C. Double distilled water was used as a negative control and DNA from L. major (MHOM/IR/75/ER) and L. tropica (MHOM/IR/03/Mash-878) provided by the Parasitology Department, School of Public Health, Tehran University of Medical Sciences were used as positive controls[13].
2.4. Detection and identification of Leishmania species
Initial screening of sand flies was performed by nested-PCR amplification of kinetoplast DNA (kDNA) using the primers (Table 1) and protocol described by Noyes et al[14]. This method is highly sensitive and is recommended for initial screening. Amplification was carried out in two steps, both in the same tube. This PCR protocol is able to identify Leishmania parasites by producing a 680 bp for L. infantum/L. donovani, 560 bp for L. major, and a 750 bp for L. tropica. The cycling conditions were 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 seconds, 55 °C for 60 seconds, and 72 °C for 90 seconds. One micro liter of a 9:1 dilution in water of the first-round product was used as template DNA for the second round in a total volume of 30 mL under the same conditions as those for the first round, except with primers LIR and 13Z. Due to presence of many DNA polymorphisms in kDNA of each Leishmania species, sequencing of kDNA is problematic. Therefore, further identification of Leishmania parasites was done using the ITS1-PCR[14],[15]. A set of primers (Table 1) LITSR and L5.8S was used to amplify 340 bp of rDNA including parts of 3′ end of the 18S rDNA gene, complete ITS1, and part of 5′ end of the 5.8S rDNA gene. Also, the ITS1 PCR products (340 bp) of the samples that demonstrated Leishmania profile were sequenced (Seqlab, Göttingen, Germany), employing the same primers used for the PCR. The sequences obtained were processed and aligned, using the multiple alignment program clustal X[16]. Homologies with the available sequence data in GenBank was checked by using BLAST analysis software (http://www.ncbi.nlm.nih.gov/BLAST). A PCR protocol of 30 cycles of denaturation was performed for 30 s at 94 °C, annealing 1 min at 62 °C and elongation for 1 min at 72 °C, followed by a final elongation of 10 min at 72 °C. All PCR products were analyzed by 1%-1.5% agarose gel electrophoresis, followed by ethidium bromide staining and visualization under UV light. Standard DNA fragments (100 bp ladder, Fermentas®) were used to permit sizing.
Table 1. List and details of primers used in this study.
| Target | PCR step | Name | Sequences (5′-3′) |
| kDNA | First | CSB2XF | CGAGTAGCAGAAACTCCCGTTCA |
| CSB1XR | ATTTTTCGCGATTTTCGCAGAACG | ||
| Second | 13Z | ACTGGGGGTTGGTGTAAAATAG | |
| LIR | TCGCAGAACGCCCCT | ||
| ITS1 | One | LITSR | CTGGATCATTTTCCGATG |
| L5.8S | TGATACCACTTATCGCACTT |
3. Results
3.1. Sand flies
Altogether 1 800 sticky traps were installed and 2010 specimens comprising 7 species of sand flies were collected and identified. They were P. papatasi, Phlebotomus alexandri, Sergentomyia sintoni, Sergentomyia sumbarica, Sergentomyia clydei, Sergentomyia baghdadis (S. baghdadis) and Sergentomyia theodori. Among the collected sand flies 850 specimens were belong indoor places including: P. papatasi (88%), S. baghdadis (10%) and Sergentomyia sintoni (2%). About 702 specimens of sand flies were collected from rodent burrows. They were P. papatasi (61%), Sergentomyia theodori (28%), Sergentomyia clydei (8%), Sergentomyia sumbarica (1%), S. sintoni (1%) and S. baghdadis (1%). Four specie of P. papatasi (68%), P. alexandri (14%), Sergentomyia sintoni (16%) and S. baghdadis (2%) were caught from out door places. The species of P. papatasi was dominant in out doors, indoors and rodent burrows. The species richness of sand flies in rodent burrows were higher than indoors and out door places.
