Laser Capture Microdissection for Protein and NanoString RNA analysis

Abstract

Laser capture microdissection (LCM) allows the precise procurement of enriched cell populations from a heterogeneous tissue, or live cell culture, under direct microscopic visualization. Histologically enriched cell populations can be procured by harvesting cells of interest directly, or isolating specific cells by ablating unwanted cells. The basic components of laser microdissection technology are a) visualization of cells via light microscopy, b) transfer of laser energy to a thermolabile polymer with either the formation of a polymer-cell composite (capture method) or transfer of laser energy via an ultraviolet laser to photovolatize a region of tissue (cutting method), and c) removal of cells of interest from the heterogeneous tissue section. The capture and cutting methods (instruments) for laser microdissection differ in the manner by which cells of interest are removed from the heterogeneous sample. Laser energy in the capture method is infrared (810nm), while in the cutting mode the laser is ultraviolet (355nm). Infrared lasers melt a thermolabile polymer that adheres to the cells of interest, whereas ultraviolet lasers ablate cells for either removal of unwanted cells or excision of a defined area of cells. LCM technology is applicable to an array of applications including mass spectrometry, DNA genotyping and loss-of-heterozygosity analysis, RNA transcript profiling, cDNA library generation, proteomics discovery, and signal kinase pathway profiling. This chapter describes laser capture microdissection using an Arcturus^XT instrument for protein LCM sample analysis, and using a mmi CellCut Plus® instrument for RNA analysis via NanoString technology.

1. Introduction

Tissue heterogeneity is a normal biological attribute of multicellular organisms. A variety of cell types constitute tumors as well as healthy tissue. The ability to analyze a specific cell population, within a heterogeneous tissue sample, posses difficulties for both genomic and proteomic researchers during tissue analysis Molecular analysis of heterogeneous tissue is currently ambiguous because it is impossible to discern which cells contribute which cellular constituents to a given tissue lysate (1). Molecular profiling of pure cell populations, which is reflective of the cell population’s in vivo genomic and proteomic state, is essential for correlating molecular signatures in normal and diseased tissue (2-8). Laser capture microdissection is a technique that allows the identification, selection and isolation of pure cell populations from a heterogeneous tissue section, cytological preparation, or from live cell culture via direct microscopic visualization of the cells (2, 3). LCM enables researchers to isolate normal and diseased cells, as well as different stages of cells such as pre-malignant and malignant cells without contamination from surrounding cells (1, 4-7, 9-14). Xenograft tissues and host tissue may be isolated via LCM (15)). Downstream analysis of the microdissected cells may be performed with any method that has adequate sensitivity. Recently a method for in situ proteomic analysis of microdissected cells has been described, permitting potential biomarker discovery in small numbers of breast cells (16).

LCM technology encompasses two general classes, infrared (IR) laser capture systems (2, 3) and ultraviolet (UV) laser cutting systems (17-21). The basic components of LCM technology are (a) visualization of the cells of interest via microscopy, (b) transfer of laser energy to a thermolabile polymer with formation of a polymer-cell composite (IR system) or photo volatilization of cells surrounding a selected area (UV system), and (c) removal of the cells of interest from the heterogeneous tissue section. The Arcturus^XT™ system (Applied Biosystems/Life Technologies) incorporates both laser types in one instrument providing options as to the type of microdissection to be performed. The mmi CellCut Plus® instrument utilizes a UV laser for “cutting” selected cells from a tissue section.

The uses a stationary near-infrared laser mounted in the optical axis of the microscope stage to melt a thermolabile polymer film (see Note 1). The polymer film is manufactured on the bottom surface of an optical-quality plastic support cap. The cap acts as an optic for focusing the laser in the same plane as the tissue section. The polymer melts only in the vicinity of the laser pulse, forming a polymer-cell composite. A dye integrated into the polymer serves two purposes: 1) it absorbs laser energy, preventing damage to the cellular constituents, and 2) it aids in visualizing areas of melted polymer (Figure 1). Microdissection occurs when the polymer is removed from the tissue surface, at which point the embedded cells of interest are sheared away from the heterogeneous tissue section. The exact cellular morphology, as well as the DNA, RNA and proteins of the procured cells, remain intact and bound to the polymer (Figure 2). Ultraviolet lasers in both the Arcturus^XT™ and the mmi CellCut Plus® instruments photovolatilize cells and/or the mounting medium, typically a polyethylene napthalate (PEN) membrane. In UV cutting mode, a microdissection cap is placed on the surface of the tissue, encompassing the area of photovolatilization, and the infrared laser melts the thermolabile polymer in several defined areas around the edge of the cut area, thus holding the cut area of tissue/membrane in place. The mmi CellCut Plus® instrument uses an adhesive membrane mounted on the lid of a collection tube to secure the microdissected cells/membrane during microdissection. Following microdissection, extraction buffer may be applied directly to the polymer film for solubilizing the cells, allowing the collection of nucleic acids or protein for downstream analysis.

Figure 1. Arcturus^XT software for microdissection.

A. The Arcturus^XT instrument operates via a series of software tool panes and option buttons. Each step of the microdissection process and can be accessed from the main software screen. Mouse bony ear tissue is shown at 2x magnification in the live image, and an overview of the tissue slide is shown below. The overview image allows the operator to navigate across the slide and/or tissue section. B. Properly melted spots have a dark outer ring and a clear center, indicating that the polymer has melted and is in direct contact with the slide. Inadequate power and/or duration settings create spots with a hazy appearance, lacking a distinct black ring (live image shown as 60x magnification). The area to be microdissected can be measured to match the microdissection area to the cell size.

Figure 2. Arcturus^XT Infrared Laser Capture Microdissection process.

A. A section of mouse inner ear tissue is mounted and stained on a glass slide and viewed under high magnification (40x) to locate the ciliated epithelium. The ciliated epithelium are identified visually and designated for microdissection using software annotation tools at 2x, 10x, 40x, or 60x magnification. The infrared laser locally expands a thermoplastic polymer that captures the cell(s) only in the vicinity of the laser pulse. B. Microdissection occurs when the film is lifted from the tissue section, shearing the selected cells from the tissue section. The presence of stained material inside the melted margins of the polymer indicates effective microdissection (10x).

Tissue preservation methods should be taken into consideration when planning laser capture microdissection and downstream analyses. Although LCM is compatible with frozen, fixed, or paraffin embedded specimens, tissue preservation methods vary greatly in their ability to preserve nucleic acids, proteins, and post-translational modifications of proteins (22-24). Pre-analytical variability originating from tissue procurement and preservation may cause significant variability and bias in downstream molecular analysis. Depending on the ex vivo delay time in tissue processing, and the manner of tissue handling, nucleic acids, proteins, and phosphoproteins will be elevated or suppressed in a manner that does not represent the molecule at the time of excision. Consequently, molecular profiling requires stabilization, or preservation, of the molecules of interest immediately post tissue procurement. Proteins can be extracted with variable yield from formalin fixed tissue (25). The yield depends on the time, chemistry of formalin fixation, and the tissue geometry and density. Formalin penetrates tissue at a variable rate, reported to be within the range of mm/hr (26-28). During this time the portion of the living tissue deeper than several millimeters would be expected to undergo significant fluctuations with regard to phosphoprotein analytes. The preferred specimen for protein and RNA analysis is frozen tissue because formaldehyde becomes hydrated in aqueous solutions, forming methylene glycol (26, 28). Methylene glycol readily penetrates tissue, yet it is the small percentage of carbonyl formaldehyde that covalently cross-links proteins and nucleic acids, resulting in tissue fixation (26, 28). Formalin cross-linking, the formation of methylene bridges between amide groups of protein, blocks analyte epitopes thereby decreasing the yield of proteins extracted from the tissue.

Desirable aspects of tissue preservation are a) preservation of nucleic acids, proteins and protein post-translational modifications such as phosphorylation state, b) maintenance of nuclear size and morphology, c) functional at room temperature, d) one-step system, and e) compatible with standard paraffin embedding and processing. We have developed a fixative for protein and phosphoprotein preservation that meets these criteria (Figure 3) (22, 23, 29).

