Central endogenous angiotensin-(1–7) protects against aldosterone/NaCl-induced hypertension in female rats

Abstract

In comparison to male rodents, females are protected against angiotensin (ANG) II- and aldosterone (Aldo)-induced hypertension. However, the mechanisms underlying this protective effect are not well understood. ANG-(1–7) is formed from ANG II by angiotensin-converting enzyme 2 (ACE2) and has an antihypertensive effect in the central nervous system (CNS). The present study tested the hypothesis that central ANG-(1–7) plays an important protective role in attenuating the development of Aldo/NaCl-hypertension in female rats. Systemic infusion of Aldo into intact female rats with 1% NaCl as their sole drinking fluid resulted in a slight increase in blood pressure (BP). Intracerebroventricular (icv) infusion of A-779, an ANG-(1–7) receptor (Mas-R) antagonist, significantly augmented the pressor effects of Aldo/NaCl. In contrast, systemic Aldo/NaCl induced a significant increase in BP in ovariectomized (OVX) female rats, and central infusion of ANG-(1–7) significantly attenuated this Aldo/NaCl pressor effect. The inhibitory effect of ANG-(1–7) on the Aldo/NaCl pressor effect was abolished by concurrent infusion of A-779. RT-PCR analyses showed that there was a corresponding change in mRNA expression of several renin-angiotensin system components, estrogen receptors and an NADPH oxidase subunit in the lamina terminalis. Taken together these results suggest that female sex hormones regulate an antihypertensive axis of the brain renin-angiotensin system involving ACE2/ANG-(1–7)/Mas-R that plays an important counterregulatory role in protecting against the development of Aldo/NaCl-induced hypertension.

sex differences in the development of hypertension and cardiovascular diseases have been well described in humans and in animal models (14, 15, 28). Female sex hormones have been demonstrated to have beneficial effects on cardiovascular function through actions not only on the heart and vasculature, but also on the central nervous system (CNS) (21). Previously, we have shown a role of the CNS in estrogen protection against the hypertensive effects of angiotensin (ANG) II or aldosterone (Aldo) (25, 29). In these studies, central infusion of estrogen attenuated ANG II- or Aldo-induced hypertension in both males and ovariectomized (OVX) females, while central blockade of estrogen receptors (ERs) by nonselective antagonist augmented ANG II or Aldo pressor effects in intact females. However, the mechanisms underlying these central protective effects of estrogen are not well understood.

The renin-angiotensin system (RAS) is regarded as playing a critical role in the regulation of blood pressure (BP) and body fluid homeostasis. It is well established that angiotensinogen (AGT) is hydrolyzed by renin to produce ANG I and that angiotensin-converting enzyme (ACE1) generates ANG II, which acts on ANG type 1 and type 2 receptors (AT1-R, AT2-R). AT1-R mediates the majority of ANG II physiological and pathophysiological effects, but ANG II binding to the AT2-R appears to counteract many AT1R-mediated effects (5). ACE2, a homolog of ACE, is a recently identified component of the RAS, which cleaves ANG II to the vasodilatory peptide ANG-(1–7). ANG-(1–7) binds the Mas receptor to exert effects opposite to those produced by ANG II (24). Therefore, within the RAS, ACE1/ANG II/AT1-R can be considered as a hypertensive axis while ACE2/ANG-(1–7)/Mas-R can be viewed as an antihypertensive axis.

Recent studies demonstrated that in male mice, brain overexpression of ACE2 to increase ANG-(1–7) level prevented the development of hypertension induced by peripheral ANG II infusion (2). Central infusion of ANG-(1–7) reduced BP and improved baroreflex control of heart rate (HR) in the deoxycorticosterone acetate (DOCA)-salt hypertensive male rats (6). These results highlight the importance of this peptide in BP regulation by the CNS. Recent studies have also shown that the expression and activation of the ACE2/ANG-(1–7)/Mas-R axis differs between the sexes. Sullivan et al. (22) reported that the level of renal cortical ANG-(1–7) was significantly higher in female compared with male spontaneously hypertensive rats (SHRs) before and after exogenous ANG II infusion, and that female SHRs exhibited a lower level of hypertension in response to ANG II infusion than males, which was reversed by administration of an ANG-(1–7) receptor antagonist. Similarly, Gupte and colleagues (7) demonstrated that ACE2 in adipose tissue, regulated by female sex hormones, contributed to sex differences in the development of obesity-related hypertension in mice. However, whether estrogen regulation of brain ACE2/ANG-(1–7) is involved in the protective response of this female steroid in the development of hypertension has not been studied.