In all, 130 females of P. papatasi were tested against the Leishmania parasite genome. Only 2 out of them were positive for L. infantum and L. major using the nested PCR against kDNA. This was observed in the kDNA nested-PCR amplification assays where a 680 and 560 bp PCR band were produced for L. infantum and L. major respectively (Figure 1). Examination of the two infected specimens showed that their abdomen were empty. Further analysis showed that they were positive against ITS1 locus and produced a band of approximately 340 bp. This is the first report of P. papatasi naturally infected with L. infantum in Iran or maybe in the world. The ITS1 DNA sequences were obtained for only one of these specimens and submitted to Genbank database with accession number (KC57045) in comparison with other available data, confirming it as L. infantum. The specimen was identical (99%) or very similar to several L. infantum sequences deposited in Genbank, including isolates from Uzbekistan (Accession No. FN398341), Iran (Accession Nos. KC347301 and HQ535858), France (Accession No. AJ634340) and India (Accession No. EU326227). Also it was found to be 99% similar to Leishmania chagasi from Brazil (Accession No. AJ000304 ) and 99% similar to L. donovani from Bangladesh (Accession No. AB725909).
Figure 1. kDNA nested PCR amplification (680 bp).
L. infantum in P. papatasi (Lane 1, 560 bp); L. major in P. papatasi and T. indica (Lanes 2 and 3); Positive control of L. major (Lane 4, 720 bp); Positive control of L. tropica (Lane 5); Negative control (Lane 6) and (M)100 bp molecular weight marker (Fermentase).
3.2. Rodents
During this study 36 rodents were captured and identified. They were T. indica. Although all collected animals were examined for parasite infection under a light microscope, Leishmania parasite were found only in smears of 16 (44%) of them. Each sample from infected rodents was inoculated subcutaneously at the base of tail of one BALB/c. Inoculation of the parasite from infected rodents revealed the presence of amastigotes into the nodules and ulcer of the experimental mice after 30 d of the inoculation period. Parasite infections were observed in both male and female animals. Isolated parasites from infected rodents were identified as L. major using kDNA nested PCR with 560 bp band (Figure 1).
Furthermore we observed mix infection of some rodents to amastigote and promastigote after two month keeping in animal house ( Figure 2).
Figure 2. Promastigote and amastigote infection of wild caught Tatera indica after two month keeping in animal house.

4. Discussion
Ecology and epidemiology of leishmaniasis are important measures for management and planning of disease control. The entomological survey accompanied by epidemiological data is a major component for combating against disease. Several epidemiological and entomological findings, including anthropophily and common infection of the sand flies with the same Leishmania parasite that found in patient in the same places, suggested the capacity of sand fly as a vector[17],[18]. Recently, molecular techniques (PCR) have been employed for vector incrimination of sand flies[18]–[20]. The highly sensitive technique of PCR has been used for Leishmania in sand flies in some endemic areas, including Iran and India[3],[4],[18],[19],[21]–[23]. Results of our study revealed that the high density of P. papatasi in indoor, out door and rodent burrow resting places and its infection with L. major is attributed to the fact that this species plays a major role as a principal vector in the region.
In this study we found natural infection of P. papatasi to L. infantum. This parasite is causative agent of infantile visceral leishmaniasis in the old world. There are several vectors of L. infantum in the subgenus Laroussius, including Phlebotomus (Laroussius) perfiliewi, P. (Lar.) neglectus, P. (Lar.) syriacus, P. (Lar.) major, P. (Lar.) kandelakii and P. (Lar.) tobbi have been reported from the eastern Mediterranean basin[17],[18],[20]. We could not find any reports on natural infection of wild caught P. papatasi to L. infantum and this is the first one in Iran and maybe in the world. Our study showed that this sand fly circulating two species of Leishmania parasite including L. major and L. infantum among human and reservoirs. There is no human visceral leishmaniasis cases in the study areas.
