Skip to main content
Genetics logoLink to Genetics
. 2013 Sep;195(1):147–158. doi: 10.1534/genetics.113.153320

Effete, a Drosophila Chromatin-Associated Ubiquitin-Conjugating Enzyme That Affects Telomeric and Heterochromatic Position Effect Variegation

Francesca Cipressa *,†,1, Sabrina Romano ‡,1, Silvia Centonze , Petra I zur Lage §, Fiammetta Vernì †,**, Patrizio Dimitri †,**, Maurizio Gatti †,**, Giovanni Cenci *,†,2
PMCID: PMC3761297  PMID: 23821599

Abstract

Drosophila telomeres are elongated by the transposition of telomere-specific retrotransposons rather than telomerase activity. Proximal to the terminal transposon array, Drosophila chromosomes contain several kilobases of a complex satellite DNA termed telomere-associated sequences (TASs). Reporter genes inserted into or next to the TAS are silenced through a mechanism called telomere position effect (TPE). TPE is reminiscent of the position effect variegation (PEV) induced by Drosophila constitutive heterochromatin. However, most genes that modulate PEV have no effect on TPE, and systematic searches for TPE modifiers have so far identified only a few dominant suppressors. Surprisingly, only a few of the genes required to prevent telomere fusion have been tested for their effect on TPE. Here, we show that with the exception of the effete (eff; also called UbcD1) mutant alleles, none of the tested mutations at the other telomere fusion genes affects TPE. We also found that mutations in eff, which encodes a class I ubiquitin-conjugating enzyme, act as suppressors of PEV. Thus, eff is one of the rare genes that can modulate both TPE and PEV. Immunolocalization experiments showed that Eff is a major constituent of polytene chromosomes. Eff is enriched at several euchromatic bands and interbands, the TAS regions, and the chromocenter. Our results suggest that Eff associates with different types of chromatin affecting their abilities to regulate gene expression.

Keywords: Effete, telomere position effect, position effect variegation, telomeres, Drosophila


TELOMERES are specialized nucleic acid–protein complexes that counteract incomplete terminal DNA replication and shield chromosome ends from inappropriate DNA repair, which might result in end-to-end fusion (Palm and De Lange 2008; Jain and Cooper 2010; Raffa et al. 2011). In most organisms, telomeres terminate with tandemly repeated G-rich sequences, which are added to chromosome ends by the telomerase holoenzyme (Blackburn et al. 2006). These telomere short repeats associate with sequence-specific binding factors, which in turn recruit additional telomeric proteins, forming multiprotein complexes that are crucial for chromosome end homeostasis. A well-known example of such terminal complexes is shelterin, the six-protein assembly that coats human chromosome ends, allowing cells to distinguish between natural chromosome ends and DNA breaks (Palm and De Lange 2008).

Drosophila lacks telomerase and fly telomeres are elongated by transposition of three specialized retrotransposons—HeT-A, TART, and TAHRE—that form terminal arrays (HTT arrays) of complete and incomplete elements. Consistent with this situation, Drosophila telomeres are assembled independently of the sequence of terminal DNA (Mason et al. 2008; Pardue and Debaryshe 2011). Studies carried out in the past 15 years have detected many factors required to prevent telomere fusions (TFs) (for reviews see Cenci et al. 2005; Rong 2008; Raffa et al. 2011). The isolation and characterization of mutants displaying frequent TFs in larval brain cells has led to the identification of 10 genes required for telomere capping: effete/UbcD1, which encodes an E2 ubiquitin-conjugating enzyme (Cenci et al. 1997); the Drosophila homologs of the ATM, RAD50, MRE11, and NBS1 DNA repair genes (Bi et al. 2004, 2005; Ciapponi et al. 2004, 2006; Oikemus et al. 2004, 2006; Silva et al. 2004; Song et al. 2004); Su(var)205 and caravaggio (cav), which encode heterochromatin protein 1 (HP1) and HP1/ORC-associated protein (HOAP), respectively (Fanti et al. 1998; Cenci et al. 2003); without children (woc), which specifies a putative transcription factor (Raffa et al. 2005); modigliani (moi), which encodes a nonconserved HOAP-binding protein (Raffa et al. 2009); and verrocchio (ver), which specifies an OB-fold-containing protein structurally homologous to STN1 (Raffa et al. 2010). An additional telomere-capping protein called HP1-HOAP interacting protein (HipHop), was identified among the polypeptides that coprecipitate with HOAP and shown to prevent TFs in S2 cultured cells (Gao et al. 2010).

HOAP, Moi, Ver, and HipHop are nonconserved fast-evolving proteins that localize and function only at telomeres. These proteins form a capping complex we call terminin, which is functionally analogous to shelterin, although it binds chromosome ends independently of the DNA sequence (Raffa et al. 2011). The other proteins that protect Drosophila telomeres from fusion events (Eff, HP1, ATM, Rad50, Mre11, Nbs, and Woc) are evolutionarily conserved, do not localize only at telomeres, and do not play telomere-specific functions (Raffa et al. 2011). It has recently been proposed that concomitant with telomerase loss, Drosophila rapidly evolved terminin to bind chromosome ends in a sequence-independent fashion, and that the nonterminin telomere protection factors correspond to ancestral telomere-associated proteins that did not evolve as rapidly as terminin because of the functional constraints imposed by their involvement in diverse cellular processes (Raffa et al. 2009, 2010, 2011; Gao et al. 2010).

A particularly versatile nonterminin protein is the class I E2 ubiquitin-conjugating enzyme encoded by the eff gene. Eff is extraordinarily conserved. In 12 recently sequenced Drosophila species, the Eff proteins are 100% identical (Clark et al. 2007; Raffa et al. 2011). UBC4/UBCH5B and UBC5p, the human and yeast orthologs of Eff, are 89 and 82% identical to Eff, and Eff can functionally substitute for UBC4/UBCH5B (Treier et al. 1992). In addition, expression in flies of the human UBC4/UBCH5B gene rescues the telomere fusion phenotype elicited by eff mutations (our unpublished results). Eff has been implicated in ubiquitin-mediated degradation of several Drosophila proteins, including the Drosophila Inhibitor of Apotosis Protein 1 (DIAP1) (Ryoo et al. 2002) and CyclinA (Chen et al. 2009), and has been shown to interact with chromatin components such as the Ph component of the Polycomb complex (Fauvarque et al. 2001) and the nucleosome remodeling factor ISWI (Arancio et al. 2010). In addition, recent studies have also shown that Eff is a general component of Drosophila chromatin. A genome-wide analysis of the localization of 53 proteins has recently shown that the Drosophila genome is segmented into five major chromatin types (dubbed GREEN, BLUE, BLACK, RED, and YELLOW) defined by unique combinations of proteins (Filion et al. 2010). Eff is preferentially enriched in the GREEN, BLUE, and BLACK chromatins, which are thought to have repressive properties (Filion et al. 2010).

Many studies have shown that telomeres modulate the expression of genes located in their proximity, a phenomenon known as telomere position effect (TPE). This form of transcriptional regulation is conserved from yeast to humans and has been implicated in numerous human pathologies (reviewed in Ottaviani et al. 2008). Studies in Saccharomyces cervisiae have identified >50 telomere-associated proteins involved in TPE. Most of these proteins are bound to telomeres and their deletion reduces or abrogates telomere-induced gene silencing (Mondoux and Zakian 2007; Ottaviani et al. 2008). In Drosophila, TPE was first identified as a silencing effect on white+ transgenes inserted into the telomeric regions of the chromosomes (Gehring et al. 1984; Hazelrigg et al. 1984; Levis et al. 1985; Biessmann et al. 2005b). Subsequent studies showed that these variegating white+ transgenes were inserted within or next to a cluster of subtelomeric repeats, designed as telomere associated sequences (TASs) (Karpen and Spradling 1992; Levis et al. 1993; Cryderman et al. 1999; Mason et al. 2000; Golubovsky et al. 2001).