It is established that ANG II plays a key role in controlling Aldo release and that Aldo is an independent risk factor for cardiovascular disease (33). Aldo pressor effects have been demonstrated to involve actions in the CNS and to interact with ANG II (27). Forebrain structures along the lamina terminalis (LT) [i.e., subfornical organ (SFO), median preoptic nucleus (MnPO), organum vasculosum of the lamina terminalis (OVLT)] and the hypothalamus [particularly the paraventricular nucleus (PVN)] play important roles in the long-term regulation of BP and body fluid homeostasis. LT structures are involved in both sensing and processing input derived from humoral factors (e.g., ANG II, Aldo and extracellular osmolality) and transmitting this information to other forebrain regions, particularly the PVN (12). Ablations of the periventricular tissue lining the anteroventral part of the third cerebral ventricle (AV3V) destroy cell bodies in the OVLT and MnPO, as well as interrupt efferent projections from the SFO to the OVLT, MnPO, and cardiovascular control nuclei in the hypothalamus. These lesions abolish DOCA-salt hypertension in the rat (12). It has been also shown that Mas-R, ERs, and mineralocorticoid receptor (MR) are expressed in LT structures (4, 21, 25). Therefore, in the present study, in vivo telemetric recording of BP and RT-PCR to assess mRNA expression of several RAS components, estrogen receptors and an NADPH oxidase subunit in the LT were used to investigate the role of brain ACE2/ANG-(1–7)/Mas-R axis in the protective actions of estrogen in Aldo-induced hypertension.

METHODS

Animals

Forty Sprague-Dawley female rats (10–12 wk old, Harlan) were used. They were housed in a temperature- and humidity-controlled facility. The rats were maintained in a 12:12-h light-dark cycle (6:00 AM to 6:00 PM) and were provided with rat chow (7013 NIH-31 modified rat diet, 0.25% NaCl) ad libitum. The rats were divided into five groups: 1) intracerebroventricular (icv) infusions of vehicle in intact females (n = 5); 2) icv infusions of ANG-(1–7) analog d-alanine-[ANG-(1–7)] (A-779, 60 ng·kg⁻¹·min⁻¹, GenScript), an ANG-(1–7) receptor antagonist, in intact females (n = 6); 3) icv infusions of vehicle in OVX females (n = 6); 4) icv infusions of ANG-(1–7) (1.8 μg/h, Bachem) in OVX females (n = 6); and 5) icv concurrent infusion of ANG-(1–7) and A-779 (n = 5). A-779 is a potent and selective ANG-(1–7) receptor antagonist and has a very low affinity for AT1-R and AT2-R. This compound antagonizes several actions of ANG-(1–7), including the changes in BP produced by ANG-(1–7) microinjection into the dorsomedial or ventrolateral medulla and beneficial effects of ANG-(1–7) on hypertension and heart failure (2, 13, 18, 22). The doses of ANG-(1–7) and A-779 used in the present study were based on the above studies.

All of the groups were infused subcutaneously with Aldo (750 ng/h, Sigma) combined with 1% NaCl as the sole drinking fluid. The 1% NaCl intakes were measured daily. Three additional control groups were only given 1% NaCl, icv A-779, or icv ANG-(1–7) without Aldo treatment (n = 4 each group). After the physiological studies were finished, brains were taken and LT-associated tissue was collected by micropunching for determining mRNA expression of several components of RAS, ERα, ERβ, and gp91phox (NOX2), an NADPH oxidase subunit.

All experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the University of Iowa Animal Care and Use Committee.

Surgical Procedures

Ovariectomy and telemetry probe implantation.

Bilateral OVX was performed in female rats. A single 2- to 3-cm dorsal midline incision was made in the skin and underlying muscles. The ovaries were isolated, tied-off with sterile suture, and removed, and the incisions were closed. Ten days later, rats were chronically instrumented with telemetry probes (TA11-PA40, DSI) through the femoral artery for continuous monitoring of mean arterial pressure (MAP) and HR.