In this survey we isolated some L. major parasites from T. indica, the only collected rodents species. This fact confirms that T. indica is the principal reservoir of L. major in Farashband city. Leishmania infection of T. indica has been reported in west and southwest of Iran with 12.5% and 9.0% positive cases respectively[8]. In a study in southeastern Iran L. major was found to be 3.7% infection in this region. There is a report on Leishmania infection of T. indica as a reservoir of cutaneous leishmaniasis in Baluchistan, Pakistan[24].
T. indica ranges from northern Arabia throughout the Indomalayan region[25]. This species commonly known as the Indian gerbil, was first recorded from southeastern Turkey by Misonne[26].
This is the first report on natural infection of wild T. indica to L. major in Fars province, south of Iran. This rodent is the only infected animal and it seems to play as a reservoir host of the disease in the study areas.
The result of the current study revealed all of the important factors present for establishment of the disease in the region. These include human activities close to T. indica burrows, the presence of high density of P. papatasi in the rodent burrows and indoors, and proximity of human habitat to T. indica colonies, which have led to emergence of a new focus of L. major in the region. Further study is needed for confirming the presence of L. infantum in this region.
Acknowledgments
The authors gratefully thank Farashband Health Center, Fars province, south of Iran for its field assistance. This study was financially supported by the School of Public Health, Tehran University of Medical Sciences (Project No.13946).
Comments
Background
Cutaneous leishmaniasis is a worldwide public health and a social problem in many developing countries. It can affect the skin and mucous membranes, and is caused by different Leishmania species widespread in 98 countries in the New and Old World. Old World cutaneous leishmaniasis is present in many endemic areas in North Africa, the Mediterranean, the Middle East, the Indian subcontinent and Central Asia. Phlebotomine sand flies are the only biological vectors, and rodents play as the reservoir hosts of the disease.
Research frontiers
This article is discussing on the detection and identification of Leishmania parasite and their corresponding vectors as well as the reservoir host of the disease using molecular methods.
Related reports
Ecology and epidemiology of leishmaniasis are important measures for management and planning of disease control. The entomological survey accompanied by epidemiological data is a major component for combating against disease. Several epidemiological and entomological finding including anthropophily, common infection of the sand flies with the same Leishmania parasite that found in patient in the same places, suggested the capacity of sand fly as a vector. Recently, molecular techniques (PCR) have been employed for vector incrimination of sand flies. The highly sensitive technique of PCR has been used for Leishmania in sand flies in some endemic areas including Iran, India and several countries with leishmaniasis problem. Rodents are regarded as resources of rural type of cutaneous leishmaniasis.
T. indica is main reservoir host of cutaneous leishmaniasis in west and southwest of Iran. This species of rodent has been reported from Pakistan as a reservoir host of disease.
Innovations and breakthroughs
This study for the first time found L. infantum in P. papatasi in Iran and maybe in the world. And it is also the first time to find L. major in T. indica in Fars province, South of Iran. This study also revealed mix infection of wild caught T. indica with amastigote and promastigot after two month keeping in animal house.
Applications
Determination and identification of vectors and reservoir host of cutaneous leishmaniasis are two important things for planning of effectiveness program for control of the disease in rural areas.
Peer review
This is an interesting study which used molecular markers for identification of Leishmania parasites at species and strain levels and identification of probable vectors and reservoir host of leishmaniasis. It provided useful information to address the key epidemiological questions for control of disease.
Footnotes
Foundation Project: Supported by the School of Public Health, Tehran University of Medical Sciences (Project No.13946).
Conflict of interest statement: We declare that we have no conflict of interest.