TASs can be subdivided into two classes: the 2L and 3L TASs, which contain 40–60 tandemly arranged copies of a 458-bp sequence; the XL, 2R, and 3R TASs, which contain a 400-bp repeat derived from the Invader 4 retrotransposon intercalated with a telomere-specific repeat that differs between the XL TAS and the TASs of 2R and 3R (Mason et al. 2008; Antao et al. 2012). Although the TASs are molecularly divergent, they appear to share some gene silencing properties, as deletions of the 2L TAS suppress TPE at nonhomologous telomeres (Golubovsky et al. 2001; Mason et al. 2004). In contrast to transgenes inserted into the TAS, reporter gene insertions into the HTT array of retrotransposons are not repressed (Biessmann et al. 2005a). However, it is currently unclear whether transgenes inserted in the most distal chromosome regions coated by terminin are negatively regulated.

Superficially, TPE resembles position effect variegation (PEV) of euchromatic genes placed next to heterochromatin by chromosome rearrangements (Weiler and Wakimoto 1995). However, TPE and PEV respond differently to genetic modifiers; PEV modifiers do not generally affect TPE of transgenes inserted into the second or third chromosome subtelomeric regions, but do affect TPE at the telomeres of the fourth chromosome, which shares properties with centric heterochromatin (e.g., it binds HP1) (Wallrath and Elgin 1995; Weiler and Wakimoto 1995). In addition, several studies have shown that dominant suppressors of TPE are relatively rare compared to the plethora of PEV dominant suppressors (Mason et al. 2004; Doheny et al. 2008; Antao et al. 2012). Unambiguous identification of TPE suppressors has been a difficult task due to the widespread presence of TAS deficiencies among Drosophila stocks and the allele-specific differences among the mutations that suppress TPE (Boivin et al. 2003; Mason et al. 2004; Doheny et al. 2008).

So far, only a few bona fide TPE suppressors have been identified. They include grappa (grp), which encodes histone H3 lysine 79 methyltransferase (Mason et al. 2004; Shanower et al. 2005; Doheny et al. 2008), Su(var)3-9, which encodes a histone H3 lysine 9-specific methyltransferase (Doheny et al. 2008), the Polycomb group genes Polycomb (Pc), Posterior sex comb (Psc), Polycomblike (Pcl), polyhomeotivc (ph), and Suppressor of zeste 2 [Su(z)2], which encode chromatin remodeling proteins (Wallrath and Elgin 1995; Cryderman et al. 1999; Boivin et al. 2003; Mason et al. 2004; Doheny et al. 2008), and Su(var)3-26/Hdac1/RPD3, which encodes a histone deacetylase that also affects telomere organization and behavior in polytene nuclei (Doheny et al. 2008; Burgio et al. 2011). Other genes that might be involved in TPE modulation are Su(var)2-10, which encodes a PIAS family protein that interacts with lamin and mediates proper telomere clustering (Hari et al. 2001; Doheny et al. 2008), male sex lethal 3 (msl3), and kismet (kis), which specify chromodomain-containing proteins that are likely to interact with Hdac1/RPD3 (Doheny et al. 2008). Dominant suppressors of both TPE and PEV are even more rare; they include Su(var)3-9 and possibly Su(var)3-26/Hdac1 and Su(var)2-10 (Doheny et al. 2008).

Mutations in genes required to prevent telomeric fusions have not systematically been assayed for their effect on TPE. Here we tested mutations in 10 of these genes and found that only those in eff suppress TPE. In addition, we found that mutations in eff suppress PEV. These results prompted us to ask to investigate whether Eff associates with specific genomic sites and whether these sites are related to PEV and TPE. Immunolocalization experiments on polytene chromosomes showed that Eff localizes to several discrete euchromatic sites, the TASs, and the chromocenter. These results are consistent with studies showing that Eff is a component of the GREEN, BLUE, and BLACK repressive chromatin types (Filion et al. 2010) and they suggest that loss of Eff disrupts proper organization of the GREEN and BLUE chromatin, leading to suppression of PEV and TPE, respectively.

Materials and Methods

Drosophila stocks

The effΔ112 and effΔ73 (formerly UbcD1Δ112 and UbcD1Δ73) mutations (Cenci et al. 1997) and the other mutations causing telomere fusions (cav1, moi1, moiM12, ver1, mre11, nbs1, rad50D5.1, Su(var)20505, Su(var)20504, tefuatm3, tefuatm6, wocB111, and woc964) were described previously. Most likely, effΔ73, cav1, moi1, ver1, mre11, rad50D5.1, nbs1, tefuatm6, wocB111, and woc964 are amorph alleles, while Su(var)20505, Su(var)20504, moiM12, tefuatm3, and effΔ112 are strong hypomorphs (Cenci et al. 2003; Bi et al. 2004; Ciapponi et al. 2004; Silva et al. 2004; Raffa et al. 2005, 2009, 2010). The Δ112 and Δ73 eff alleles have been generated by imprecise excision of a P-element inserted into the eff locus; Δ73 carries a deletion that removes almost the entire eff transcription unit (Cenci et al. 1997). Δ73 and Δ112 homozygotes die during embryogenesis and late larval/pupal stages, respectively; Δ73/Δ112 heterozygotes die at late larval stages and exhibit frequent telomeric fusions (Cenci et al. 1997).

The insertion lines 39C-X (X euchromatin, region 2D), 39C-5 (2L TAS), 39-C58 (2R TAS), 39C-31 and 118E-26 (3R TAS), and 118-E15 (fourth chromosome telomeric region) were previously described (Wallrath and Elgin 1995; Cryderman et al. 1999) and kindly provided by L. Wallrath (University of Iowa, Iowa City, IA). All these lines carry a transgenic construct containing the hsp26 gene fused to the sequence of the barley SIP1 gene (designated as hsp26-pt), followed by the hsp70 promoter fused to a mini-white+ (Figure 1A). In the 39C-5 line, the hsp26-pt-hsp70-w transgene is flanked on both sides by 4–5 kb of a 0.4-kb TAS satellite sequence. In the 39C-31 and 118E-26 lines the same transgene is flanked by a 1.0-kb TAS sequence (Cryderman et al. 1999). The transgene in 39C-58 is flanked by subtelomeric repetitive elements designated as 0.8-kb TAS and 1.0-kb TAS, respectively (Wallrath and Elgin 1995). The 118-E15 insert in the fourth chromosome is surrounded by 1.1 kb of unique DNA (Cryderman et al. 1999).

Figure 1.

Figure 1

eff mutations suppress variegation of subtelomeric white+ transgenes. (A) Schematic representation of the hsp26-pt-hsp70-w+ construct (top) and the endogenous hsp26 gene (bottom). The triangles indicate the positions of the primers used for the sqRT–PCR. (B) The effΔ73 and effΔ112 mutant alleles behave as dominant suppressors of variegation of the mini-white gene carried by the hsp26-pt-hsp70-w+ construct inserted into the 2L (39C-5), 2R (39C-58), or 3R (39C-31 and 118E-26) TASs or near the fourth chromosome telomere (118E-15). (C) Mutations in eff lower the expression of the hsp26-pt-hsp70-w+ transgene. The columns represent the amounts of PCR products (mean ± SEM; n = 4) obtained using the P1 and P2 primers indicated in A, relative to the amount of the endogenous hsp26 transcript obtained with primers P1 and P3 (see A). P[eff+]064 is a transgene that carries a wild-type copy of eff. All values were normalized to the value of the 39C-X line (carrying a euchromatic insertion of hsp26-pt-hsp70-w+), which has been set at 100% expression. Asterisks indicate statistically significant differences (Student’s t-test; *P < 0.01; **P < 0.05).