Chronic icv cannula and osmotic pump implantation.

After baseline BP and HR recordings were made, the rats were again anesthetized with ketamine-xylazine mixture, and the icv cannula with an osmotic pump (ALZET Brain Infusion Kits, Alzet) was implanted into the right lateral ventricle (the coordinates 1.0 mm caudal, 1.5 mm lateral to bregma, and 4.5 mm below the skull surface) for chronic infusion of vehicle, A-779, ANG-(1–7), or both for 28 days. At the same time, osmotic pumps (model 2004, Alzet) containing Aldo were implanted subcutaneously in the back, and tap water was changed to 1% NaCl.

Experimental Protocol

Measurement of BP and HR.

All rats were allowed 7 days to recover from transmitter implantation surgery before any measurements were made. Thereafter, BP and HR were telemetrically recorded 5 min every hour and stored with the Dataquest ART data acquisition system (DSI). BP and HR were collected for 5 baseline days and then for 28 consecutive days after Aldo pump implantation.

Measurement of mRNA expression in the LT.

Total RNA was isolated from the LT using the Trizol method (Invitrogen) and treated with DNase I (Invitrogen). RNA integrity was checked by gel electrophoresis. Total RNA was reverse transcribed using random hexamers following the manufacturer's instructions (Applied Biosystems). Real-time PCR was conducted using 200–300 ng of cDNA and 500 nM of each primer in a 20 μl reaction with iQ SYBR Green Supermix (Bio-Rad). Amplification cycles were conducted at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s and annealing/extension at 60°C for 30 s. Reactions were performed in duplicate and analyzed using a C1000 thermocycler system (Bio-Rad). Samples that did not yield homogenous melt curves were excluded. Changes in mRNA expression levels were normalized to GAPDH levels and calculated using the ΔΔCt method. Results are expressed as relative fold change, mean of fold change ± SE. Primers were purchased from Integrated DNA Technologies (Coralville, IA). The sequences of the primers are shown in Table 1.

Table 1.

Primer sequences for real-time PCR

Gene	Forward Primer	Reverse Primer	Product Size, bp	Accession No.
GAPDH	TGACTCTACCCACGGCAAGTTCAA	ACGACATACTCAGCACCAGCATCA	141	XM_001062726.2
Renin	CTGCCACCTTGTTGTGTGAG	ACCTGGCTACAGTTCACAACG	154	NM_012642.4
AGT	TCCCTCGCTCTCTGGACTTA	AAGTGAACGTAGGTGTTGAAA	209	NM_134432.2
AT1-R	CTCAAGCCTGTCTACGAAAATGAG	GTGAATGGTCCTTTGGTCGT	188	NM_030985.4
AT2-R	ACCTTTTGAACATGGTGCTTTG	TTTCCTATGCCAGTGTGCAG	160	NM_030985.4
ACE1	GTGTTGTGGAACGAATACGC	CCTTCTTTATGATCCGCTTGA	187	AF539425.1
ACE2	TTAAGCCACCTTACGAGCCTC	GCCAATGTCCATGGAGTCAT	170	GQ262788.1
Mas-R	TGTGGGTGGCTTTCGATT	CCCGTCACATATGGAAGCAT	159	NM_012757.2
gp91phox	CAAGATGGAGGTGGGACAGT	GCTTATCACAGCCACAAGCA	170	AF298656.3
ERα	CATCGATAAGAACCGGAGGA	TCTGACGCTTGTGCTTCAAC	128	AB477039
ERβ	GAAGCTGAACCACCCAATGT	CAATCATGTGCACCAGTTCC	112	AB190770

AGT, angiotensinogen; AT-R, angiotensin receptor; ACE, angiotensin-converting enzyme; ER, estrogen receptor.