References
- 1.Goto H, Lindoso JA. Current diagnosis and treatment of cutaneous and mucocutaneous leishmaniasis. Expert Rev Anti Infect Ther. 2010;8(4):419–433. doi: 10.1586/eri.10.19. [DOI] [PubMed] [Google Scholar]
- 2.Hotez PJ, Savioli L, Fenwick A. Neglected tropical diseases of the Middle East and North Africa: review of their prevalence, distribution, and opportunities for control. PLoS Negl Trop Dis. 2012;6(2):e1475. doi: 10.1371/journal.pntd.0001475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rassi Y, Javadian E, Amin M, Rafizadeh S, Vatandoost H, Motazedian H. Meriones libycus is the main reservoir of zoonotic cutaneous leishmaniasis in South Islamic Republic of Iran. East Med Health J. 2006;12(3–4):475–477. [PubMed] [Google Scholar]
- 4.Rassi Y, Gassemi MM, Javadian E, Rafizadeh S, Motazedian H, Vatandoost H. Vectors and reservoirs of cutaneous leishmaniasis in Marvdasht district, southern Islamic Republic of Iran. East Med Health J. 2007;13(3):686–693. [PubMed] [Google Scholar]
- 5.Rassi Y, Sofizadeh A, Abai MR, Oshaghi MA, Rafizadeh S, Mohebail M, et al. et al. Molecular detection of Leishmania major in the vectors and reservoir hosts of cutaneous leishmaniasis in Kalaleh District, Golestan Province, Iran. Iran J Arthropod Borne Dis. 2008;2(2):21–27. [Google Scholar]
- 6.Rassi Y, Abai MR, Javadian E, Rafizadeh S, Imamian H, Mohebali M, et al. et al. Molecular detection of Leismania infection due to Leishmania major and Leishmania turanica in the vectors and reservoir host in Iran. Vector Borne Zoonotic Dis. 2011;11(2):145–150. doi: 10.1089/vbz.2009.0167. [DOI] [PubMed] [Google Scholar]
- 7.Afshar AA, Rassi Y, Sharifi I, Abai M, Oshaghi M, Yaghoobi-Ershadi M, et al. et al. Susceptibility status of Phlebotomus papatasi and P. sergenti (Diptera: Psychodidae) to DDT and deltamethrin in a focus of cutaneous leishmaniasis after earthquake strike in Bam, Iran. Iran J Arthropod Borne Dis. 2011;5(2):32–41. [PMC free article] [PubMed] [Google Scholar]
- 8.Azizi K, Moemenbellah-Fard MD, Fakoorziba MR, Fekri S. Gerbillus nanus (Rodentia: Muridae): a new reservoir host of Leishmania major. Ann Trop Med Parasitol. 2011;105(6):431–437. doi: 10.1179/1364859411Y.0000000036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kassiri H, Javadian E, Abdigoudarzi M. Natural Leishmania infection in Meriones hurrianae and Tatera indica (Rodentia: Cricetidae: Gerbillinae) in Sistan-Baluchistan province, South-Eastern of Iran. Adv Stud Biol. 2011;3(6):247–256. [Google Scholar]
- 10.Absavaran A, Rassi Y, Parvizi P, Oshaghi M, Abaie M, Rafizadeh S, et al. et al. Identification of sand flies of the subgenus Larroussius based on molecular and morphological characters in North Western Iran. Iran J Arthropod Borne Dis. 2009;3:22–35. [PMC free article] [PubMed] [Google Scholar]
- 11.Theodor O, Mesghali A. On the Phlebotominae of Iran. J Med Entomol. 1964;1:285–300. doi: 10.1093/jmedent/1.3.285. [DOI] [PubMed] [Google Scholar]
- 12.Lewis DJ. A taxonomic review of the genus Phlebotomus (Diptera: Psychodidae) Bull Br Mus Nat Hist (Ent) 1982;45:121–209. [Google Scholar]
- 13.Oshaghi MA, Ravasan NM, Hide M, Javadian EA, Rassi Y, Sedaghat MM, et al. et al. Development of species-specific PCR and PCR-restriction fragment length polymorphism assays for L. infantum/L. donovani discrimination. Exp Parasitol. 2009;122(1):61–65. doi: 10.1016/j.exppara.2009.01.015. [DOI] [PubMed] [Google Scholar]