Figure 3. Mouse bony ear tissue adequately preserved for laser capture microdissection.

Bony inner ear tissue, preserved in a novel protein/phosphoprotein preservative (22, 23) and paraffin embedded, shows retention of morphology adequate for microdissection of inner ear ciliated epithelium.

This chapter presents microdissection of frozen tissue sections for proteomic analysis as an illustration of the operation of the Arcturus^XT™ in both capture and cutting modes, and microdissection of formalin fixed paraffin embedded (FFPE) tissue section on a mmi CellCut Plus® instrument for RNA analysis via NanoString technology (30).

2. Materials

Tissue for microdissection is usually prepared as a cryosection, or a paraffin embedded section, on a glass or PEN (polyethylene napthalate) membrane, or PET (polyethylene terephthalate) slide. The tissue section is stained for histomorphologic identification of cells. The stained section is used immediately for laser capture microdissection, or stored in a desiccator, depending on the tissue and molecular analysis type.

2.1. Preparation of Tissue Sections for Arcturus^XT Infrared Capture Mode

1. Uncharged, pre-cleaned glass microscope slides, 25 × 75 mm

2. Optimal cutting temperature cryopreservation solution (Tissue-Tek® O.C.T.™) (Sakura Finetek) for embedding frozen tissue sections.)

3. Cryomolds

4. Specimen for protein analysis: frozen tissue or ethanol fixed tissue sections cut at 2-15 μm (thickness of 5-8 μm is optimal for capture methods) (see Note 2)

5. Dry ice; Inhalation and contact hazard. Use with appropriate ventilation and personal protective equipment.

2.1.2. Preparation of Frozen Tissue Sections for UV Cutting Mode (protein analysis)

1. PEN membrane or PEN frame slides, 25 × 75 mm

2. Optimal cutting temperature cryopreservation solution (Tissue-Tek® O.C.T.™) (Sakura Finetek) for embedding frozen tissue sections.)

3. Cryomolds

4. Specimen for protein analysis: frozen of ethanol fixed tissue sections cut at 2-200 μm (see Note 2)

5. Dry ice

2.1.3. Preparation of FFPE tissue sections for UV Cutting Mode (NanoString analysis)

• 6. Automated microtome

• 7. PET PALM® metal framed membrane slide (polyethylene terephthalate) (P.A.L.M. Microlaser Technologies)

• 8. RNAse-AWAY™ (Molecular BioProducts)

• 9. RNAse-free water (Hydro Picopure® 2UV Plus)

• 10. FFPE tissue paraffin block for RNA analysis

• 11. Ice pan with solid ice (kept at −20°C)

• 12. Water bath with RNAse-free water at +43°C

• 13. 8% 3-aminopropyltriethoxysilane (APES) (Sigma) in dry acetone

2.2. Hematoxylin and Eosin (H&E) staining for frozen/FFPE sections for protein analysis

1. Mayer’s Hematoxylin Solution (Sigma). Inhalation and contact hazard; wear gloves when handling.

2. Eosin Y Solution, alcoholic (Sigma). Highly flammable; store away from heat, sparks, and open flames. Contact hazard; wear gloves when handling.

3. Scott’s Tap Water Substitute (Fisher), also known as Blueing Solution (see Note 3).

4. Ethanol (ethyl alcohol, absolute, 200 proof molecular biology grade). Flammable; store away from heat, sparks, and open flames.

5. Ethanol gradient: 70% (v/v in dH₂O), 95% and 100% ethanol (see Note 4).

6. Type 1 reagent-grade water (dH₂O).

7. Xylene. Xylene vapor is harmful and can be fatal if inhaled. Use in a well-ventilated area and discard in appropriate hazardous waste container. Flammable; Contact hazard; wear gloves when handling.

8. Protease inhibitors (Complete Protease Inhibitor Cocktail tablets; Roche). Use one inhibitor tablet for every 10ml of solution (see Note 5).

2.2.1. One-step Cresyl Violet Acetate/Eosin Y staining of FFPE sections for NanoString analysis

1. Cresyl violet acetate (Sigma)

2. Eosin Y (VWR)

3. Ethyl alcohol USP Absolute-200 proof (AAPER Alcohol and Chemical Co.)

4. RNAse–free water

5. ProtectRNA™ RNase inhibitor (Sigma)

6. Xylene

7. 50 ml conical (Falcon) tubes

2.3. Laser Capture Microdissection Infrared Mode

1. 1. Arcturus^XT laser capture microdissection system (Applied Biosystems)

2. CapSure® Macro LCM Caps (Applied Biosystems) are recommended for protein analysis. CapSure® HS LCM Caps (Applied Biosystems) are recommended for DNA or RNA downstream analysis (see Note 6).

3. SealRight tubes 0.5mL (USA Scientific) or GeneAmp ® 0.5mL Thin-walled Reaction Tubes with Domed Cap (cat. No. N801-0611; Applied Biosystems) (see Note 7)

2.4. Laser Capture Microdissection UV mode

1. Arcturus^XT laser capture microdissection system (Applied Biosystems/Life Technologies)

2. mmi CellCut Plus® microdissection system (MMI)

3. mmi IsolationCap® (MMI)

4. PCR tube (200 μL)

5. CapSure® Macro LCM Caps (Applied Biosystems) are recommended for protein analysis CapSure® HS LCM Caps (Applied Biosystems) are recommended for DNA or RNA downstream analysis (see Note 6)

6. SealRight tubes 0.5mL (USA Scientific) or GeneAmp ® 0.5mL Thin-walled Reaction Tubes with Domed Cap (cat. No. N801-0611; Applied Biosystems) (see Note 7)

2.5. Protein and RNA Extraction Buffers

1. Protein extraction buffer: 450μL T-PER Tissue Protein extraction reagent (Pierce), 450μL Novex® Tris-glycine 2X SDS loading buffer (Invitrogen), and 100 μL TCEP (Tris (2-carboxyethyl)phosphine) Bond Breaker® 10% v/v (Pierce).

2. RNA lysis buffer for NanoString analysis: 2 μL of buffer RLT with β-mercaptoethanol from AllPrep RNA/DNA extraction kit (Qiagen), 3.8μL of RNAse-free water (Hydro Picopure® 2UV Plus) 1.0μL Proteinase K from FFPE RNA extraction kit (Qiagen), 0.3μL of RNAseOut™ RNAse inhibitor (Invitrogen).

2.6. Adaptation of LCM workflow for NanoString platform

1. Aperio ScanScope® XT scanner

2. ImageScope™ software

3. Agilent Bioanalyzer (Agilent Technologies)

4. Agilent RNA 6000 Pico LabChip kit

5. AllPrep RNA/DNA extraction kit (Qiagen)

2.7. NanoString analysis of LCM samples

1. NanoString technology platform

2. LCM sample lysate

3. Reporter CodeSet

4. Capture ProbeSet

3. Methods

The protocols described below illustrate a) sample preparation of frozen tissue sections, b) hematoxylin and eosin (H&E) tissue staining for frozen sections and formalin fixed paraffin embedded sections (FFPE) or ethanol fixed paraffin embedded section, c) infrared capture mode microdissection, d) ultraviolet cutting mode microdissection using the Arcturus^XT and mmiCellCutPlus, e) cell lysis and protein extraction, and e) NanoString analysis (30).

3.1. Frozen Tissue Sectioning for Protein Analysis

Tissue biopsy samples should be stabilized promptly (within 15 minutes) after procurement. Stabilization methods for tissue that will be frozen include embedding in a cryopreservative solution or snap freezing as soon as the specimen is excised from the patient/animal. Prompt preservation of the sample reduces protein and RNA degradation as a result of protease and RNase activity respectively and limits reactive changes in phosphorylated kinases (22, 24, 31-33).

1. Embed tissue directly in a cryomold, covering the tissue with cryopreservative solution (OCT). Place OCT-embedded tissue on dry ice, or at −80°C, to freeze the tissue. Store the frozen tissue at −80°C (see Note 8).