Data Analysis

MAP and HR are presented as mean daily values. Difference scores for MAP and HR were calculated for each animal based on the mean of the 5-day baseline subtracted from the mean of the final 5 days of treatment. One-way ANOVAs for the experimental groups were then conducted on the means of calculated difference scores. After establishing a significant ANOVA, post hoc analyses were performed with Tukey multiple comparison tests between pairs of mean change scores. To test differences in the mean of the 5 days baseline vs. the mean of the final 5 days of treatment, paired t-tests were performed in animals within the same group. The same statistical methods were also used to analyze the changes in HR, 1% NaCl intake, and differences in mRNA expression of the RAS components, ERα, ERβ and NOX2 in the LT. All data are expressed as means ± SE. Statistical significance was set at P < 0.05.

RESULTS

The rats exhibited a normal circadian cycle of MAP and HR both before and during infusion of Aldo or Aldo combined with icv ANG-(1–7) and A-779. Aldo alone or Aldo plus A-779 or ANG-(1–7) elicited changes in the same direction of daytime and nighttime BPs. Consequently, all data were expressed as values averaged from daytime and nighttime measurements.

Effect of icv Infusions of Mas-R Antagonist A-779 on Aldo/NaCl-Induced Hypertension in Intact Females

Baseline values for MAP (102.6 ± 1.3 mmHg) and HR (366.9 ± 6.5 beats/min) were comparable prior to and following application of 1% NaCl alone or icv infusion of A-779 alone in all groups of intact female rats (data not shown in Fig. 1). Twenty-eight days of Aldo/NaCl treatment resulted in a slight, but significant increase in MAP in intact females with icv vehicle infusion (Δ9.5 ± 1.5 mmHg, P < 0.05). In contrast, females receiving the same Aldo/NaCl treatment along with icv infusions of A-779 showed significantly augmented pressor effects (Δ19.9 ± 2.1 mmHg, P < 0.05, Fig. 1, A and B). Systemic Aldo infusions also produced significant, comparable decreases in HR (Fig. 1C, P > 0.05) in all groups when compared with rats given 1% NaCl alone.

Fig. 1.

Central blockade of angiotensin (ANG)-(1–7) augmented pressor effects induced by aldosterone (Aldo)/NaCl in intact female rats. A: daily mean arterial pressures (MAP) before and during systemic infusion of Aldo in intracerebroventricular (icv) vehicle or A-779-treated female rats. B and C show average changes in MAP and heart rate (HR) across days induced by Aldo infusion in all groups. *P < 0.05 vs. baseline. #P < 0.05 vs. icv vehicle/NaCl or Aldo/NaCl.

Effect of icv Infusions of ANG-(1–7) on Aldo/NaCl-Induced Hypertension in OVX Females

Baseline values for MAP (104.3 ± 1.5 mmHg) and HR (342.8 ± 6.3 beats/min) were comparable prior to and following icv ANG-(1–7) infusion in all groups of OVX females. Following 28 days of Aldo/NaCl treatment, MAP was significantly increased in OVX females (Δ26.8 ± 2.9 mmHg, P < 0.05). Icv infusion of ANG-(1–7) for 28 days significantly attenuated this Aldo/NaCl pressor effect (Δ11.9 ± 2.8 mmHg, P < 0.05). Icv concurrent infusion of A-779 abolished the inhibitory effect of icv ANG-(1–7) on Aldo/NaCl-induced hypertension (Δ27.7 ± 2.3 mmHg, P < 0.05, Fig. 2, A and B). Systemic Aldo infusions also produced significant, comparable decreases in HR in all groups (Fig. 2C).

Fig. 2.

Central infusion of ANG-(1–7) attenuated pressor effects induced by Aldo/NaCl in ovariectomized (OVX) female rats. Concurrent administration of A-779 abolished the protective effect of ANG-(1–7). A: daily mean arterial pressures (MAP) before and during systemic infusion of Aldo and 1% NaCl access in icv infusion of ANG-(1–7) and A-779. B and C show average changes in MAP and HR across days induced by Aldo infusion in all groups. *P < 0.05 vs. baseline. #P < 0.05 vs. icv vehicle + Aldo/NaCl or icv ANG-(1–7)/A-779 + Aldo/NaCl.

Effects of Aldo Infusion on 1% NaCl Intake in Intact and OVX Females with icv Infusions of A-779 and/or ANG-(1–7)

There was no difference in 1% NaCl intake between intact females and OVX rats when given Aldo vehicle alone. Systemic infusion of Aldo produced a significant, but comparable, increase in 1% NaCl intake in all groups of rats (Fig. 3).