- 14.Maia C, Afonso MO, Neto L, Dionísio L, Campino L. Molecular detection of Leishmania infantum in naturally infected Phlebotomus perniciosus from Algarve region, Portugal. J Vector Borne Dis. 2009;46(4):268–72. [PubMed] [Google Scholar]
- 15.Rassi Y, Saghafipour A, Abai MR, Oshaghi MA, Rafizadeh S, Mohebali M, et al. et al. Phlebotomus papatasi and Meriones libycus as the vector and reservoir host of cutaneous leishmaniasis in Qomrood District, Qom Province, central Iran. Asian Pac J Trop Med. 2011;4(2):97–100. doi: 10.1016/S1995-7645(11)60045-X. [DOI] [PubMed] [Google Scholar]
- 16.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface. Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res. 1997;25:4876–4882. doi: 10.1093/nar/25.24.4876. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Sharma U, Singh S. Insect vectors of Leishmania: distribution, physiology and their control. J Vector Borne Dis. 2008;45:255–272. [PubMed] [Google Scholar]
- 18.Oshaghi MA, Maleki Ravasan N, Hide M, Javadian E, Rassi Y, Sadraei J, et al. et al. Phlebotomus perfiliewi transcaucasicus is circulating both Leishmania donovani and L. infantum in northwest Iran. Exp Parasitol. 2009;123:218–225. doi: 10.1016/j.exppara.2009.07.004. [DOI] [PubMed] [Google Scholar]
- 19.Oshaghi MA, Ravasan NM, Javadian EA, Mohebali M, Hajjaran H, Zare Z, et al. et al. Vector incrimination of sand flies in the most important visceral leishmaniasis focus in Iran. Am J Trop Med Hyg. 2009;81:572–577. doi: 10.4269/ajtmh.2009.08-0469. [DOI] [PubMed] [Google Scholar]
- 20.Rassi Y, Javadian E, Nadim A, Rafizadeh S, Zahraii A, Azizi K, et al. et al. Phlebotomus perfiliewi transcaucasicus, a vector of Leishmania infantum in Northwestern Iran. J Med Entomol. 2009;46:1094–1098. doi: 10.1603/033.046.0516. [DOI] [PubMed] [Google Scholar]
- 21.de Bruijn M H, Barker DC. Diagnosis of new world leishmaniasis: specific detection of species of the Leishmania brasiliensis complex by amplification of kinetoplast DNA. Acta Trop. 1992;52:5–58. doi: 10.1016/0001-706x(92)90006-j. [DOI] [PubMed] [Google Scholar]
- 22.Campino L, Cortes S, Dionísio L, Neto L, Odete Afonso M, Maia C. The first detection of Leishmania major in naturally infected Sergentomyia minuta in Portugal. Mem Inst Oswaldo Cruz. 2013;108(4):516–518. doi: 10.1590/0074-0276108042013020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Azizi K, Rassi Y, Javadian E, Motazedian MH, Rafizadeh S, Yaghoobi Ershadi MR, et al. et al. Phlebotomus (Paraphlebotomus) alexandri: a probable vector of Leishmania infantum in Iran. Ann Trop Med Parasitol. 2006;100:63–68. doi: 10.1179/136485906X78454. [DOI] [PubMed] [Google Scholar]
- 24.Rab MA, Azim J, Iqbal J, Hamid A, Burney MI, Seyedi-Rashti MA. Cutaneous leishmaniasis in Baluchistan; reservoir host and sand fly vector in Uthal, Lasbella. J Pak Med Assoc. 1986;36:134–138. [PubMed] [Google Scholar]
- 25.Harrison DL, Bates PJJ. The mammals of Arabia. 2 ed. Sevenoaks, UK: Harrison Zoological Museum; 1991. Felidae; pp. 156–172. [Google Scholar]
- 26.Khajeh A, Meshkani J. A study of intraspecies variations of Indian gerbil, Tatera indica Hardwicke, 1807 (Muridae, Rodentia) in Eastern Border of Iran. Pak J Biol Sci. 2010;13(2):59–65. doi: 10.3923/pjbs.2010.59.65. [DOI] [PubMed] [Google Scholar]