2. Cut frozen sections at 2-15 μm thickness (5-8 μm is optimal for IR laser capture) and place sections on labeled, uncharged, pre-cleaned glass microscope slides (see Note 9). Position the tissue section near the center of the slide, avoiding the top and bottom thirds of the slide (see Note 10). Place the slide directly on dry ice or keep it in the cryostat at −20°C or colder, or place the slide in a pre-chilled slide box on dry ice until the slides can be stored at −80 °C. Alternatively the frozen section can be immediately stained and microdissected (see Note 11).

3.1.1. FFPE Tissue Sectioning for NanoString analysis

Maintain nuclease free conditions throughout the procedure: Tools should be wiped with RNAse-AWAY™, rinsed with RNAse-free water and wiped dry with a new kimwipe, A new disposable blade should be installed prior to cutting each sample. Use RNAse-free water in the water bath and use individual containers for soaking the tissue blocks (see Note 12). Discard the first 20-25 μm of tissue before cutting an LCM section (or use these first sections for reference H&E). Sections should be protected from dust while drying.

Coat PET slides with 8% 3-aminopropyltriethoxysilane (APES) in dry acetone.

1. Expose PET slides to UV at 352 nm for 30 minutes.

2. Immerse the slides in APES coating solution for 10 minutes.

3. Wash slides in two changes of acetone for 1 minute.

4. Rinse slides in two changes of RNAse-free water for 10 minutes.

5. Dry slides overnight at 37°C (see Note 13).

   Design a block trimming template and trim the block

6. Use an Aperio annotated digital image of the H&E reference slide (Figure 4A) to design a block trimming template (Figure 4B).

7. Trim the block to maximize the number of sections mounted on the PET slide (Figure 4C, D), and set a water bath at +43°C.

8. Cut serial 7 μm sections.

9. On a water bath, separate the number of sections that will fit inside the dissection area of the PET framed slide.

10. Position the tissue sections on the flat side of the PET slide, opposite the slide window. Center the sections such that the annotated area can be optimally dissected from around the slide midline (Figure 4D).

11. Air-dry slides for 1 hour in a vertical position. Place a filter paper under the slide so that water which may have accumulated under the bottom section will drain out. Incubate the slides at 37°C overnight, followed with a 1 h incubation at 58°C.

12. Cool slide to reoom temperature and place each sample set in an individual slide box with a dessicant pouch or Drierite. Store slides at −20°C.

Figure 4. Sectioning approach for LCM slide preparation (large scale target collection for NanoString analysis).

A. Aperio digital image of H&E slide with annotated papilloma (Aperio‘fit” magnification). B. FFPE block trimming template (Aperio 4x magnification). C. View of FFPE block trimmed according to the template. D. Serial sections mounted on PET membrane slide. Target area in A, B and D is indicated by a rectangular.

3.2. Hematoxylin & Eosin (H&E) Staining

Selection of tissue staining protocols should be based on compatibility with the downstream analysis (see Note 14). Staining protocols allow visualization and identification of the tissue or cells of interest with a standard inverted light microscope. Incorporation of protease inhibitors in the staining reagents, along with a microdissection session limited to 1 hr, minimizes protein degradation during the staining process. RNAse inhibitors are recommended for tissues sensitive to RNA degradation. Skin tissue, cartilage, and samples prepared on charged slides might be difficult to microdissect and may require additional slide or tissue treatments (see Note 15) (34). The staining procedure employed depends on whether the tissue is frozen or paraffin embedded.

3.2.1. H&E staining procedure for frozen tissue sections

1. Remove the frozen section slide from freezer/dry ice and proceed immediately with the staining protocol. Do not allow the slide to thaw.

2. Dip the slide in each of the following solutions, for the time indicated. Blot the slide on absorbent paper in between the different solutions to prevent carryover from the previous solution.

   1. 70% Ethanol fixative, 3-10 s
   2. dH₂O, 10 s
   3. Mayer’s hematoxylin, 15-20 s
   4. dH₂O, 10 s
   5. Scott’s Tap Water Substitute, 10 s
   6. 70% Ethanol, 10s
   7. Eosin Y (optional), 3-5 s (see Note 16)
   8. 95% Ethanol, 10 s
   9. 95% Ethanol, 10 s
   10. 100% Ethanol, 30-60 s
   11. 100% Ethanol, 30-60 s
   12. Xylene, 30-60 s (see Note 17)
   13. Xylene, 30-60 s

3. Allow the stained slide to air dry as quickly as possible (see Note 18).

4. Proceed immediately with microdissection. Do not coverslip the slide.

3.2.2. H&E staining procedure for formalin-fixed or ethanol-fixed paraffin-embedded tissue sections

1. Paraffin-embedded tissue sections must be de-paraffinized and rehydrated to allow staining of the tissue elements. Dip the slide in each of the following solutions, for the time indicated. Blot the slide on absorbent paper in between the different solutions to prevent carryover from the previous solution.

   1. Xylene, 5 - 15 min (see Note 19)
   2. Xylene, 5 - 15 min
   3. 100% Ethanol, 30 s
   4. 95% Ethanol, 30 s
   5. 70% Ethanol, 30 s
   6. dH₂O, 10 s
   7. Mayer’s hematoxylin, 15 s
   8. dH₂O, 10 s
   9. Scott’s Tap Water Substitute, 10 s
   10. 70% Ethanol, 10 s
   11. Eosin Y (optional), 3-5 s (see Note 16)
   12. 95% Ethanol, 10 s
   13. 95% Ethanol, 10 s
   14. 100% Ethanol, 30-60 s
   15. 100% Ethanol, 30-60 s
   16. Xylene, 30-60 s
   17. Xylene, 30-60 s

2. Air dry slide as quickly as possible.

3. Proceed immediately with microdissection. Do not coverslip the slide (see Note 18).

3.2.3. One-step Cresyl Violet Acetate/Eosin Y staining procedure for FFPE sections (NanoString analysis)

Our previously described protocol (35) was modified for a) improved contrast on the dissecting screen of the mmi CellCut Plus® instrument, B) gentle treatment of sections to minimize adherence to the membrane, and c) better preservation of tissue RNA. RNase free conditions and reagents should be used for the whole procedure. Staining is performed in 50 ml Falcon tubes filled with 45 ml of required reagent (see Note 20).

1. Prepare fresh staining mixture for 4 slides: 300μl of cresyl violet stock (dissolve 250 mg of cresyl violet in 25 ml of 100% ethanol, mix on a shaker overnight, filter for RNAse-free conditions, store at +4°C for at least 6 months for the stain to reach full strength), 100μL Eosin Y, 400 μL RNAse-free water, and 400 μL 100% ethanol. Vortex vigorously for 30 seconds, centrifuge at 6000rpm for 1 minute, and pipette from the surface of the stain.

2. Dissect one sample at a time. After −20°C storage, equilibrate slide to +4°C for 15 minutes in a closed box, and then to room temperature for 20 minutes.

3. Move slide to a desiccator for at least 10 minutes before staining.

4. Place the slide in xylene #1 and incubate for 5 minutes.

5. Transfer the slide to xylene #2 and incubate for 5 minutes.

6. Transfer the slide to 100% ethanol #1, gently invert the tube and incubate for 1 minute.

7. Transfer the slide to 100% ethanol #2 and incubate for 1 minute.

8. By pipette, apply a maximum of 200μL of stain to each section with ProtectRNA RNAse inhibitor (1:500) for 20 seconds, and immediately drain the slide by touching a kimwipe to the edge of the slide.