Fig. 3.

Mean daily 1% NaCl intake during Aldo infusion in intact or OVX female rats treated with central vehicle, ANG-(1–7), A-779, or ANG-(1–7) plus A779. *P < 0.05 vs. icv vehicle plus Aldo vehicle.

Effect of Aldo Infusions on the mRNA Expression of RAS Components, the NADPH Oxidase Subunit and ERs in the LT

In LT tissue collected from intact females, Aldo induced a significant increase in the mRNA expression of AT1-R, ACE1, NOX2, ACE2, Mas-R and ERα while decreasing the mRNA expression of renin and AT2-R when compared with controls (P < 0.05). The expression of AGT and ERβ in the LT was not changed (P > 0.05). Central infusion of A-779 resulted in greater increases in mRNA expression of renin, AGT, and NOX2 during Aldo infusion. In contrast, the mRNA expression of ACE2, Mas-R, and ERα was decreased (P < 0.05, Fig. 4), while the mRNA expression of AT1-R and ACE1 remained higher and AT2-R was still lower. These results suggest that in intact female rats with central blockade of ANG-(1–7), increased mRNA expression of renin, AGT, and NOX2 and decreased ACE2, Mas-R, and ERα expression in the LT may be responsible for the augmentation of pressor effects induced by Aldo/NaCl.

Fig. 4.

Changes of mRNA expression in renin-angiotensin system components (A–C), estrogen receptors (ER; D), and the NADPH oxidase subunit NOX2 (E) in the lamina terminalis (LT) of intact and OVX female rats after central infusion of A-779 or ANG-(1–7) and systemic administration of Aldo. AGT, angiotensinogen; AT1R and AT2R, ANG type 1 and 2 receptors, respectively. *P < 0.05 vs. intact females. #P < 0.05 vs. intact females with icv vehicle plus Aldo. ‡P < 0.05 vs. OVX females with icv vehicle plus Aldo.

Ovariectomy alone induced a significant increase in the mRNA expression of AT1-R and ERα in the LT. In these OVX females, Aldo infusion resulted in a significant increase in the mRNA expression of renin, ACE1, and NOX2 in the LT while AT2-R and ERα was decreased (P < 0.05). Central infusion of ANG-(1–7) reversed the changes in mRNA expression of these genes during Aldo infusion (P < 0.05, Fig 4). These results indicate that in OVX female rats receiving central infusions of ANG-(1–7), a decrease in mRNA expression of renin, ACE1, and NOX2, and an increase in AT2-R and ERα expression in the LT may play a protective role against the development of Aldo/NaCl-induced hypertension.

DISCUSSION

The main findings of this study are that 1) central blockade of ANG-(1–7) augmented Aldo/NaCl-induced hypertension in intact female rats. In contrast, central infusion of ANG-(1–7) attenuated Aldo/NaCl-induced hypertension in OVX females; 2) in intact female rats with central blockade of ANG-(1–7) there was increased mRNA expression for renin, AGT, and NOX2, and decreased ACE2, Mas-R, and ERα mRNA expression in the LT. This pattern of change in gene products associated with mRNA expression may be responsible for the augmentation of the pressor effects induced by Aldo/NaCl; and 3) in OVX female rats with central infusion of ANG-(1–7), decreased mRNA expression for renin, ACE1, and NOX2, and increased ERα and AT2-R in the LT may be responsible for the inhibitory effect of ANG-(1–7). Taken together, these results suggest that female sex hormones upregulate brain ACE2/ANG-(1–7) to provide a protective role against the development of Aldo/NaCl-induced hypertension. An ANG-(1–7) mediated increase in ERα expression and a decrease in NADPH oxidase expression are also involved in its protective responses.

Accumulating evidence shows that ANG-(1–7) functions as a counterregulatory peptide for ANG II- and Aldo-hypertension-inducing effects. The protective effects of ANG-(1–7) are by actions on both brain and peripheral tissues (24). Feng et al. (2) reported that brain overexpression of ACE2 attenuated ANG II-induced hypertension, at least partly, by increasing AT2-R, Mas-R, and nitric oxide synthase (NOS) mRNA expression and NO production in the brain of male mice. A life-time increase in circulating ANG-(1–7) or icv infusion of ANG-(1–7) reduced the pressor effect of DOCA/salt in male rats (6, 17). These studies demonstrated the protective effects of exogenous ANG-(1–7), especially in the CNS, in the development of hypertension.

