Abstract
This study shows for the first time the mechanism of carbapenem resistance of a Klebsiella pneumoniae clinical isolate TJ8 recovered from Tianjin Medical University General Hospital ,China. The modified Hodge test and EDTA synergy test were performed for the screening of carbapenemases and metallo-β-lactamases (MBLs), respectively. Polymerase chain reactions and DNA sequencing confirmed that the strain carried IMP-4 metallo-β-lactamase (MBL) , SHV-11 and TEM-1 β-lactamase.
Class I integron was positive and gave a 3.0-kb PCR amplicon .IMP-4 was located in Class I integron 5’CS. The gene determinants were organized in the order of blaIMP-4-orfII-orfIII.In all, the results show that IMP-4 MBL production caused the TJ8 resistance to carbapenems.
Keywords: Klebsiella pneumoniae, metallo-β-lactamases, integron
INTRODUCTION
Carbapenems are relatively stable agents and commonly used to treat serious infections caused by multi-resistant gram-negative bacilli, especially strains producing high-level of AmpC cephalosporinases or extended-spetrum β-lactamases (ESBLs). However, the occurrence and spread of genes encoding metallo-β-lactamases (MBLs) including IMP, VIM, SPM and GIM have been reported in a variety of clinical isolates of Enterobacteriaceae from 28 countries (24).The metallo-β-lactamases emergence is becoming a therapeutic challenge. The class B enzymes, MBLs are the most clinically threatening carbapenems for their ability to hydrolyse almost all β-lactams except monobactams, and they are not susceptible to therapeutic β-lactams inhibitors such as clavulanate, sulbactam and tazobactam.
The blaIMP-4 gene ,which encodes IMP-4 MBL,was first identified in the late 1990s in Acinetobacter spp. from Hong Kong (2) and Citrobacter youngae from Guangzhou in the People’s Republic of China (PRC) (7), was recognized in Australian Enterobacteriaceae isolates on a road-host-range conjugative plasmid in Sydney, Australia, in 2003 (4) and caused a simultaneous outbreak in Melbourne, Australia (15). In China, there were only three reports on the production of IMP in Klebsiella pneumoniae. An IMP-4-producing K. pneumoniae from Wuhan in 2008 (13) and an IMP-4-producing K. pneumoniae from Shanghai in 2009 (9).
In this study, an ertapenem-resistant K. pneumoniae strain was collected from our hospital and its mechanisms of carbapenem resistance were analyzed. To our knowledge, this is the first report of a clinical isolate of K. pneumoniae producing a MBL in Tianjin district of China. A further study revealed that this K. pneumoniae strain carried integron-borne blaIMP-4.
MATERIALS AND METHODS
Bacterial strains and reagents
In November 2009, a K. pneumoniae strain (TJ8) was isolated from sputum sample from a patient in cadre ward in Tianjin Medical University General Hospital ,China. The strain isolated was identified as K. pneumoniae by using the Vitek2 Compact system (bioMe´rieux, France).
Antimicrobial susceptibility testing
Susceptibility testing was performed by using the Vitek2 Compact system and the disk diffusion method according to the guidelines of the Clinical and Laboratory Standards Institute (3) .
Carbapenemase assays
A modified Hodge test was performed to screen carbapenemase production (3). A suspension of E. coli ATCC 25922, which was adjusted to the turbidity of 0.5 McFarland standard, and inoculated evenly on a Mueller Hinton agar plate. Then, a meropenem disk (10μg) was placed at the center of the plate. Test strains were streaked heavily from the edge of the disk to the periphery of the plate. The presence of a distorted inhibition zone after 16 to 18 hours of incubation at 35ºC interpreted as a positive modified Hodge test. Escherichia coli ATCC 25922 and Klebsiella pnenmoniae producing KPC-2 carbapenemase were used as reference strains.
An EDTA-disk synergy test was used for the screening of metallo-β-lactamase production. The test strain was adjusted to a turbidity of 0.5 McFarland standard and spread on the surface of a MHA plate. A meropenem disk (10μg) and a sterilized blank filter paper disk were placed 15 mm apart from edge to edge on the agar plate. Four μL of EDTA solution (0.5 M) was applied to the blank disk. After 16 to 18 hours of incubation at 35ºC, the presence of an enlarged zone of inhibition was interpreted as EDTA-synergy test positive (10).