9. Dip the slide in 100% ethanol for 5 seconds to rinse the stain off.

10. Transfer the slide to 100% ethanol, and incubate for 30 seconds.

11. Transfer the slide to xylene #1, gently invert the tube and incubate for 2 minutes.

12. Transfer the slide to xylene #2, and incubate for 3 minutes.

13. Air-dry the slide for 5 minutes in a fume hood in a vertical position (see Note 21).

14. Transfer the slide to a desiccator at least for 10 minutes prior to LCM.

3.3. Laser Capture Microdissection: Infrared (IR) Capture Mode

The Arcturus^XT system combines IR capture microdissection (LCM) and ultraviolet (UV) laser cutting in one instrument. UV laser cutting microdissection allows the “cut and capture” of cells of interest by first ablating unwanted cells, thus preventing contamination during cell capturing. This system is particularly useful for microdissection of tissue sections up to 200 μm thick, such as plant tissue sections (5, 9). The Arcturus^XT instrument features imaging software for creating composite images of the tissue, allowing the user to identify differences in tissue architecture during cell selection. The Graphical User Interface permits the control of all operations in the system, including stage movement, slide selection, focus and light intensity, laser parameters, objective selection, cap transfers, and camera settings (Figure 1). Images may be captured, annotated, and saved as JPEG or TIFF files; live video can also be taken at any point during the microdissection process. This automated system is equipped with a trackball activated stage and a mouse for navigation across a slide. An interactive touch screen (stylus) monitor permits selection of single cells or groups of cells (36). A variety of slide types can be used with this automated system including glass, glass membrane (PEN), and/or framed membrane (PET) slides. This flexibility, along with the IR laser and UV laser capability of the system, allows the user to technically prepare any specimen for automated laser microdissection (see Note 22).

Microdissection is performed without cover slips or immersion oils. Lack of immersion fluids on any of the optics prevents refraction of light from the tissue image. Thus, the color and detail of a given tissue stain is lost as the stained slide dries. Manual LCM methods capitalize on the index refraction of a wet tissue slide for visualizing and reviewing an index-matched image of the tissue (11, 12). The Arcturus^XT allows an index-matched image or images to be digitally saved which can be used to directly mark the cells of interest for microdissection.

The microdissection process consists of six steps: 1) loading the slides and LCM caps, 2) locating the cells of interest, 3) LCM cap placement and laser location, 4) marking the cells of interest, 5) capturing the cells, and 6) unloading of the samples and caps containing the captured tissue.

3.3.1. Arcturus^XT instrument set-up

1. Turn on the PC, then the Arcturus^XT instrument, and touch screen monitor.

2. Open the Arcturus^XT software program by double clicking on the Arcturus^XT software icon.

3. Click on “Present Stage” in the SetUp tool pane. The microscope stage moves forward to allow loading of CapSure® caps and slides.

4. Load the CapSure® caps by sliding a CapSure® cap cartridge into the stage slot. Each cartridge holds 4 individual LCM caps.

5. Load up to 3 slides on the stage.

6. Remove any existing caps in the QC/Unload area.

7. Click the “i” options button to open the “Load Options” dialog box. Enter information about your slides and caps.

   1. Check each slide that is loaded.
   2. Check “Load with Overview” to create a full slide overview images.
   3. Select the type of slide: glass, membrane or frame.
   4. Enter a slide name/ID in the “SlideName” field.
   5. Enter any comments for each slide in the “SlideNotes” field.
   6. Click on the “Caps” tab to enter information about the caps.
   7. Select the type of cap: Macro or HS.
   8. Check each cap that is loaded.
   9. Click on “File Paths” tab to enter information regarding the location of saved images. Enter your desired file path/name information.
   10. Click “OK”.

3.3.2. Inspect image and locate cells of interest

1. Use the trackball or mouse to move the stage to an area for microdissection. The live video image is displayed on the monitor. Alternatively, you can tap the stylus on the overview image at the location of interest.

2. To view a different slide, tap the slide button for the slide of interest (see Note 23).

3. In the “Inspect” tool pane, select the desired objective, brightness and focus by tapping on the corresponding button. The selected objective is red. Autobrightness and Autofocus settings are the middle icon between the up and down arrows (see Note 24).

4. Locate the cells of interest using the trackball, mouse, or stylus to move the stage to the desired location (see Note 25).

3.3.3. LCM cap placement and laser location

1. Place a cap on the slide by clicking “Place Cap” icon in the “Microdissect” tool pane. The instrument places a cap at the center of the red box in the slide overview image. The apparent size of this box will change depending on the microscope objective. The cap location is outline in green.

2. Use the trackball to move to an area without tissue but still under the cap. This can be at the side of the tissue, a luminal area, or any other area without cells.

3. Tap the “i” options button in the “Select” tool pane. Tap the “IR Spot Sizes” tab.

4. Click on the desired spot size button. Click OK.

5. Double-click the mouse in the area without tissue to fire a test IR laser shot. This test spot allows you to verify the polymer wetting, spot size and IR laser location.

6. Place the mouse cursor directly in the center of the test spot. Right-click in the center of the spot and select “Located IR laser” (see Note 26).

7. Move to another area free of cells and fire another test IR laser shot. Assess the quality of the spot for the following parameters (Figure 1) (see Note 27):

   1. Clear center
   2. Dark ring around spot
   3. Appropriate spot size for cell type to be microdissected
      Spot adjustments can be made using the options button in the “Select” tool pane. If the spot diameter is larger than desired, reduce the power and/or duration. If the spot diameter is too small, increase the power and/or duration (see Note 28). Fire additional test spots until the desired spot is achieved (see Note 29).

8. Measure the diameter of the test spot. Click on the ruler icon in the “Select” tool pane. Using the mouse or stylus, click and drag from one inner edge of the spot to the opposite inner edge. A line and label will be displayed showing the diameter of the spot. Click on the Move Stage (hand) icon to deactivate the ruler tool.

9. Tap the “i” options button in the “Select” tool pane to edit the spot diameter, laser power/duration, and IR laser location.

10. Tap the “IR Spot Sizes” tab. Enter the measured spot diameter for the selected spot size. Click OK.

3.3.4. Mark the cells for microdissection

1. Locate the cells of interest using the trackball, mouse, or stylus to move the stage to the desired location.

2. Click on any tool in the “Select” tool pane. The pencil icon is for freehand drawing. Freehand drawing objects must be a closed figure, i.e. the ends of the drawing must touch to enclose the desired area. The Defined circle tool allows the selection of defined areas of known diameter. The Single IR spot tool is for single cell or single spot microdissection. The IR Spot Line tool permits microdissection of a line, either straight or curved. A drawing tool is active if the icon is gray. Deactivate each drawing tool by clicking again on the icon.

3. Using the stylus or mouse, mark cells on the live image that are to be microdissected.

4. Each drawing object is numbered and appears in the Drawing Items list, located to the right of the Capture Groups List (Figure 1-2).

5. Selected areas may be deleted or erased if they were erroneously selected. Right-click on the area to be deleted and select “delete” or use the eraser icon to delete partial areas. Alternatively, the drawing object may be deleted by right clicking on the item in the Drawing Items List and selecting “Delete Object”. Selected areas may also be copied and pasted to another location or dragged as needed to duplicate or correct the drawing item placement.

6. Different cell types can be marked for microdissection and separated out by utilizing Capture Groups. This feature allows cells to be marked from one image but microdissected separately. A Capture Group is a group of drawing items that will be microdissected during one microdissection session, on one cap (see Note 30).

   1. Prior to marking cells for microdissection, click on the desired Capture Group (A, B, C, D) in the “Select” tool pane.
   2. Mark the desired cell population for microdissection.
   3. Select a new Capture Group. Mark the second desired cell population for microdissection.
   4. Tap the “i” options button in the “Select” tool pane and click on Capture Group. Click the desired group and enter the attributes for that group (name, IR spot color, UV cut color). Click OK.

7. To view the area of microdissection or the number of laser spots in each area, tap the “i” options button in the “Select” pane. Click on the “Drawing Items” tab to determine the area microdissected (μm²) or number of laser spots (see Note 31).

3.3.5. Capturing the cells

1. Tap the Capture Group to be microdissected if capture groups were assigned.

2. Click on the IR capture icon in the “Microdissect” tool pane.

3. If necessary, move the cap to new areas of the tissue/slide to microdissect additional cells (of the same cell type) that were not included under the original cap diameter. To move the cap, use the trackball, mouse or stylus to move the stage to the new location. Right click on the slide overview image and select “Place cap at region center”.