Sex differences in the development of hypertension and female protection from hypertension have been well described in animal models (14, 15, 28). Estrogen has been shown to downregulate components of the RAS hypertensive axis (i.e., ACE1/ANG II/AT1-R). Nevertheless it is important to determine if there is also a protective effect conferred by regulation of the ACE2/ANG-(1–7)/Mas-R antihypertensive axis. Recent studies from two groups have reported that ACE2/ANG-(1–7) contributed to the sex differences in the development of ANG II- or obesity-induced hypertension because both OVX and the Mas-R antagonist abolished the sex differences in these forms of hypertension (7, 22). In the present study, we found that central blockade of the Mas-R augmented Aldo/NaCl-induced hypertension in intact female rats, while central infusion of ANG-(1–7) attenuated Aldo/NaCl-induced hypertension in OVX females. These results suggest that brain endogenous ANG-(1–7) in the female normally acts to buffer increases in BP in the development of Aldo/NaCl hypertension.

Forebrain structures along the LT play important roles in the development of Aldo/NaCl hypertension. It has been shown that Mas-R, ERs, and MR are expressed in many brain areas involved in cardiovascular regulation including LT structures (4, 21, 25). Overexpression of ACE2 in the SFO reduces acute ANG II-mediated pressor and drinking responses (3). Together these results indicate the LT-associated structures are possible sites where estrogen interacts with Aldo and ANG-(1–7) to regulate BP in the females. In relation to the changes seen in the brain, recent studies demonstrated that under both basal conditions and after ANG II infusion, renal cortical ANG-(1–7) levels were higher in female SHRs compared with males, and that ACE2 is involved in the protective effects of estrogen in obesity-related hypertension (7, 22). Such results indicate that estrogen modulates ACE2/ANG-(1–7) in a tissue-specific manner. In the present study, Aldo infusion resulted in increases in both ACE2 and Mas-R mRNA expression in the LT. These increases in ACE2 and Mas-R mRNA expression were attenuated by central Mas-R antagonist in intact females. In contrast, there were no changes in ACE2 or Mas-R mRNA expression under basal conditions, after Aldo or ANG-(1–7) plus Aldo treatment in the absence of female sex hormones (OVX). These data are consistent with those previously mentioned studies showing a similar pattern of changes in ACE2 and Mas-R mRNA expression in the renal cortex and in adipose tissue of ANG II- or obesity-hypertensive female mice (7, 22). Our results suggest that female sex hormone upregulation of the brain ACE2/ANG-(1–7)/Mas-R axis during Aldo infusion contributes to the lower BP of intact females, while the failure to increase ACE2/Mas-R in the case of estrogen deficiency may be partially responsible for the elevated BP in OVX females.

Hypertension is associated with augmented activation of the classic RAS hypertensive axis in the periphery and in the brain. Aldo enhances ANG II-induced increases in expression of renin, AT1-R, and ACE1 mRNA in the LT (31). In contrast, estrogen is recognized to directly interact with the RAS, downregulating renin and ACE1 activity and AT1-R mRNA expression, as well as upregulating AT2-R mRNA expression (1, 16, 19). Moreover, estrogen regulation of the expression of RAS components has been shown to be different between normal and abnormal conditions (1, 9, 11). We only found increased expression of AT1-R and of ERα mRNA in control OVX females in the present study. Aldo infusion resulted in significant increases in AT1-R and ACE1 mRNA expression in the intact females, suggesting that endogenous estrogen is not effective in downregulating the RAS hypertensive axis under the condition of Aldo treatment. The expression of renin mRNA was increased, while that of AT1-R and ACE1 mRNA expression was maintained at significantly higher levels in intact females treated with central A-779 and in OVX animals during Aldo infusion. Given the decrease or no change in ACE2 expressions in these animals, a higher level of ACE1 expression made the balance between ACE1 and ACE2 expression favor ACE1. These observations provide a possible explanation for why there was an enhanced pressor response to Aldo in these animals. However, central infusion of ANG-(1–7) reduced the Aldo-induced increase in renin and ACE1 mRNA expression and restored AT2-R expression in OVX females. This may be one of the beneficial mechanisms underlying the ANG-(1–7) protective effect in which decreased expression of renin and ACE1 mRNA may result in reduced ANG II generation, and the effects of an enhanced central AT2-R mRNA expression might buffer the actions of ANG II on AT1-R. Taken together, endogenous ANG-(1–7) in the presence of estrogen does not seem to regulate the hypertensive axis while exogenous ANG-(1–7) in the absence of estrogen appears to downregulate it.