Polymerase chain reaction (PCR) amplification and DNA sequence analysis of β-lactamase genes and Class 1 integrons
Escherichia coli ATCC 25922 was used as negative control, the TJ8 isolate was used as test strain. Prepared bacterial DNA of the TJ8 and Escherichia coli ATCC 25922 were used as templates .The primers used to amplify blaCTX-M(5), blaSHV (16), blaTEM (14), blaKPC (13), blaIMP (20), blaVIM(23), blaSME (18) , blaDHA , blaACT (17), Class 1 integrase gene(8) and Class 1 integrons (11) were described previously. The primers used for detecting resistance gene cassettes and associated integrons are listed in Table 1. Reaction mixtures (25uL) contained 2.5uL of 10XEasyTaq Buffer, 0.2mM of dNTPs, 2.5 U of EasyTaq DNA Polymerase, 0.2 uM of each primer, and 2 uL of the bacterial DNA template. The reaction was conducted in a GeneAmp PCR System 9600 thermal cycler (Perkin Elmer Co. USA). PCR was performed under the following conditions: initial denaturation at 94ºC for 5 minutes, 35cycles of 94ºC for 30 seconds, 55ºC for 30 seconds, 72ºC for 1 minute, and a final elongation at 72ºC for 10 minutes. PCR amplification products were purified and sequenced using an ABI PRISM 3730XL sequencer analyzer (ABI Co. USA). Sequences were compared with the GenBank database via the BLAST network service.
Table 1.
Primer | sequence(5′–3′) | PCR product (bp) | Reference |
---|---|---|---|
blaKPC | F: GCTACACCTAGCTCCACCTTC | 920 | 13 |
R:ACAGTGGTTGGTAATCCATGC | |||
blaIMP | F: CTACCGCAGCAGAGTCTTTG | 587 | 20 |
R:AACCAGTTTTGCCTTACCAT | |||
blaVIM | F: AGTGGTGAGTATCCGACAG | 261 | 23 |
R:ATGAAAGTGCGTGGAGAC | |||
blaSME | F: AACGGCTTCATTTTTGTTTAG | 830 | 18 |
R: GCTTCCGCAATAGTTTTATCA | |||
blaCTX-M | F: TTTGCGATGTGCAGTACCAGTAA | 544 | 5 |
R:CGATATCGTTGGTGGTGCCATA | |||
blaSHV | F: TGGTTATGCGTTATATTCGCC | 870 | 16 |
R:GGTTAGGGTTGCCAGTGCT | |||
blaTEM | F: GTATGGATCCTCAACATTTCCGTG | TCG 862 | 14 |
R:ACCAAAGCTTAATCAGTGAGGCA | |||
blaDHA | F: AACTTTCACAGGTGTGCTGGGT | 405 | 17 |
R:CCGTACGCATACTGGCTTTGC | |||
blaACT | F:TCGGTAAAGCCGATGTTGCGC | 302 | 17 |
R:CTTCCACTGCGGCTGCCAGTT | |||
Class 1 | F:CAGTGGACATAAGCCTGTTC | 160 | 8 |
integrase gene | R: CCCGAGGCATAGACTGTA | ||
Class 1 integron | s F: GGCATCCAAGCAGCAAGC | various | 11 |
R: AAGCAGACTTGACCTGA |
RESULTS
Antibiotics susceptibility
MIC method showed reduced susceptibility to imipenem and meropenem with MICs of 2 and 4 μg/ml, and resistance to ertapenem with MIC of 16 μg/ml. The isolate was highly resistant to β-lactams except piperacillin/tazobactam ,quinolones ,aminoglycosides and aztreonam. These results suggest the production of MBL. However, K-B method showed resistance to imipenem and meropenem with zone of 13 and 10 mm. (Table 2).
Table 2.
Antibiotic | Disk diffusion test(mm) | MIC(ug/ml) | Resistance mechanism | Integron |
---|---|---|---|---|
Ertapenem | ND/ND | 4/I | ||
Imipenem | 13/R | 2/S | IMP-4 SHV-11 TEM-1 | IMP-4-orfII-orf III |
Meropenem | 10/R | ND/ND |
S,susceptible; I, intermediate; R, resistant; ND, not determined.