4. Fire a test IR pulse in an area lacking cells to check the laser spot morphology (see section 3.3.5 steps 4-8). Adjust the power and/or duration as needed to achieve the desired spot size and quality.

5. Click on the IR capture icon in the “Microdissect” tool pane.

3.3.6. Unload the samples and microdissected tissue

1. After the desired number of cells, or a capture group, has been collected on a cap, move the cap to the QC station. Click on the “Move Cap to QC” icon in the “Microdissect” tool pane. The cap will be moved to the QC position on the stage. The stage will be aligned so the QC station holding the cap is in the optical path of the microscope. The cap image will be displayed in the live image window.

2. Inspect the tissue on the cap for efficiency of microdissection. Adjust the magnification (maximum of 20× in the QC station), focus and brightness.

   1. Observe the cap for microdissection of the desired cells and for debris and/or adhesion of non-specific tissue to the polymer surface.
   2. Estimate the percentage efficiency of microdissection by observing the polymer for cellular material within the diameter of the melted laser spot. Efficiency of microdissection is a critical factor for estimating the number of cells procured by LCM.
   3. Debris or non-specific tissue adhering to the cap may be removed by gently blotting the polymer surface with the tacky side of an adhesive note. Do not use “super sticky” style adhesive notes.

3. The cap can either be removed for storage/cell lysis or placed back on the slide to continue microdissection. To place the cap back on the slide, right click on the appropriate cap icon in the “QC Caps” pane (to the right of the slide overview) (Figure 2), and select “Replace Cap on Slide”.

4. If no further microdissection is to be performed with the cap, remove the cap from the stage by carefully lifting the cap straight up from the QC position. Place the cap in a labeled microcentrifuge tube, label the outer edge of the cap, and place the cap/tube assembly in dry ice or at −80°C (for protein/RNA analysis) or at room temperature (for DNA analysis).

5. After all dissections are completed, remove all slides and caps from the stage. Click “Present Stage” for access to the slides and caps.

6. Close the Arcturus^XT software.

7. Turn-off the Arcturus^XT instrument.

8. Turn off the PC and the monitor.

3.4. UV Cutting Mode Microdissection Using the Arcturus^XT

By default, the instrument will perform IR capture first followed by UV cutting. Depending on the type of slide loaded in the instrument, details of the UV cutting vary (36). In UV cutting mode, glass slides will have a moat cut around the region of interest. For PEN membrane and PET frame slides, the instrument cuts around the region of interest, leaving tabs, or sections of uncut tissue. Tabs prevent the tissue from curling-up or detaching from the surface of the membrane slide. Initial slide preparation and instrument set-up are similar to the IR capture mode (sections 3.3.1. to 3.3.3. #2).

3.4.1. UV Laser Location

1. To locate the UV laser for each objective, tap the “i” options button in the “Microdissection” tool pane. Select the “UV Locate” tab. Follow the steps in the dialog box.

   1. Tap the locate UV button. The UV laser will be fired.
   2. From the live image, tap the location of the UV laser spot (designated by a circle) then tap the OK button in the dialog box next to the UV button.
   3. If the UV laser is not visible, tap “Push On” to manually turn on the UV cutting laser.
   4. Click OK to close the dialog box.

2. Click OK.

3.4.2. Mark the cells for UV cutting

1. Locate the cells of interest using the trackball, mouse, or stylus to move the stage to the desired location.

2. Click on the freehand drawing tool, or the circle tool, in the “Select” tool pane.

3. Using the stylus or mouse, mark the cells on the live image that are to be cut or ablated with the UV laser. Assign capture groups if desired (see section 3.3.4. #6).

4. To determine the area (μm²) of tissue to be microdissected tap the “i” options button in the “Select” pane. Click on the “Drawing Items” tab to view the microdissection area (μm²).

3.4.3. Setting cut and capture properties

1. Tap the “i” options button in the “Microdissect” tool pane. Select the “Select Settings” tab.

2. Tap “IRSpotSpacing” and enter a value of 100%. This allows the spots to touch but not overlap.

3. Tap “UV Settings” and enter values for the following settings. Values will depend on the area to be cut. Smaller areas require fewer tabs and fewer IR spots compared to larger areas.

   1. IR SpotsPerCutLength – number of IR spots per cut length
   2. Tab Length – distance (microns) between each UV cut
   3. UV CutLength – length of UV cut before a tab
   4. UV CuttingSpeed – speed of the UV laser. Increase the speed to cut more quickly. Alternatively, the UV laser cutting speed can be adjusted using the slide bar in the “Microdissect” tool pane, allowing adjustment in real time during UV cutting if necessary.

3.4.4. Cutting the cells

1. Tap the Capture Group to be microdissected if capture groups were assigned.

2. Click on either the UV cut and capture or UV cut icon in the “Microdissect” tool pane.

3. Move the cap to the QC area and unload caps/slides.

3.4.5. UV Cutting Mode Microdissection for NanoString analysis using the mmi CellCut Plus®

The mmi CellCut Plus® instrument is designed to dissect sections on PET (polyethylene terephthalate) metal framed slides. A plain glass histological slide is used as a cover for the tissue section and a support for the membrane during microdissection. This two-slide ‘sandwich’ is inserted in the slide holder of the microscope dissection stage. Dissections are software navigated. Microdissected tissue is collected with the inert adhesive lid on the collection tube. Cell lysis is performed by adding lysis buffer to the collection tube, closing the lid and placing the tube upside down (see Note 32). A slide can be scanned, and the scan used as a navigation reference during dissection. We recommend setting up the laser and camera configuration on a stained test slide of the tissue of interest prior to microdissecting experimental samples.

3.4.6. mmi CellCut Plus® instrument set-up

1. Turn on PC and wait for Windows to boot.

2. Turn on the microscope power supply and the laser key.

3. Start the mmi CellTools® software, allow it to load fully, and press laser button on the control box.

4. Load a glass support slide on the microscope dissection stage (see Note 33).

5. Load a test membrane slide on the glass slide (slide window facing up) and make sure that the slide ‘sandwich’ is clipped tightly in the holder.

6. Select the 4x-objective on the instrument and in the software tool panel.

7. Set-up slide limits in the software tool panel.

8. Define the scanning area and press scan button in the overview section of the tool panel for a reference slide view.

3.4.7. Laser set-up

1. On the reference scan of the LCM slide, move the red square to the clear membrane area.

2. Set a 10x-objective on the instrument and in the software tool panel, and disable ‘AutoShape’ function.

3. Bring membrane in focus, press on a drawing tool button and draw a long line across the dissecting screen.

4. Set laser speed at 10%, and laser power at 80%.

5. Press the Cut button in the tool panel and adjust the focus slider in a continuous slow motion to observe a cut line. Stop the focus slider when the optimal cut line appears.

6. Repeat step 5 with the speed of choice for serial dissections.

7. With the Laser Position button, set the laser position to match the cut line to the drawing.

8. On the reference scan of the LCM slide, move a red square to the target area and bring it in focus.

9. In groups 1, 2, and 3, mark one target per group with the drawing tool.

10. Cut the target in each group with decreasing laser power (group 1--80%, group 2--70%. Group 3--60%).

11. Load the collection tube in the tube holder and attach the tube holder to the cap lift (the cap is in up position by default).

12. With the Cap Lift button, set the cap on the slide over the dissected target.

13. Observe the target image on the dissecting screen for color and brightness. If the image is discolored, use a Camera Configuration dialog box to set white balance (WB) and adjust brightness.

14. Lift the cap and observe target for a complete pick-up.

15. Repeat step 12 and 14 for each of the dissected targets.

16. The speed and focus of choice (from step 6), and the lowest power providing a complete target pick up (from step 12, 14 and 15) will be the parameters of choice for serial dissections (see Note 34).