It is well known that estrogen actions on cardiovascular hemodynamics are mediated by at least the two classic estrogen receptor (ER) subtypes, ERα and ERβ. Subtype-specific expression has also been demonstrated in autonomic nuclei; for example, ERα appears to predominate in LT-related structures, while ERβ is important in the PVN (21). Previous studies have shown that central activation of either ERα or ERβ is protective against the hypertension induced by Aldo in female rats (30). Shimada et al. (20) reported that the cortical infarct volume was smaller in intact female rats than in the OVX females, and that the level of brain ERα expression was a determinant of ischemic brain damage. In the present study, ERα, but not ERβ, mRNA expression in the LT was upregulated in intact females with Aldo treatment and in OVX females with treatment of ANG-(1–7) plus Aldo. Conversely, LT ERα mRNA expression was downregulated by Aldo in intact females with central blockade of ANG-(1–7) and in OVX females. These data indicate that ANG-(1–7) beneficial effects may be associated with the upregulation of ERα.

In addition, gp91phox/NOX2 is a key subunit enzyme of NADPH oxidase that catalyzes the reduction of molecular oxygen to form reactive oxygen species (ROS) (8). Previous studies from our laboratory have demonstrated that Aldo increases BP through increased oxidative stress in the forebrain (26, 27). Estrogen inhibits ANG II-induced hypertension and activation of SFO neurons via interactions with intracellular ROS production (32). OVX increases the activity of NADPH oxidase in renal wrap hypertension (10). In the present studies, LT-associated structures showed a significant increase in NOX2 mRNA expression after Aldo infusion in intact females. Aldo-induced NOX2 mRNA expression was further increased in central Mas-R antagonist-treated intact females and in OVX females. Central treatment with ANG-(1–7) blocked this Aldo-induced increase in NOX2 mRNA expression. These results indicate that either endogenous or exogenous ANG-(1–7) inhibits brain NADPH oxidase and provide further evidence for a mechanism underlying the beneficial effect of ANG-(1–7) on BP regulation. The present study is consistent with and extends a recent report showing that ACE2 deletion increases ROS levels and exaggerates ANG II-induced oxidative stress in brain regions related to cardiovascular function. ACE2 gene enhancement reduces ANG II-mediated ROS production associated with inhibition of NADPH oxidase (23).

Taken together, the present study demonstrates that both endogenous and exogenous ANG-(1–7) play a pivotal protective effect against Aldo-induced hypertension in intact and OVX females, respectively. Endogenous ANG-(1–7) in the presence of estrogen and exogenous ANG-(1–7) in the absence of estrogen seem to act via different mechanisms to attenuate an Aldo-induced increase in BP. In the former condition the antihypertensive axis of the brain RAS is upregulated while in the case of the latter the hypertensive axis is downregulated. ANG-(1–7) mediated increase in ERα expression and decrease in NADPH oxidase expression are also involved in the protective effects of estrogen.

GRANTS

This work was supported by National Institutes of Health Grants HL-14388, HL-98207, and MH-80241.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: B.X., M.H., and A.K.J. conception and design of research; B.X., Z.Z., R.F.J., and F.G. performed experiments; B.X. and Z.Z. analyzed data; B.X. and A.K.J. interpreted results of experiments; B.X. and Z.Z. prepared figures; B.X. drafted manuscript; B.X., M.H., and A.K.J. edited and revised manuscript; B.X., Z.Z., R.F.J., F.G., M.H., and A.K.J. approved final version of manuscript.