The P[ro-eff+] transgenic line 064 that carries a wild-type copy of the eff gene (Wu et al. 1999) was kindly provided by J. Fischer (University of Texas, Austin, TX). This transgene, located on chromosome 2, rescued the telomere fusion phenotype elicited by the effΔ112 mutation, lowering the telomeric fusion frequency from ∼40 to ∼5% (130 cells analyzed; our unpublished results). The mre11 null allele (Bi et al. 2004) was a gift from Y. Rong [National Cancer Institute, National Institutes of Health (NIH), Bethesda]. The variegating line Tp(3;Y)BL2 (Lu et al. 1998) was provided by J. Eissenberg (Saint Louis University, St. Louis). In(1)wm4 and bwD flies have been kept in our laboratory for many years and are described in detail in FlyBase (http://flybase.bio.indiana.edu/) together with all genetic markers and balancers used here. Stocks were maintained and crosses were made on standard Drosophila medium at 25°.

Eye pigment quantification

For quantification of eye drosopterin by spectrophotometric analysis, 20 males were collected in a 15-ml centrifuge tube, frozen in liquid nitrogen, and rapidly vortexed to detach heads from thoraxes. Heads were incubated for 24 h at 25° in 1 ml of a 30% ethanol solution, pH 2. Tubes were then spun for 30 min at 3500 rpm to pellet the heads; the eye pigment-containing supernatants were then analyzed with a spectrophotometer with λ set at 480 nm. Five samples of 20 flies were analyzed for each genotype; the measures reported in Table 1 and Figure 3A are the mean values of these samples ±SEM.

Table 1. Effects on TPE of mutations in genes required for telomere capping.

OD valuesa
Insertions on Ch 2 Insertions on Ch 3 Insertions on Ch 4
Genotype yw 39C-5 yw 39C-58 yw 39C-31 yw 118E-26 yw 118E-15
+b 0.052 (±0.002) 0.086 (±0.003) 0.094 (±0.003) 0.085 (±0.006) 0.096 (±0.003
TM6Cb 0.058 (±0.002) 0.080 (±0.003) 0.101 (±0.003) 0.080 (±0.003) 0.102 (±0.004)
effΔ73 0.198 (±0.003)c 0.288 (±0.008)c 0.224 (±0.010)c 0.264 (±0.005)c 0.186 (±0.002)c
effΔ112 0.103 (±0.002)c 0.120 (±0.010)c 0.248 (±0.001)c 0.270 (±0.006)c 0.178 (±0.005)c
cav1 0.042 (±0.001) 0.100 (±0.001) 0.104 (±0.005)
tefuatm3 0.058 (±0.003) 0.062 (±0.009) 0.102 (±0.003)
tefuatm6 0.064 (±0.002) 0.086 (±0.002) 0.122 (±0.003)
moi1 0.045 (±0.003) 0.102 (±0.003) 0.082 (±0.003)
moiM12 0.048 (±0.002) 0.058 (±0.002)
ver1 0.060 (±0.002) 0.094 (±0.004)
wocB111 0.042 (±0.004) 0.080 (±0.006)
woc964 0.035 (±0.002) 0.095 (±0.005)
nbs1 0.045 (±0.003) 0.082 (±0.005)
rad50D5.1 0.061 (±0.001) 0.082 (±0.001)
mre11 0.054 (±0.006) 0.088 (±0.008)
Su(var)20505 0.055 (±0.004) 0.056 (±0.001)
Su(var)20504 0.050 (±0.003) 0.081 (±0.002)
a

All values refer to the average optical density ± SEM of five samples (containing 20 heads each) from flies heterozygous for a TF mutation-bearing chromosome (or a control chromosome) and carrying a single copy of either 39C-5, 39-C58, 39C-31, 118E-26, or 118E-15.

b

Wild-type background; eyes from F1 males obtained by crossing Oregon R females to males from the insertion lines.

c

Values significantly different from those found in +/+ and TM6C/+ control flies (Student’s t-test; P < 0.01).

Figure 3.

Figure 3

Mutations in eff suppress PEV. (A) Quantification of the eye pigment levels [mean optical density (OD) ± SEM; n = 5] for wm4; +/+, wm4; +/TM3, wm4; effΔ112/+, and wm4; effΔ73/+ males (red columns) and bwD; +/+, bwD; +/TM3, bwD; effΔ112/+, and bwD; effΔ73/+ males (green columns). Asterisks (*) indicate statistically significant differences (Student’s t-test; P < 0.01). (B and C) Expression of the Hs-lacZ transgene of Tp (3;Y)BL2 in salivary glands and brains (insets) from larvae with a wild-type genetic background (B) or carrying mutations in eff (effΔ73/effΔ112) (C).

Fluorescent in situ hybridization

Polytene chromosome preparation and fluorescent in situ hybridization (FISH) were carried out as described previously (Berghella and Dimitri 1996). A 6-kb fragment of the 2L TAS array (Kurenova et al. 1998), kindly provided by J. Mason (National Institute of Environmental Health Sciences, NIH, Triangle Park, NC) was used as probe. The slides were mounted in Vectashield medium H-1200 with 4,6 diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA) to stain DNA.

Transcription analysis by semi-quantitative RT–PCR

Five samples of 20 larvae were analyzed for each genotype. Larvae were heat-shocked for 45 min at 37° to drive the expression of both the endogenous hsp26 gene and the hsp26-pt-hsp70-w+ construct; total RNA was isolated using the RNeasy mini kit (Qiagen) following the manufacture’s instructions. A total of 100 ng of RNA per sample were converted into cDNA using the Access RT–PCR System kit (Promega). For cDNA amplification we used the same primers previously used by Cryderman et al. (1999): P1 5′-CCTTTGCTTACAAGTCAAACAAGTTC-3′, which is common to the endogenous hsp26 gene and the hsp26-pt-hsp70-w+ transgenes: P2 5′-CTCAAGATATGGAACATGAACAAGTGC-3′, which corresponds to the barley sequence: P3 5′-CTGGTGTTTACGAATGGGTCTTCACC-3, which is specific for the endogenous hsp26 gene (Figure 1A). PCR amplification was performed with an Eppendorf MasterCycler (Eppendorf) using the reaction conditions previously described (Cryderman et al. 1999). However the P1 and P2 primers worked only for the 39C-58 insertion line, but failed to amplify a hsp26-pt transcript in the 39C-5, 39C-31, and 118E-26 lines. We were not able to amplify this transcript even using the following primers (kindly suggested by D. E. Cryderman): 5′-ACAACACCGACATGCTCTACAG-3′ (forward) and 5′-CGAGGAAGAGCGTGTTGTAGG-3′ (reverse). PCR products obtained from the 39C-58 insertion line were run on a 0.7% agarose gel and transferred to a Hybond-N membrane (Amersham). Filters were probed with an hsp26 PCR product that was 32P dATP-labeled by random priming (using the DIG DNA labeling and detection kit; Roche), and then hybridized as described in Raffa et al. (2005). The blots were optically scanned and the density of signals was determined with the OpitQuant 3.10 software (Packard Instruments).

Generation of an anti-Eff antibody and Western blotting

The eff reading frame, omitting the start codon, was amplified by PCR using the 5′ primer GCATGGATCCGCGTTAAAAAGAATC and the 3′ primer GCATGAATTCTCACATAGCATAC. The amplified fragment was cloned into pGEX-2T and expressed in BL21 (pLysS) cells after induction with 2 mM IPTG. The glutathione–Eff fusion protein was extracted as described previously (Smith and Johnson 1988). The purified protein was injected into rabbits to produce the antibody, which was purified by standard methods. Western blotting was performed as previously described (Somma et al. 2002), using protein extracts from larval brains. The anti-Eff antibody was diluted 1:1000; the anti-Giotto antibody (Giansanti et al. 2006), used as a loading control, was diluted 1:4000.