3.4.8. Dissection of serial slides and target collection

The dissection and collection approach described below allows acquisition of an LCM sample for tissues such as mouse skin and skin papilloma that contain abundant collagen and have sub-optimal adherence of the tissue sections to the PET membrane slide. A low volume of lysis buffer is combined with multiple dissections from serial tissue sections to provide adequate material for downstream analysis. The method is applicable to target areas larger than 200 μm (see Note 35).

1. Remove the cap holder from the cap lift and remove the test slide from the dissection stage together with the glass slide.

2. Set the 4x-objective on the instrument and in the software tool panel.

3. Load an RNAse-free glass support slide (see Note 36) on the microscope dissection stage, and insert the first serial slide.

4. Define the scanning area and press scan button in the overview section of the tool panel for a reference slide view.

5. Set the 10x-objective on the instrument and in the software tool panel.

6. Check the laser position.

7. Load the collection tube in the tube holder and attach the tube holder to the cap lift.

8. Disable ‘Collect with Cap Up’ function and select ‘Auto New Cap’ (see Note 37).

9. With the cap in ‘up’ position navigate to the first section on the review scan and draw the target on the dissecting screen.

10. Press the Cut button, then collect the dmicrodissected tissue by putting the cap in the ‘down’ and then ‘up’ position.

11. Navigate to the next section on the review scan, and draw and cut the target (see Note 38).

12. Repeat step 11 until all the dissected targets from the slide are collected on the cap (see Note 39) (Figure 5).

13. Remove the cap holder from the cap lift and carefully transfer the collection tube under a dissecting microscope set on 1x- magnification.

14. Dispense 3 μL of 100% ethanol on the bottom of 200μL PCR tube. With fine tip forceps, detach the microdissected tissue from the lid and transfer them into the PCR tube by touching the tissue piece to the ethanol (see Note 40).

15. Spin the tube at 16,000 rpm for 15 seconds to collect microdissected cells on the tube bottom.

16. Place the tube in the desiccator until the next serial slide will be dissected (see Note 41).

17. Remove the dissected slide from the slide holder leaving the glass slide on the stage (see Note 42), and set a 4x-objective on the instrument and in the software tool panel. Insert the next serial slide.

18. Continue with the dissections following steps 4-7 and 9-18.

19. Upon sample completion, open the lid of PCR tube with microdissected tissue and place it in a desiccator for 15 minutes to evaporate the ethanol. Close the lid and place the tube with dry microdissected tissue/cells in 15 mL Falcon tube with a dessicant pouch. Store at −20°C before lysis.

Figure 5. LCM target dissection and collection for NanoString analysis with ‘Auto New Cap’ set-up (Aperio 4x magnification).

A. View of the PET membrane after collection of the first serial target. B. mmi IsolationCap® with the first collected target (a) positioned over the second target (b) with laser cutting path (open line). C. mmi IsolationCap® with the first (a) and second (b) collected targets is positioned over the third (c) target with laser cutting path (open line). D. View of mmi IsolationCap® with the first (a), the second (b) and the third (c) overlapped targets.

3.5.Lysis and Protein Extraction of Microdissected Material for Downstream Analysis

The LCM cap, containing microdissected cells for protein analysis, can be stored at −80°C for extraction at a later date (see Note 43). Extraction of proteins from microdissected cells should be performed just prior to the downstream analysis to prevent aggregation of proteins, degradation of proteins, or binding of protein to the walls of the microcentrifuge tube during prolonged storage. Microdissected samples for western blotting and/or reverse phase protein array analysis, can be prepared with the following denaturing cell lysis/protein extraction buffer:

1. Protein extraction buffer: 450 μL T-PER Tissue Protein extraction reagent, 450μL Novex® Tris-glycine 2X SDS loading buffer, and 100μL TCEP Bond Breaker®. The final extraction buffer is a 10% (v/v) solution of TECP in T-PER/Tris-glycine 2x SDS buffer (see Note 44).

2. Thaw each LCM cap at room temperature and remove all traces of condensation from the edges and rim of the cap. Place the CapSure® cap containing microdissected cells on a flat-clean surface, film side up. Using a pipette, dispense the desired quantity of extraction buffer directly on the cap film and incubate for 1 min. The maximum volume of extraction buffer that can be used to cover the surface of a CapSure® cap is 15 μL.

3. Pipette the extraction buffer up and down on the surface of the cap to solubilize the cells. Be careful not to scrape the cap polymer.

4. Collect the extraction buffer containing the solubilized cells in a 0.5mL microcentrifuge tube. If more than one CapSure® cap was used to microdissect the cells of interest, solubilized cells from these caps can be collected in the same microcentrifuge tube.

5. Denature the proteins by heating the closed microcentrifuge tube at 100°C for 5-8 minutes prior to downstream proteomic analysis.

6. Briefly spin the microcentrifuge tubes at 14,000rpm to pellet any condensation in the tube. Store the samples at −80°C.

3.5.1. Lysis of Microdissected Material for NanoString Analysis

1. Transfer tubes from −20°C storage to a +4°C refrigerator for 30 minutes.

2. Prepare lysis buffer (see section 2.5.) adding one extra reaction to the mix (see Note 45).

3. Centrifuge the tube at 16,000 rpm for 30 seconds to collect the microdissected tissue on the bottom of the tube.

4. Add 7.5 μL of lysis buffer to each tube, vortex vigorously for 15 seconds and centrifuge at 16,000 rpm for 30 seconds.

5. Make sure that all the microdissected tissue is covered with buffer and not stuck to each other.

6. Seal the lid of the tube with Parafilm and place the tube in a metal dry heat block. Incubate at 56 °C for 68 hours.

7. Transfer the block with tubes to an oven preheated at +80°C, and incubate for 15 minutes.

8. Vortex the tube vigorously for 30 seconds and centrifuge at 16,000 rpm for 30 seconds.

9. Cut off the tip of the RNAse-free long-tip 20μL barrier tip, leaving a 3 mm stump, and insert it in the labeled PCR tube as a filter for the lysate.

10. Pipette in the lysate and transfer it to the filter by touching the barrier with the pipette tip.

11. Gather microdissected tissue in a lump with the pipette tip and transfer them to the bottom of the filter (see Note 46).

12. Centrifuge the filter-tube assembly at 16,000 rpm for 30 seconds, discard the filter and store the sample in −80°C prior to NanoString analysis.

3.6. Adaptation of LCM workflow for NanoString platform requirements

Considering that a large amount of dissected material for one sample should be collected in a timely manner we found it advantageous to use an automated microtome for serial sectioning, a modified target collection approach, and the use of an Aperio slide scanner to facilitate the LCM sample collection process (see Note 47).

3.6.1. Aperio digital image of H&E sections

The Aperio ScanScope®XT instrument allows scanning of the whole slide area at 20x and 40x magnification (we use 20x scanning mode for LCM projects). The resulting digital image, annotated by the pathologist, serves as a reference during target annotation on the dissecting screen of mmi CellCut instrument (Figure 6). A digital image can be accessed through the database and viewed from any computer (we use a wall mounted monitor to display a digital image during LCM). The magnification of the digital image can be matched to the magnification of the LCM objective of choice. The rotation tool allows placing the Aperio reference image into the same orientation as an mmi CellCut® reference view of the membrane slide before laser dissection.

1. During serial sectioning, mount each 10^th section on a positively charged (plus) glass slide for an H&E stain and label slides sequentially.

2. Scan H&E slides in Aperio ScanScope®XT, review digital images for scanning quality, and assign them to the study folder for annotation by the pathologist.

3. Create a list of samples with Aperio image IDs for prompt image retrieval from the Spectrum™ database during LCM. With the search function of the ImageScope™ digital slide viewer, locate the image in the database.

4. When stained slides are drying in a desiccator, retrieve the first annotated image to the display monitor (Figure 7A).

5. Insert a test slide in the holder of the dissection stage, create a reference view of an LCM slide and compare the target image on the dissecting screen (Figure 7A, B) with the Aperio image on the display monitor.

6. With the rotation tool, rotate the annotated image (if required) for the same orientation as the LCM target image (Figure 7B, C).