Carbapenemase assays
The isolates was positive for carbapenemase by modified Hodge test (Fig. 1). EDTA-disk synergy test was positive (Fig. 2) which indicated the isolate probably produced metallo-β-lactamase.
PCRs and DNA sequence analysis
PCR amplification from DNA preparations of TJ8 yielded corresponding products for int1, blaIMP, blaSHV, blaTEM, but not for blaCTX-M, blaKPC, blaSME , blaVIM , blaDHA or blaACT. (Figure 3 showed an amplified product of blaIMP).Sequencing of the amplified products revealed the presence of blaIMP-4, blaSHV-11 and blaTEM-1. The Class 1 integron was detected by overlapping PCR techniques. K. pneumoniae strain TJ8 gave a 3.0-kb PCR amplicon for class 1 integron that contained blaIMP-4. The gene determinants were organized in the order of blaIMP-4-orfII-orfIII.
DISCUSSION
IMP-type MBLs were most frequently detected among gram-negative nonfermenters. IMP-producing Enterobacteriaceae were mainly reported from Japan, Australia, and Taiwan region of China. Production of IMP in Enterobacteriaceae was rare in mainland China. Moreover, MBL genes are usually found as gene cassettes in integrons, mostly in class 1 integrons (21). Integrons are not self-transferred elements, but they can capture and carry genes, particularly antibiotic-resistance genes, by site-specific recombination(1, 6, 22). Therefore, the metallo-β-lactamases emergence is becoming dangerous. Five classes of integron are known to play a role in the dissemination of antibiotic resistance, and class 1 integrons are the most extensively studied(12). Typical class 1 integrons contain two conserved segments (CSs), the 5’- CS and 3’-CS. The 5’-CS includes the intI1 gene encoding integrase, the attI site for addition of the inserted gene cassette and a promoter(s). The 3’-CS is composed of the qacED1 and sul1 genes, which are responsible for resistance to quaternary ammonium compounds and sulphonamides, respectively. In this study, we detected blaIMP-4and class 1 integrons in a clinical isolate of ertapenem-resistant K. pneumoniae strain. In addition, further studies revealed a variable region of class 1 integron where blaIMP-4 gene was inserted.
Similar to results in previous reports (13, 9), the K. pneumoniae isolate in this study showed “susceptible” results to IMP and MEM by using automated instrumentation, and in the mean-time, the strain showed resistant results to IMP and MEM by using K-B method. As is reported by some researchers, automated instrumentation may fail to detect the resistance of carbapenem strains against carbapenem antibiotics. The main cause is that carbapenem strains have clear inoculation effect, which affects the MIC of imipemen.
IMP-4 metallo-β-lactamase producing K. pneumoniae emergence represents a serious diagnostic challenge for microbiology laboratories, as well as challenges for infection control and antimicrobial drug management. IMP might spread without attracting attention. Microbiologists should be aware of suspicious gram-negative bacteria with reduced susceptibility to carbapenems, and examine their carbapenemase activity.