Immunostaining of polytene chromosomes

To obtain polytene chromosomes for immunostaining with anti-Eff, anti-HOAP, and anti-Pc, salivary glands from third instar larvae were dissected in 0.7% NaCl, fixed for 5 min with 2% formaldehyde in 45% acetic acid, and squashed in the same fixative. Slides were frozen in liquid nitrogen and, after flipping off the coverslip, immediately immersed in cold TBS for 5 min. Slides were then washed in TBS-T (TBS containing 0.1% Tween 20) and incubated overnight with rabbit anti-Eff (diluted 1:50), goat anti-Pc (1:50; Santa Cruz Biotechnology), and mouse anti-HOAP (a gift from L. Ciapponi; diluted 1:50). For Eff and HP1 immunostaining, polytene chromosomes were fixed as previously described (Raffa et al., 2005). Slides were incubated overnight with rabbit anti-Eff (1:50) and mouse anti-HP1 (1:20). Secondary antibody incubation was carried out at room temperature for 2 hr, using FITC-conjugated donkey anti-goat or FITC-conjugated goat anti-mouse (Jackson Laboratories), and AlexaFluor 555-conjugated donkey anti-rabbit (Invitrogen). Slides were then mounted in Vectashield medium H-1200 with DAPI to stain DNA.

Microscopy

FISH and indirect immunofluorescence on polytene chromosome preparations were detected using a Zeiss Axioplan epifluorescence microscope equipped with a cooled Charge-Coupled Device (CCD) camera (CoolSnap HQ, Photometrics). Pictures of variegating eyes and lac-Z stained tissues were taken using a Leica MZ 12 dissecting microscope (Leica) equipped with a Nikon Coolpix 990 (Nikon).

Results

Mutations in eff suppress TPE

To assay whether mutations that cause telomere fusion affect TPE, we used the y w; p[w+]39C-5, y w; p[w+] 39C-58, y w; p[w+]39C-31, and y w; p[w+]118E-26 reporter strains described previously (Wallrath and Elgin 1995; Cryderman et al. 1999). These strains bear a construct containing a mini-white+ reporter gene, driven by an hsp70 promoter, embedded in the TAS satellite sequences of 2L (39C-5), 2R (39C-58), and 3R (39C-31 and 118E-26). In addition, this construct contains a molecular tag, the barley SIP1 gene, that allows measuring TPE by analysis the hsp26-SIP1 (designated as hsp26-pt) transcript levels (Figure 1A). In a white background, the p[w+] 39C-5, p[w+] 39C-58, p[w+] 39C-31, and p[w+] 118E-26 transgenes, when heterozygous with chromosomes carrying normal telomeres, result in a pale yellow or orange eye color with occasional red facets (Figure 1B).

To determine the effects of mutations in genes required to prevent telomere fusion (henceforth designated as TF genes) we crossed y w; p[w+]39C-5, y w; p[w+] 39C-58, y w; p[w+]39C-31, or y w; p[w+]118E-26 homozygous females to males bearing mutations in TF genes balanced over TM6C (effΔ112, effΔ73, cav1, moi1, moiM12, ver1, nbs1, tefuatm3, tefuatm6, wocB111, and woc964) or CyO (mre11, rad50D5.1, Su(var)20504, and Su(var)20505). y w F1 males heterozygous for either 39C-5, 39C-58, 39C-31, or 118E-26, and each of the TF mutations were examined for eye color both by visual inspection and by measuring the amount of pigment with a spectrophotometer. y w males bearing the TM6C balancer and either the 39C-5, 39C-58, 39C-31, or 118E-26 insertion were used as control. Observation of the eyes (Figure 1B) and measurements of the eye pigment (Table 1) revealed that the eff mutant alleles (Δ112 and Δ73) suppress TPE associated with 39C-5, 39C-58, 39C-31, and 118E-26, whereas none of the mutations in the other TF genes has a detectable effect on TPE.

We also tested whether mutations in eff suppress the variegated eye phenotype associated with transgenes inserted near the fourth chromosome telomere. We crossed y w females homozygous for the 118E-15 fourth chromosome insertion (Cryderman et al. 1999) to effΔ112/TM6C or effΔ73/TM6C males. y w F1 males heterozygous for both the 118E-15 insertion and each of the eff mutant alleles displayed darker eyes and higher levels of drosopterin compared to brothers bearing 118E-15 and the TM6C balancer (Figure 1B and Table 1). Thus, we conclude that mutations in eff dominantly relieve silencing of transgenes inserted near the telomeres of chromosome 4.

It has been reported that deficiencies of the 2L TAS dominantly suppress TPE (Mason et al. 2004). To ascertain whether the eff-mediated TPE suppression was not due to a deficiency of 2L TAS, we performed FISH on polytene chromosomes using a 2L TAS probe (Kurenova et al. 1998). Examination of 20 polytene nuclei from wild-type and effΔ112/effΔ73 larvae revealed no detectable differences in FISH signal at the 2L tips (Figure 2). Mason et al. (2004) also noticed that most of the 2L TAS deficiencies that suppressed TPE also remove the terminal l(2)gl gene. The effΔ112 and effΔ73 mutations complemented mutations in l(2)gl (data not shown), confirming that the effΔ112 and effΔ73 retain intact 2L terminal regions. Thus, both FISH and complementation analysis indicate TPE suppression is a consequence of lesions in the eff locus and not a deficiency of the 2L TAS.

Figure 2.

Figure 2

The subtelomeric regions of the 2L chromosome arms of eff mutants retain the TAS. Fluorescent in situ hybridization with a 2L TAS-specific probe (red) shows that wild-type (A) and eff Δ73/eff Δ112 (B) 2L polytene arms exhibit similar signals.

Mutations in eff enhance transcription of transgenes inserted in the TAS

To substantiate the finding that mutations in eff dominantly enhance the expression of genes embedded into the TAS, we used semi-quantitative RT–PCR to determine the transcription levels of the hsp26-pt transgene. We could only examine transcription of the 39C-58 and the 39C-X transgenes because we were not able to amplify the hsp26-pt transcript from the 39C-5, 39C-31, and 118E-26 lines. Amplification failed even using primers different from those originally designed by Cryderman et al. (1999) and used here to amplify the hsp26-pt transcript of the 39C-58 line. We generated larvae heterozygous for the 39C-58 insertion and either homozygous or heterozygous for each of the two eff mutant alleles. The 39C-58/+; effΔ112/+ and 39C-58/+; effΔ73/+ larvae were generated as described above; 39C-58/+; effΔ112/effΔ112 and 39C-58/+; effΔ112/effΔ73 larvae were generated by crossing 39C-58/39C-58; effΔ112/TM6C females to either effΔ112/TM6C or effΔ73/TM6C. The effΔ112/+, effΔ73/+, effΔ112/effΔ112, and effΔ112/effΔ73 larve were distinguished from their TM6C-bearing siblings because of their non-Tubby phenotype.

All larvae were heat shocked for 45 min. We also heat shocked larvae heterozygous for the euchromatic insertion 39C-X, which served as control. Forty-five minutes after the heat shock, we extracted total RNA from these larvae and performed RT–PCR using primers that allow amplification of both the endogenous hsp26 gene and the hsp26-pt transgenes (Figure 1A). The resulting RT–PCR products were then quantified after radioactive hybridization, and the amounts of hsp26-pt and hsp26 transcripts were normalized to that observed for the 39C-X stock in which the level of the hsp26-pt transcript was 2.18-fold (±0.44) higher than that of the endogenous hsp26 transcript. If the expression level of hsp26-pt in the 39C-X/+ control line is set to 100%, in larvae heterozygous for the 39C-58 insertion, the hsp26-pt expression is reduced to 28% of control (Figure 1C). However, in 39C-58/+; effΔ112/+ and 39C-58/+; effΔ73/+ larvae, the hsp26-pt expression level was partially restored to 56 and 58% of the control level, respectively. Importantly, the presence of a wild-type eff transgene (indicated as 064) (Wu et al. 1999) in larvae heterozygous for both the 39C-58 insertion and effΔ112 (39C58/+; 064/effΔ112) brought back the expression of hsp26-pt to approximately the same level of 39C58/+ flies (36 vs. 28%, Figure 1C). Thus, our results collectively indicate that mutations in eff act as dominant suppressors of TPE.