7. With the zoom slider, match the Aperio image magnification to the magnification of LCM objective (Figure 7B, D), substitute the test slide with the first serial slide, and proceed to LCM.

Figure 6. Mouse skin papilloma dissection based on pathology annotation of Aperio digital image of the reference H&E slide.

A. Digital image of H&E reference slide with pathology annotation (black line) (Aperio 4x magnification). B. View of LCM target on the dissecting screen with the reflected drawing of pathology annotation (white line) (mmi CellCut® objective 4x, mmi IsolationCap® is in ‘down’ position). C. View of the PET membrane after target collection (mmi CellCut® objective 4x, mmi IsolationCap® is in a down position).

Figure 7. Digital image manipulation with ImageScope™ digital slide view prior to LCM session.

A. Digital image of annotated H&E section in ImageScope™ Main Window (Aperio 0.4x magnification) (a) zoom slider (b) slide label window (c) rotation tool (d) thumbnail window (e) magnifier window with LCM target. B. Orientation of LCM target (dissected) on LCM dissecting screen (mmi CellCut® objective 4x, mmi IsolationCap® is in ‘up’ position). C. Rotated digital image matches the orientation of LCM section on dissecting screen during laser cutting. D. Enlarged H&E image of the target (Aperio 4x magnification) matches the magnification of LCM target on dissecting screen.

3.6.2. Pilot studies: Amount of microdissected material for NanoString input

We conduct pilot studies in order to determine a lysis procedure suitable for NanoString sample requirements, and to estimate the number of LCM slides per sample. The pilot experiment is recommended for each tissue type/project to ensure adequate cell number and RNA yield/

1. Use ALL Prep RNA/DNA extraction kit (Qiagen) for RNA extraction from pilot samples.

2. Calculate the area of each annotated target by Aperio ImageScope™ software, based on annotated H&E image.

3. Microdissect areas of various size containing the cells of interest and extract the RNA from microdissected samples. Example microdissected areas are: 2.7 mm², 3.3 mm², 6 mm², 12 mm², 12 mm², 24 mm². Calculate an average RNA yield (ng) for one mm² of target tissue (see Note 48).

4. Calculte the Total Collected Area (mm²) for NanoString input by the formula: quotient of division of 100 ng of Total RNA by Average RNA Yield (ng/mm²) from step 4 (see Note 49).

5. Calculate the Total Number of Sections (per sample) by the formula: quotient of division of Total Collected Area (mm²) by Annotated Target Area (mm²).

6. Calculate the Number of Slides (per sample) by the formula: quotient of division of Total Number of Sections by Number of Mounted Sections (per slide).

3.6.3. Optimize LCM sample lysis

We recommend preparing a test block to optimize cell lysis conditions. We used twenty five dissectates (3 mm²), corresponding by area to the largest target across a sample-set, were incubated for 72 h in 5 μL of buffer RLT (see Note 50), and the final lysate volume was measured. On average, 2 μL of lysis buffer were lost during lysis procedure. Increasing the initial lysis volume to 7 μL resulted in 3.5-5 μL of lysate for NanoString input (see Note 51).

3.7. NanoString analysis of LCM samples

An example application of NanoString analysis with LCM samples is described below using microdissected skin papillomas from C57BL/6 mice. Skin papillomas were generated in C57BL/6 mice using a skin painting protocol (34). Briefly, 400 nmoles of DMBA (9, 10-Dimethyl-1,2-Benzanthracene) in 200 μL of acetone were applied to the skin, and ten days later, 40 nmoles of TPA (12-O tetradecanocylphorbol-13 acetate) in 200 μL of acetone were applied twice weekly for a total of 20 weeks. Developed papillomas were fixed in 10% neutral buffered formalin for 24 hours and paraffin embedded.

1. Laser microdissected papillomas are used to prepare total RNA lysates for NanoString analysis. Twenty genes involved in inflammation and five housekeeping genes, used as an internal control (Table 1), are selected for a custom NanoString probe set (Reporter Code set and Capture Probe set).

2. The nCounter™ Gene Expression Assay is performed using two specific probes (capture and reporter) for each gene of interest. 5 μL of LCM lysate from each laser dissected papilloma is hybridized with the designed Reporter CodeSet and Capture ProbeSet (according to the manufacturer’s instructions (NanoString Technologies, Seattle-USA), for direct labeling of mRNAs of interest with molecular barcodes, without the use of reverse transcription or amplification.

3. The hybridized samples are recovered with the NanoString Prep Station and the mRNA molecules counted with the NanoString nCounter™.

4. The resulting counts are corrected by subtracting the average value of the negative control (alien probes from the CodeSet, lacking spiked transcript) from the raw counts obtained for each RNA. Values less than zero are considered equal to 1.

5. The corrected raw data are finally normalized using values for the housekeeping genes.

Table 1. The targeted region and corresponding sequence of interleukin genes selected for NanoString Reporter Code and Capture Probe set.

(RPl9, RPl30, RPl9, GAPDH, and HPRT were used as housekeeping genes).