The effΔ73 mutant allele carries a large deletion of the eff locus, which leads to embryonic lethality when homozygous. However, both effΔ112 homozygotes and effΔ112/effΔ73 heterozygotes survive till the larval–pupal transition (Cenci et al. 1997). This enabled us to measure hsp26-pt transcription in 39C-58/+; effΔ112/effΔ112 and 39C-58/+; effΔ112/effΔ73 mutant larvae, which showed 74 and 103% of hsp26-pt transcription relative to the control level, respectively (Figure 1C). These results indicate the degree of TAS-induced gene silencing is inversely related to the amount of Eff in the chromatin (see below).

Mutations in eff suppress PEV

The finding that eff mutations suppress variegation of transgenes inserted near the fourth chromosome telomere prompted us to ask whether these mutations also suppress gene silencing associated with pericentric heterochromatin (PEV). To assay whether eff mutations modify PEV, we used the In(1)whitem4 (wm4), brownD (bwD), and Tp(3;Y)BL2 variegating strains. In wm4, the w+ gene, juxtaposed to the X heterochromatin by an inversion, is clonally inactivated, leading to a variegated pattern of eye pigmentation in hemizygous males and homozygous females (Weiler and Wakimoto 1995). The bwD chromosome carries a transposition that places a megabase of 2L heterochromatin next to the brown gene in region 59E, giving rise to dominant silencing of bw in bwD/bw+ heterozygotes, which exhibit variegated eyes with pigmented ommatidia scattered in a very pale eye (Henikoff et al. 1995). Tp(3;Y)BL2 carries an inducible Hs-lacZ transgene that can be used to detect PEV modifications in larval tissues upon staining for β-galactosidase activity (Lu et al. 1998).

To analyze PEV in the eye, we crossed wm4/wm4 and bwD/bwD females to effΔ112/TM3 or effΔ73/TM3 males. We used the TM3 to balance the eff mutations because previous studies showed that this balancer does not affect PEV (Weiler 2007; Zhu et al. 2008). We then compared wm4/Y; eff/+ and bwD/+; eff/+ F1 males with their wm4/Y; TM3/+ and bwD/+; TM3/+ siblings for the eye pigment. This analysis revealed that males heterozygous for eff mutations and either hemizygous for wm4 or heterozygous bwD exhibit a significant increase in eye pigment with respect to their brothers bearing the TM3 balancer instead of the eff mutation (Figure 3A). We also compared Tp(3;Y)BL2; +/+ and Tp(3;Y)BL2; effΔ112/effΔ73 males for Lac-Z expression in salivary glands and larval brains (Figure 3). β-Gal staining revealed that homozygosity for eff mutations (effΔ112/effΔ73) strongly enhances Lac-Z expression. We note that the observed effects of eff mutations on wm4, bwD, or Tp(3;Y)BL2 variegation cannot be the consequence of Y chromosome hyperploidy, as both during this study and our past studies (Cenci et al. 1997) we never observed eff mutant brains with two Y chromosomes. We thus conclude that eff represses the expression of both genes relocated next to heterochromatin and transgenes embedded into subtelomeric TASs. In addition, in both cases the degree of repression appears to be directly related to the amount of Eff associated with the chromatin.

Localization of Eff on polytene chromosomes

To localize the Eff protein along the polytene chromosomes, we generated a polyclonal antibody against the entire Eff polypeptide; this antibody recognized a band of the expected molecular weight (∼19 kDa) in Western blots from larval brain extracts (Figure 4A). This band was strongly reduced in larval brain extracts from both effΔ112/effΔ112 and effΔ112/effΔ73 mutants, demonstrating the specificity of the antibody and confirming that effΔ112 is a hypomorphic mutant allele (Cenci et al. 1997) (Figure 4A). Immunostaining of polytene chromosomes revealed that Eff localizes to many euchromatic regions along all chromosome arms (Figure 4B); polytene chromosomes from effΔ112/effΔ73 mutants were not stained, consistent with Western blotting results (data not shown). Most Eff signals on polytene chromosomes did not coincide with brightly fluorescent DAPI bands. About 60% of the Eff signals corresponded to interbands that are not stained by DAPI, while the remaining 40% appeared to coincide with thin bands that were weakly stained by DAPI (Figure 4, B′–D). In addition, we observed a diffuse Eff staining of the chromocenter (Figure 4, B and B′).

Figure 4.

Figure 4

Eff localizes in many bands and interbands of wild-type polytene chromosomes. (A) Western blots of protein extracts from wild-type and eff mutant larvae demonstrate the specificity of the antibody. Anti-Giotto (Giansanti et al. 2006) was used as loading control. (B and B′) Localization of Eff in polytene chromosomes. (C and D) Close-ups of the insets indicated in B′. Note that Eff localizes mainly to interbands and weakly stained DAPI bands.

To obtain additional insight into the Eff localization pattern we co-immunostained polytene chromosomes for Eff and either HP1 or Polycomb (Pc), a component of the repressive PRC1 complex (Saurin et al. 2001). Examination of 10 Eff/HP1- and 10 Eff/Pc-stained polytene nuclei revealed that Eff is enriched in ∼110 clear-cut polytene bands. A total of 15% of these bands colocalized with Pc signals and 28% with HP1 signals (Figure 5). These findings indicate that Eff is highly enriched in both HP1- and Pc-containing chromatin domains and demonstrate that Eff localization is not restricted to a specific chromatin type.

Figure 5.

Figure 5

Eff colocalizes with both Pc- and HP1-enriched bands. (A and B) Immunostaining of wild-type polytene chromosomes for Pc (red) and Eff (green) (A) or for HP1 (red) and Eff (green) (B). Eff precisely colocalizes with 15% of the Pc and 28% of the HP1 bands; some of the Eff/Pc and Eff/HP1 bands are indicated by arrows.

Double immunostaining for Eff and HOAP revealed that Eff exhibits telomeric signals that partially overlap HOAP signals (Cenci et al. 2003) (supporting information, Figure S1). The apparent colocalization of Eff and HOAP at the telomere regions prompted us to ask whether Eff binds the very end of the chromosomes like the telomere-capping HOAP protein. To address this question, we immunostained for Eff the polytene chromosomes from flies bearing the Telomere elongation (Tel) dominant mutation. These flies exhibit a strong increase in the copy number of the HTT elements, which form homogeneously stained regions at the end of the chromosomes (Siriaco et al. 2002). Telomere-capping proteins such as HP1 and HOAP associate with the distal ends of these regions (Andreyeva et al. 2005) (Figure 6). Thus, in the polytene chromosomes of Tel mutant, the TAS are separated from the telomere by a long HTT array, allowing the TAS and the telomere cap to be spatially resolved (Andreyeva et al. 2005) (see also Figure 6). We found that the HOAP signals at the end of all chromosomes are distinct from the most distal Eff bands. Thus, Eff is not detectably enriched at the telomere but accumulates in subtelomeric bands that, based on the DAPI staining pattern, are likely to correspond to the TAS repeats (Figure 6).

Figure 6.

Figure 6

Eff does not colocalize with the telomeric HOAP signal on XL. XL polytene from wild type (wt, left) and Tel mutants (right) were stained for DNA (with DAPI), HOAP, and Eff. The top panels show XL chromosome tips stained for DAPI and HOAP (red); the bottom panels show Eff staining in black and white of the same chromosome tips. Note that in the wild-type X chromosome, the most distal Eff signal is apparently coincident with the HOAP signal. However, in the X chromosome from the Tel-bearing Gaiano strain, the Eff and HOAP signals are separated by the long HTT array (see schemes in the middle panels) that characterizes the Gaiano chromosomes.

To determine whether the subtelomeric Eff bands correspond to the TASs, we immunostained for Eff and Pc the polytene chromosomes of larvae from the Tel-bearing Gaiano 3 strain (Figure 7). Previous studies have shown that the TASs are enriched in Pc (Boivin et al. 2003; Andreyeva et al. 2005). Specifically, it has been shown that in polytene chromosomes from Tel mutants the most distal Pc bands correspond to the XL, 2L, 3L, and 3R TASs; in 2R, the most distal Pc band is distinct from and proximal to the TAS (Andreyeva et al. 2005). Our analyses of Eff and Pc doubly stained chromosomes revealed that in all chromosome arms but 2R, the most distal Pc band corresponds to an Eff band (Figure 7). These results indicate that the XL, 2L, 3L, and 3R TAS regions are enriched in Eff. The most distal Eff band in 2R is not enriched in Pc. However, based on previous Pc and TAS mapping studies (Andreyeva et al. 2005) it is likely to correspond to the TAS.

Figure 7.

Figure 7

The TAS regions are enriched in Eff. Immunostaining of Gaiano polytene chromosomes for both Eff (green) and Pc (red) shows that the most distal Pc bands of XL and 2L (that correspond to the TAS; see text) coincide with Eff bands. At the ends of the 2R arms, there is an Eff band just distal to the terminal Pc band. Previous studies have shown that the 2R TASs are also localized just distally to the terminal Pc band (see text). Thus, the 2R TAS regions are likely to be enriched in Eff.

Discussion

We have tested mutations in 10 genes required to prevent telomere fusion for dominant effect on TPE. We found that mutations in eff suppress TPE. In contrast, mutations in cav, moi, ver, woc, Su(var)205, mre11, rad50, nbs, and tefu/atm did not display dominant effects on TPE. These results agree with most but not all previous studies on Drosophila TPE. Several studies have shown that mutations in the HP1-encoding Su(var)205 gene do not affect TPE (Cryderman et al. 1999; Doheny et al. 2008). A deficiency screen for dominant suppressor of TPE revealed that deficiencies that uncover cav, moi, ver, woc, Su(var)205, or mre11 do not relieve silencing of telomeric transgenes, while deficiencies that remove rad50 or nbs behave as strong and weak TPE suppressors, respectively (Mason et al. 2004). This deficiency screen did not provide information on eff and tefu/atm, as deficiencies uncovering these genes were not tested (Mason et al. 2004). However, in contrast to our results, previous studies showed the the tefu1 mutant allele acts as dominant suppressors of TPE (Oikemus et al. 2004) and that the effmer4 allele does not affect TPE (Doheny et al. 2008). Given that in our analyses we used different tefu and eff mutant alleles (effΔ112, effΔ73, tefuatm6, and tefuatm3), these discrepancies are not surprising as previous studies documented many allele-specific differences among the mutations that suppress TPE. For example, studies on Su(var)3-9, Psc1, and Su(z)2 revealed that not all mutant alleles at each locus suppress TPE (Boivin et al. 2003; Doheny et al. 2008).

We believe that our results unambiguously demonstrate that mutations in eff relieve silencing of transgenes inserted into the TASs. We have shown that the strong effΔ112 and effΔ73 mutant alleles suppress the eye variegated phenotype of the 39C-5 and the 39-C58 insertion lines that contain mini-white+ transgenes embedded into the 2L and 2R TASs, respectively. The same eff mutations also suppress TPE associated with the 39C-31 and 118E-26 lines that carry mini-white+ transgenes inserted into the 3R TAS. We have also shown that effΔ112 and effΔ73 enhance transcription of the barley tag of the 39C-58 transgene. Importantly, this enhancement of transcription was suppressed by a wild-type eff transgene. It is thus clear that eff has the ability to modulate the expression of genes inserted into the TAS. The finding that none of the other TF genes tested here (cav, moi, ver, woc, Su(var)205, mre11, rad50, nbs, and tefu/atm) affects TPE is intriguing but not surprising. The simplest interpretation of this finding is that TPE is induced by the TAS sequences, which are physically separated from the telomere-capping complex. We believe that Eff suppresses TPE because in addition to protecting telomere from fusion events it is also enriched at the TASs.

We have also shown that mutations in eff dominantly suppress the eye variegated phenotype of mini-white+ transgenes inserted near the fourth chromosome telomeres, and white+ genes placed next to the X chromosome heterochromatin. In addition, effΔ112 and effΔ73 suppress the brown dominant variegated phenotype and relieve silencing of the Hs-lacZ transgene in larval tissues. We thus conclude that eff is one of the rare genes that can modulate both TPE and PEV.

It has recently been shown that the Drosophila genome is segmented into five major chromatin types (GREEN, BLUE, BLACK, RED, and YELLOW) defined by unique combinations of proteins (Filion et al. 2010). These chromatin types are organized in large domains that extend over genomic regions >100 kb. Eff is present in all chromatin types but preferentially binds the GREEN, BLUE, and BLACK chromatins. The GREEN chromatin, which is enriched in HP1 and the Su(var)3-9 histone methyltransferase but not in PcG proteins, is thought to correspond to classic heterochromatin. The BLUE chromatin does not contain HP1 or Su(var)3-9 but binds PcG proteins such as Pc, E(z), Pcl, and Sce. The BLACK chromatin covers 48% of the genome, is relatively gene poor, and is marked by histone H1, the D1 protein, the IAL kinase, SUUR, and lamin (Lam). The YELLOW and RED chromatins bind similar proteins, most of which are absent or underrepresented in the GREEN, BLUE, or BLACK chromatin types. BLUE and BLACK chromatins are transcriptionally inactive compared to the other chromatin types, and silencing of mini-white+ transgenes inserted in BLACK chromatin is more pronounced than BLUE or GREEN chromatin (Filion et al. 2010).

Our finding on the Eff distribution along polytene chromosomes are consistent with the hypothesis that chromatin is segmented into discrete domains that contain unique combinations of proteins (Filion et al. 2010). However, inferences on the types of chromatin contained in the Eff stained bands and interbands should be made with great caution. Subdivision of chromatin in multicolor domains was achieved by analyzing Kc167 tissue culture cells and does not apply to all tissues of developing flies. For example a survey of gene expression profiling indicated that some of the genes in BLACK chromatin of Kc167 cells can became active during Drosophila development (Chintapalli et al. 2007; Filion et al. 2010). With this in mind, we would like to suggest that the chromatin associated with the TAS is BLUE chromatin, as it contains PcG proteins and Eff, but it is not enriched in HP1 and SUUR (Boivin et al. 2003; Andreyeva et al. 2005; this report). We do not know the “color” of the chromatin associated with the Eff bands that do not contain Pc proteins. Most of these bands should contain BLACK chromatin but some might contain GREEN or even YELLOW or RED chromatin. Definition of the nature of these bands will require detailed analyses by double immunostaining for Eff and specific markers of the different chromatin color types.

Our finding that mutations in eff are dominant suppressors of both TPE and PEV are consistent with both molecular and cytological data on Eff distribution in chromatin domains. Eff is enriched in the chromocenter of the polytene chromosome that includes the fourth chromosome chromatin and pericentric heterochromatin, which are thought to correspond to GREEN chromatin (Filion et al. 2010). In addition, Eff is enriched in the TAS chromatin and in other Pc-containing bands; the TAS and these bands are likely to correspond to BLUE chromatin. Thus, one can easily envisage that loss or reduction of Eff would result in alterations of both heterochromatin/GREEN chromatin and TAS-associated BLUE chromatin, impairing the repressive properties of both chromatin types. However, the nature of the alterations caused by Eff depletion is currently unknown. Given that Eff is an E2 ubiquitin-conjugating enzyme (see Introduction), some of the Eff targets might not be properly mono- or polyubiquitinated, leading to defects in chromatin structure. Alternatively, Eff may be a structural component of the chromatin and serve an ubiquitination-independent function. It is even possible that Eff plays different roles in different chromatin types. Thus, an understanding of the molecular mechanisms through which Eff mediates TPE and PEV will require extensive studies aimed at defining the Eff interacting proteins and their possible post-translational modifications.

Even if Eff is required to prevent telomere fusion, surprisingly we did not observe any Eff accumulation at the telomere cap. This finding is subject to two alternative explanations. The most likely one is that Eff is present at the telomere caps in amounts that are not detected by ordinary immnofluorescence. Alternatively, the telomeric Eff target may be ubiquitinated in the cytoplasm or in the nucleus and then recruited to the telomeres. We have recently found that Eff physically interacts with HOAP (our unpublished results). However, this result does not discriminate between the above alternatives, as the biochemical Eff–HOAP interaction may occurs either at the telomeres or in the cytoplasm. Whatever the alternative, the Eff targets at the telomere cap might be different from those contained in the TAS-associated chromatin.