Gene	Accession	Targeted Region	Target Sequence
Il10	NM_010548.1	985-1085	GGGCCCTTTGCTATGGTGTCCTTTCAATTGCTCTCATCCCTGAGTTCAGAGCTCCTAAGAGAGTTGTGAAGAAACTCATGGGTCTTGGGAAGAGAAACCA
Il11	NM_008350.2	285-385	GCGCTGGGACATTGGGATCTTTGCAGCTTCCTGGTGTGCTGACAAGGCTTCGAGTAGACTTGATGTCCTACCTCCGGCATGTACAATGGCTGCGCCGTGC
Il12a	NM_008351.1	355-455	TCATGAAGACATCACACGGGACCAAACCAGCACATTGAAGACCTGTTTACCACTGGAACTACACAAGAACGAGAGTTGCCTGGCTACTAGAGAGACTTCT
Il12b	NM_008352.1	1045-1145	TCGTAGAGAAGACATCTACCGAAGTCCAATGCAAAGGCGGGAATGTCTGCGTGCAAGCTCAGGATCGCTATTACAATTCCTCGTGCAGCAAGTGGGCATG
Il13	NM_008355.2	425-525	AGCTACACAAAGCAACTGTTTCGCCACGGCCCCTTCTAATGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTTCTCACATCAGAC
Il15	NM_008357.1	205-305	GTGTTTGGAAGGCTGAGTTCCACATCTAACAGCTCAGAGAGGTCAGGAAAGAATCCACCTTGACACATGGCCCTCTGGCTCTTCAAAGCACTGCCTCTTC
Il17a	NM_010552.3	205-305	ACCTCAAAGTCTTTAACTCCCTTGGCGCAAAAGTGAGCTCCAGAAGGCCCTCAGACTACCTCAACCGTTCCACGTCACCCTGGACTCTCCACCGCAATGA
il17e	NM_080729.2	649-749	TTGGGGAGAAACTCTGACTTTTGCACTTTTTGGAAGCACTTTTGGGAAGGAGCAGGTTCCGCTTGTGCTGCTAGAGGATGCTGTTGTGGCATTTCTACTC
Il18	NM_008360.1	270-370	ACTTTGGCCGACTTCACTGTACAACCGCAGTAATACGGAATATAAATGACCAAGTTCTCTTCGTTGACAAAAGACAGCCTGTGTTCGAGGATATGACTGA
Il18bp	NM_010531.1	585-685	TTTGTTTGTGGATCCTGGACAAGTGGCCCAGTATCACATCATTCTGGCCCAGCTCTGGGATGGGTTGAAGACAGCTCCGTCCCCTTCTCAAGAAACCCTC
Il1a	NM_010554.4	225-325	ACCTCTGAAACGTCAAAGATGTCCAACTTCACCTTCAAGGAGAGCCGGGTGACAGTATCAGCAACGTCAAGCAACGGGAAGATTCTGAAGAAGAGACGGC
Il1b	NM_008361.3 NM_00102560	1120-1220	GTTGATTCAAGGGGACATTAGGCAGCACTCTCTAGAACAGAACCTAGCTGTCAACGTGTGGGGGATGAATTGGTCATAGCCCGCACTGAGGTCTTTCATT
Il1rl1	2.2	815-915	ATAGGAAAACCAGCAAGTATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTCTTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAA
Il1rn	NM_031167.5	224-324	CAACCAGCTCATTGCTGGGTACTTACAAGGACCAAATATCAAACTAGAAGAAAAGATAGACATGGTGCCTATTGACCTTCATAGTGTGTTCTTGGGCATC
Il21	NM_021782.2	1762-1862	ATGGCCTGGGGGATGGTTTTGATCTAAGGAAAAAGGTGTCTGTACCTCACAGTGCCTTTAAAACAAGCAGAGATCCCGTGTACCGCCCTAAGATAGCACA
Il22	NM_016971.1	477-577	AGAAGAATGTCAGAAGGCTGAAGGAGACAGTGAAAAAGCTTGGAGAGAGTGGAGAGATCAAGGCGATTGGGGAACTGGACCTGCTGTTTATGTCTCTGAG
Il23a	NM_031252.1	360-460	CAAGGACAACAGCCAGTTCTGCTTGCAAAGGATCCGCCAAGGTCTGGCTTTTTATAAGCACCTGCTTGACTCTGACATCTTCAAAGGGGAGCCTGCTCTA
Il27 ebi3	NM_015766.2	1015-1115	ATGTACTGGGCTGCTCCGAAGCACTGGATAATTCACTTGACTTCTTCAGACCTCAATTTCCAACCCTGTGGGATGATCTTTCTTCTTCTGCCGGTGCGGG
Il27p28	NM_145636.1	175-275	GCTATGTCCACAGCTTTGCTGAATCTCGATTGCCAGGAGTGAACCTGGACCTCCTGCCCCTGGGATACCATCTTCCCAATGTTTCCCTGACTTTCCAGGC
il33	NM_133775.1	1011-1111	ATGACTTACGGCGTTGGTAAAGAAACTGAAGGAGATTCAGCCTTGCTCTTTCCTTTTCTCTGCCTTGAGTCCTGTATGAAATCACACTCACGGACTTCAG
Il4	NM_021283.1	345-445	TGCTTGAAGAAGAACTCTAGTGTTCTCATGGAGCTGCAGAGACTCTTTCGGGCTTTTCGATGCCTGGATTCATCGATAAGCTGCACCATGAATGAGTCCA
Il6	NM_031168.1	40-140	CTCTCTGCAAGAGACTTCCATCCAGTTGCCTTCTTGGGACTGATGCTGGTGACAACCACGGCCTTCCCTACTTCACAAGTCCGGAGAGGAGACTTCACAG
Rpl27	NM_011289.3	2-102	GCTGCTCGTGCTGCTAATAAAGCTTGGTTCAAAAACGCAGTGCCCGACCCTCCCTGACGAGCTCCTTCCGCCAACAACTTTGACCACCAACCGTGGGGCA
Rpl30	NM_009083.4	14-114	CCCCGGCCATCTTGGCGGCTGGTGTTGGTGAGTGAGCTCTGCGGGGTAAACGATTAGGCGGCTCGGGGAGCTCCGCTAGCTGGTGTTTGACGCTCTGGAT
Rpl9	NM_011292.2 NM_00100130	240-340	GGTAACAGAAAGGAACTGGCCACCGTCAGGACCATCTGCAGTCATGTTCAGAACATGATCAAGGGTGTCACGCTGGGCTTCCGATACAAGATGCGGTCTG
Gapdh	3.1	890-990	AGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTG
Hprt	NM_013556.2	30-130	TGCTGAGGCGGCGAGGGAGAGCGTTGGGCTTACCTCACTGCTTTCCGGAGCGGTAGCACCTCCTCCGCCGGCTTCCTCCTCAGACCGCTTTTTGCCGCGA

3.7.1. Assay validity and sample quality assessment

The quality control of the NanoString analysis platform is based on the value of FOV (fields of view per sample) counted, a binding density, seven negative and six positive controls per sample, and presence or absence of messages under ‘Lane Attributes’ as displayed by the NanoString nCounter™. A sensitivity level of 600 FOV counts was used for the papilloma analysis (Table 2).

1. For the analysis to be qualified as ‘successful’, the FOV counted (corresponding to the counted number of reporters and showing the level of sensitivity in the system) should be close to 600 across the samples set (twelve samples).

2. The values for Binding Density (a measure of sample saturation) should be between 0.05 and 2.25 across the sample set. Positive control values should show linearity with corresponding dilutions in a descending order, and the first (largest) values should be close across a sample set.

3. The negative control values should be low and comparable across the sample set in a range from 0 to10. There should be no messages displayed in the ‘Lane Attributes’. An example from our papilloma data set that satisfied all quality control conditions of the NanoString analysis platform is shown in Table 2.

4. The results are analyzed using the least variable gene (GAPDH) for normalization. Alternatively, the average of the three least variable genes (GAPDH, RPl9 and RPl30) may be used for comparison. The calculations for the background subtraction, correction factor and normalization are performed as per standard NanoString analysis protocols (NanoString Technologies, Seattle-USA) (37) (Figure 8).

The mRNA counts pattern, similar using both analytical approaches (least variable gene or 3 least variable genes), demonstrated the suitability of our LCM sample preparation method for NanoString input, and the reliability of NanoString analysis of LCM samples for gene expression profiling. Our LCM procedure for a NanoString sample will suit profiling studies on archival clinical cases stored as FFPE sections mounted on glass slides, providing that sections are transferred from glass slides to PET membrane slides (see Note 51).

Table 2.

NanoString nCounter™ Report for LCM papilloma samples.

File Attributes
File name			20110224
Sample ID			Pap1330	Pap1332	Pap338-1	Pap338-2	Pap339-2
Owner
Sample Date			2/24/2011	2/24/2011	2/24/2011	2/24/2011	2/24/2011
File Version			1.6	1.6	1.6	1.6	1.6
GeneRLF
Comments
Lane Attributes
Lane ID			1	2	3	4	5
FOV Count			600	600	600	600	600
FOV Counted			600	600	598	600	597
Scanner ID			DA36	DA36	DA36	DA36	DA36
StagePosition			2	2	2	2	2
Binding Density			0.15	0.16	0.23	0.17	0.2
Messages
Reporter Counts
Code Class	Name	Accession
Positive	POS_A(128)	ERCC_00117.1	6196	6755	6607	7530	7786
Positive	POS_B(32)	ERCC_00112.1	1619	1897	1787	1980	2029
Positive	POS_C(8)	ERCC_00002.1	331	460	370	420	444
Positive	POS_D(2)	ERCC_00092.1	109	136	97	143	135
Positive	POS_E(0.5)	ERCC_00035.1	16	27	25	28	20
Positive	POS_F(0.125)	ERCC_00034.1	10	15	18	20	18
Negative	NEG_A(0)	ERCC_00096.1	3	1	1	1	0
Negative	NEG_B(0)	ERCC_00041.1	2	1	4	1	2
Negative	NEG_C(0)	ERCC_00019.1	3	5	2	1	3
Negative	NEG_D(0)	ERCC_00076.1	2	1	2	0	2
Negative	NEG_E(0)	ERCC_00098.1	2	2	1	0	3
Negative	NEG_F(0)	ERCC_00126.1	2	4	6	4	5
Negative	NEG_G(0)	ERCC_00144.1	0	0	2	2	0
Negative	NEG_H(0)	ERCC_00154.1	4	2	2	0	1

Figure 8. NanoString expression results for selected interleukin genes in murine skin papillomas.

The expression of several interleukins associated with inflammatory response was investigated in murine papillomas developed post DMBA/TPA treatment. The data was normalized using GAPDH as housekeeping gene (A) or using the mean of the three least variable housekeeping genes (GAPDH, RPl30, RPl9) B. The results of each normalization approach are very similar. Each circle corresponds to gene expression in a single mouse. Mean is indicated by a solid line.