Supplementary Material

Supporting Information

Acknowledgments

We thank L. Wallrath, J. Fischer, Y. Rong, J. Eissenberg, J. Mason, L. Ciapponi, and M. Giansanti for strains and reagents. This work was supported in part by grants from the Italian Association for Cancer Research to G.C. (IG12749) and M.G. (IG10793).

Footnotes

Communicating editor: C.-ting Wu

Literature Cited

  1. Andreyeva E. N., Belyaeva E. S., Semeshin V. F., Pokholkova G. V., Zhimulev I. F., 2005.  Three distinct chromatin domains in telomere ends of polytene chromosomes in Drosophila melanogaster Tel mutants. J. Cell Sci. 118: 5465–5477. [DOI] [PubMed] [Google Scholar]
  2. Antao J. M., Mason J. M., Dejardin J., Kingston R. E., 2012.  Protein landscape at Drosophila melanogaster telomere-associated sequence repeats. Mol. Cell. Biol. 32: 2170–2182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arancio W., Onorati M. C., Burgio G., Collesano M., Ingrassia A. M., et al. , 2010.  The nucleosome remodeling factor ISWI functionally interacts with an evolutionarily conserved network of cellular factors. Genetics 185: 129–140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berghella L., Dimitri P., 1996.  The heterochromatic rolled gene of Drosophila melanogaster is extensively polytenized and transcriptionally active in the salivary gland chromocenter. Genetics 144: 117–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bi X., Wei S. C., Rong Y. S., 2004.  Telomere protection without a telomerase; the role of ATM and Mre11 in Drosophila telomere maintenance. Curr. Biol. 14: 1348–1353. [DOI] [PubMed] [Google Scholar]
  6. Bi X., Srikanta D., Fanti L., Pimpinelli S., Badugu R., et al. , 2005.  Drosophila ATM and ATR checkpoint kinases control partially redundant pathways for telomere maintenance. Proc. Natl. Acad. Sci. USA 102: 15167–15172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Biessmann H., Prasad S., Semeshin V. F., Andreyeva E. N., Nguyen Q., et al. , 2005a Two Distinct Domains in Drosophila melanogaster Telomeres. Genetics 171: 1767–1777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Biessmann H., Prasad S., Walter M. F., Mason J. M., 2005b Euchromatic and heterochromatic domains at Drosophila telomeres. Biochem. Cell Biol. 83: 477–485. [DOI] [PubMed] [Google Scholar]
  9. Blackburn E. H., Greider C. W., Szostak J. W., 2006.  Telomeres and telomerase: the path from maize, Tetrahymena and yeast to human cancer and aging. Nat. Med. 12: 1133–1138. [DOI] [PubMed] [Google Scholar]
  10. Boivin A., Gally C., Netter S., Anxolabehere D., Ronsseray S., 2003.  Telomeric associated sequences of Drosophila recruit polycomb-group proteins in vivo and can induce pairing-sensitive repression. Genetics 164: 195–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Burgio G., Cipressa F., Ingrassia A. M., Cenci G., Corona D. F., 2011.  The histone deacetylase Rpd3 regulates the heterochromatin structure of Drosophila telomeres. J. Cell Sci. 124: 2041–2048. [DOI] [PubMed] [Google Scholar]
  12. Cenci G., Rawson R. B., Belloni G., Castrillon D. H., Tudor M., et al. , 1997.  UbcD1, a Drosophila ubiquitin-conjugating enzyme required for proper telomere behavior. Genes Dev. 11: 863–875. [DOI] [PubMed] [Google Scholar]
  13. Cenci G., Siriaco G., Raffa G. D., Kellum R., Gatti M., 2003.  The Drosophila HOAP protein is required for telomere capping. Nat. Cell Biol. 5: 82–84. [DOI] [PubMed] [Google Scholar]
  14. Cenci G., Ciapponi L., Gatti M., 2005.  The mechanism of telomere protection: a comparison between Drosophila and humans. Chromosoma 114: 135–145. [DOI] [PubMed] [Google Scholar]
  15. Chen D., Wang Q., Huang H., Xia L., Jiang X., et al. , 2009.  Effete-mediated degradation of Cyclin A is essential for the maintenance of germline stem cells in Drosophila. Development 136: 4133–4142. [DOI] [PubMed] [Google Scholar]
  16. Chintapalli V. R., Wang J., Dow J. A., 2007.  Using FlyAtlas to identify better Drosophila melanogaster models of human disease. Nat. Genet. 39: 715–720. [DOI] [PubMed] [Google Scholar]
  17. Ciapponi L., Cenci G., Ducau J., Flores C., Johnson-Schlitz D., et al. , 2004.  The Drosophila Mre11/Rad50 complex is required to prevent both telomeric fusion and chromosome breakage. Curr. Biol. 14: 1360–1366. [DOI] [PubMed] [Google Scholar]
  18. Ciapponi L., Cenci G., Gatti M., 2006.  The Drosophila Nbs protein functions in multiple pathways for the maintenance of genome stability. Genetics 173: 1447–1454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Clark A. G., Eisen M. B., Smith D. R., Bergman C. M., Oliver B., et al. , 2007.  Evolution of genes and genomes on the Drosophila phylogeny. Nature 450: 203–218. [DOI] [PubMed] [Google Scholar]
  20. Cryderman D. E., Morris E. J., Biessmann H., Elgin S. C., Wallrath L. L., 1999.  Silencing at Drosophila telomeres: nuclear organization and chromatin structure play critical roles. EMBO J. 18: 3724–3735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Doheny J. G., Mottus R., Grigliatti T. A., 2008.  Telomeric position effect–a third silencing mechanism in eukaryotes. PLoS ONE 3: e3864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fanti L., Giovinazzo G., Berloco M., Pimpinelli S., 1998.  The heterochromatin protein 1 prevents telomere fusions in Drosophila. Mol. Cell 2: 527–538. [DOI] [PubMed] [Google Scholar]
  23. Fauvarque M. O., Laurenti P., Boivin A., Bloyer S., Griffin-Shea R., et al. , 2001.  Dominant modifiers of the polyhomeotic extra-sex-combs phenotype induced by marked P element insertional mutagenesis in Drosophila. Genet. Res. 78: 137–148. [DOI] [PubMed] [Google Scholar]
  24. Filion G. J., van Bemmel J. G., Braunschweig U., Talhout W., Kind J., et al. , 2010.  Systematic protein location mapping reveals five principal chromatin types in Drosophila cells. Cell 143: 212–224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gao G., Walser J. C., Beaucher M. L., Morciano P., Wesolowska N., et al. , 2010.  HipHop interacts with HOAP and HP1 to protect Drosophila telomeres in a sequence-independent manner. EMBO J. 29: 819–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Gehring W. J., Klemenz R., Weber U., Kloter U., 1984.  Functional analysis of the white gene of Drosophila by P-factor-mediated transformation. EMBO J. 3: 2077–2085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Giansanti M. G., Bonaccorsi S., Kurek R., Farkas R. M., Dimitri P., et al. , 2006.  The class I PITP giotto is required for Drosophila cytokinesis. Curr. Biol. 16: 195–201. [DOI] [PubMed] [Google Scholar]
  28. Golubovsky M. D., Konev A. Y., Walter M. F., Biessmann H., Mason J. M., 2001.  Terminal retrotransposons activate a subtelomeric white transgene at the 2L telomere in Drosophila. Genetics 158: 1111–1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hari K. L., Cook K. R., Karpen G. H., 2001.  The Drosophila Su(var)2–10 locus regulates chromosome structure and function and encodes a member of the PIAS protein family. Genes Dev. 15: 1334–1348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hazelrigg T., Levis R., Rubin G. M., 1984.  Transformation of white locus DNA in drosophila: dosage compensation, zeste interaction, and position effects. Cell 36: 469–481. [DOI] [PubMed] [Google Scholar]
  31. Henikoff S., Jackson J. M., Talbert P. B., 1995.  Distance and pairing effects on the brownDominant heterochromatic element in Drosophila. Genetics 140: 1007–1017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jain D., Cooper J. P., 2010.  Telomeric strategies: means to an end. Annu. Rev. Genet. 44: 243–269. [DOI] [PubMed] [Google Scholar]
  33. Karpen G. H., Spradling A. C., 1992.  Analysis of subtelomeric heterochromatin in the Drosophila minichromosome Dp1187 by single P element insertional mutagenesis. Genetics 132: 737–753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kurenova E., Champion L., Biessmann H., Mason J. M., 1998.  Directional gene silencing induced by a complex subtelomeric satellite from Drosophila. Chromosoma 107: 311–320. [DOI] [PubMed] [Google Scholar]
  35. Levis R., Hazelrigg T., Rubin G. M., 1985.  Effects of genomic position on the expression of transduced copies of the white gene of Drosophila. Science 229: 558–561. [DOI] [PubMed] [Google Scholar]
  36. Levis R. W., Ganesan R., Houtchens K., Tolar L. A., Sheen F. M., 1993.  Transposons in place of telomeric repeats at a Drosophila telomere. Cell 75: 1083–1093. [DOI] [PubMed] [Google Scholar]
  37. Lu B. Y., Ma J., Eissenberg J. C., 1998.  Developmental regulation of heterochromatin-mediated gene silencing in Drosophila. Development 125: 2223–2234. [DOI] [PubMed] [Google Scholar]
  38. Mason J. M., Haoudi A., Konev A. Y., Kurenova E., Walter M. F., et al. , 2000.  Control of telomere elongation and telomeric silencing in Drosophila melanogaster. Genetica 109: 61–70. [DOI] [PubMed] [Google Scholar]
  39. Mason J. M., Ransom J., Konev A. Y., 2004.  A deficiency screen for dominant suppressors of telomeric silencing in Drosophila. Genetics 168: 1353–1370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mason J. M., Frydrychova R. C., Biessmann H., 2008.  Drosophila telomeres: an exception providing new insights. Bioessays 30: 25–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mondoux M. A., Zakian V. A., 2007.  Subtelomeric elements influence but do not determine silencing levels at Saccharomyces cerevisiae telomeres. Genetics 177: 2541–2546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Oikemus S. R., McGinnis N., Queiroz-Machado J., Tukachinsky H., Takada S., et al. , 2004.  Drosophila atm/telomere fusion is required for telomeric localization of HP1 and telomere position effect. Genes Dev. 18: 1850–1861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Oikemus S. R., Queiroz-Machado J., Lai K., McGinnis N., Sunkel C., et al. , 2006.  Epigenetic telomere protection by Drosophila DNA damage response pathways. PLoS Genet. 2: e71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ottaviani A., Gilson E., Magdinier F., 2008.  Telomeric position effect: from the yeast paradigm to human pathologies? Biochimie 90: 93–107. [DOI] [PubMed] [Google Scholar]
  45. Palm W., de Lange T., 2008.  How shelterin protects mammalian telomeres. Annu. Rev. Genet. 42: 301–334. [DOI] [PubMed] [Google Scholar]
  46. Pardue M. L., DeBaryshe P. G., 2011.  Retrotransposons that maintain chromosome ends. Proc. Natl. Acad. Sci. USA 108: 20317–20324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Raffa G. D., Cenci G., Siriaco G., Goldberg M. L., Gatti M., 2005.  The putative Drosophila transcription factor woc is required to prevent telomeric fusions. Mol. Cell 20: 821–831. [DOI] [PubMed] [Google Scholar]
  48. Raffa G. D., Siriaco G., Cugusi S., Ciapponi L., Cenci G., et al. , 2009.  The Drosophila modigliani (moi) gene encodes a HOAP-interacting protein required for telomere protection. Proc. Natl. Acad. Sci. USA 106: 2271–2276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Raffa G. D., Raimondo D., Sorino C., Cugusi S., Cenci G., et al. , 2010.  Verrocchio, a Drosophila OB fold-containing protein, is a component of the terminin telomere-capping complex. Genes Dev. 24: 1596–1601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Raffa G. D., Ciapponi L., Cenci G., Gatti M., 2011.  Terminin: a protein complex that mediates epigenetic maintenance of Drosophila telomeres. Nucleus 2: 383–391. [DOI] [PubMed] [Google Scholar]
  51. Rong Y. S., 2008.  Telomere capping in Drosophila: dealing with chromosome ends that most resemble DNA breaks. Chromosoma 117: 235–242. [DOI] [PubMed] [Google Scholar]
  52. Ryoo H. D., Bergmann A., Gonen H., Ciechanover A., Steller H., 2002.  Regulation of Drosophila IAP1 degradation and apoptosis by reaper and ubcD1. Nat. Cell Biol. 4: 432–438. [DOI] [PubMed] [Google Scholar]
  53. Saurin A. J., Shao Z., Erdjument-Bromage H., Tempst P., Kingston R. E., 2001.  A Drosophila Polycomb group complex includes Zeste and dTAFII proteins. Nature 412: 655–660. [DOI] [PubMed] [Google Scholar]
  54. Shanower G. A., Muller M., Blanton J. L., Honti V., Gyurkovics H., et al. , 2005.  Characterization of the grappa gene, the Drosophila histone H3 lysine 79 methyltransferase. Genetics 169: 173–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Silva E., Tiong S., Pedersen M., Homola E. M., Royou A., et al. , 2004.  ATM is required for telomere maintenance and chromosome stability during Drosophila development. Curr. Biol. 14: 1341–1347. [DOI] [PubMed] [Google Scholar]
  56. Siriaco G. M., Cenci G., Haoudi A., Champion L. E., Zhou C., et al. , 2002.  Telomere elongation (Tel), a new mutation in Drosophila melanogaster that produces long telomeres. Genetics 160: 235–245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Smith D. B., Johnson K. S., 1988.  Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 31–40. [DOI] [PubMed] [Google Scholar]
  58. Somma M. P., Fasulo B., Cenci G., Cundari E., Gatti M., 2002.  Molecular dissection of cytokinesis by RNA interference in Drosophila cultured cells. Mol. Biol. Cell 13: 2448–2460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Song Y. H., Mirey G., Betson M., Haber D. A., Settleman J., 2004.  The Drosophila ATM ortholog, dATM, mediates the response to ionizing radiation and to spontaneous DNA damage during development. Curr. Biol. 14: 1354–1359. [DOI] [PubMed] [Google Scholar]
  60. Treier M., Seufert W., Jentsch S., 1992.  Drosophila UbcD1 encodes a highly conserved ubiquitin-conjugating enzyme involved in selective protein degradation. EMBO J. 11: 367–372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wallrath L. L., Elgin S. C., 1995.  Position effect variegation in Drosophila is associated with an altered chromatin structure. Genes Dev. 9: 1263–1277. [DOI] [PubMed] [Google Scholar]
  62. Weiler K. S., 2007.  E(var)3–9 of Drosophila melanogaster encodes a zinc finger protein. Genetics 177: 167–178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Weiler K. S., Wakimoto B. T., 1995.  Heterochromatin and gene expression in Drosophila. Annu. Rev. Genet. 29: 577–605. [DOI] [PubMed] [Google Scholar]
  64. Wu Z., Li Q., Fortini M. E., Fischer J. A., 1999.  Genetic analysis of the role of the drosophila fat facets gene in the ubiquitin pathway. Dev. Genet. 25: 312–320. [DOI] [PubMed] [Google Scholar]
  65. Zhu C. C., Bornemann D. J., Zhitomirsky D., Miller E. L., O’Connor M. B., et al. , 2008.  Drosophila histone deacetylase-3 controls imaginal disc size through suppression of apoptosis. PLoS Genet. 4: e1000009. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Genetics are provided here courtesy of Oxford University Press

RESOURCES