REFERENCES
- 1.Bennett P.M. Integrons and gene cassettes: a genetic construction kit for bacteria. J Antimicrob Chemother. 1999;43(1):1–4. [PubMed] [Google Scholar]
- 2.Chu Y.W.M., Afzal-Shah E.T., Houang M.I., Palepou D.J., Lyon N., Woodford D.M., Livermore IMP-4, a novel metallo-β-lactamase from nosocomial Acinetobacter spp collected in Hong Kong between 1994 and 1998. Antimicrob Agents Chemother. 2001;45(3):710–4. doi: 10.1128/AAC.45.3.710-714.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.CLSI . Wayne, PA: Clinical and Laboratory Standards Institute; 2009. Performance standards for antimicrobial susceptibility testing; 19th informational supplement. CLSI standard M100-S19. [Google Scholar]
- 4.Espedido B., Iredell J., Thomas L., Zelynski A. Wide dissemination of a carbapenemase plasmid among gram-negative bacteria: implications of the variable phenotype. J. Clin. Microbiol. 2005;43(9):4918–9. doi: 10.1128/JCM.43.9.4918-4919.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Edelstein M., Pimkin M., Palagin I., Edelstein I., Stratchounski L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-Lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob Agents Chemother. 2003;47(12):3724–32. doi: 10.1128/AAC.47.12.3724-3732.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hall R.M., Collis C.M. Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol. 1995;15(4):593–600. doi: 10.1111/j.1365-2958.1995.tb02368.x. [DOI] [PubMed] [Google Scholar]
- 7.Hawkey P.M., Xiong J., Ye H., Li H., M’Zali F.H. Occurrence of a new metallo-_-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People’s Republic of China. FEMS Microbiol. Lett. 2001;194(1):53–7. doi: 10.1111/j.1574-6968.2001.tb09445.x. [DOI] [PubMed] [Google Scholar]
- 8.Koeleman J.G., Stoof J., Van Der Bijl M.W., Vandenbroucke-Grauls C.M., Savelkoul P.H. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J Clin Microbiol. 2001;39(1):8–13. doi: 10.1128/JCM.39.1.8-13.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liu Y., Zhang B., Cao Q., Huang W., Shen L., Qin X. Two clinical strains of Klebsiella pneumoniae carrying plasmid-borne blaIMP-4, blaSHV-12, and armA isolated at a Pediatric Center in Shanghai, China. Antimicrob. Agents Chemother. 2009;53(4):1642–4. doi: 10.1128/AAC.01325-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lee K., Chong Y., Shin H.B., Kim Y.A., Yong D., Yum J.H. Modified Hodge and EDTA-disk synergy tests to screen metallo-beta-lactamase-producing strains of Pseudomonas and Acinetobacter. species. Clin Microbiol Infect. 2001;7(2):88–91. doi: 10.1046/j.1469-0691.2001.00204.x. [DOI] [PubMed] [Google Scholar]
- 11.Lévesque C., Piché L., Larose C., Roy P.H. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39(1):185–91. doi: 10.1128/aac.39.1.185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol. 2006;4(8):608–20. doi: 10.1038/nrmicro1462. [DOI] [PubMed] [Google Scholar]
- 13.Mendes R.E., Bell J.M., Tumidge J.D., Yang Q., Yu Y., Sun Z., Jones R.N. Carbapenem-resistant isolates of Klebsiella pneumoniae in China and detection of a conjugative plasmid (blaKPC-2plus qnrB4) and a blaIMP-4 gene. Antimicrob. Agents Chemother. 2008;52(2):798–9. doi: 10.1128/AAC.01185-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Morris D., O′Hare C., Glennon M., Maher M., Corbett-Feeney G., Cormican M. Extended-spectrum beta-lactamases in Ireland, including a novel enzyme, TEM-102. Antimicrob Agents Chemother. 2003;47(8):2572–8. doi: 10.1128/AAC.47.8.2572-2578.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Peleg A.Y., Franklin C., Bell J.M., Spelman D.W. Dissemination of the metallo-_-lactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin. Infect. Dis. 2005;41(11):1549–56. doi: 10.1086/497831. [DOI] [PubMed] [Google Scholar]
- 16.Pai H., Lyu S., Lee J.H., Kim J., Kwon Y., Kim J.W., Choe K.W. Survey of extended-spectrum beta-lactamases in clinical isolates of Escherichia coli and Klebsiella pneumoniae: prevalence of TEM-52 in Korea. J Clin Microbiol. 1999;37(6):1758–63. doi: 10.1128/jcm.37.6.1758-1763.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.P′erez-P′erez F.J., Hanson N.D. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002;40(6):2153–62. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Queenan A.M., Torres-Viera C., Gold H.S., Carmeli Y., Eliopoulos G.M., Moellering R.C., Jr., Quinn J.P., Hindler J., Medeiros A.A., Bush K. SME-type carbapenem-hydrolyzing class A beta-lactamases from geographically diverse Serratia marcescens strains. Antimicrob Agents Chemother. 2000;44(11):3035–9. doi: 10.1128/aac.44.11.3035-3039.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Smith Moland E., Hanson N.D., Herrera V.L., Black J.A., Lockhart T.J., Hossain A., Johnson J.A., Goering R.V., Thomson K.S. Plasmid-mediated carbapenem-hydrolysing beta-lactamase, KPC-2, in Klebsiella pneumoniae isolates. J Antimicrob Chemother. 2003;51(3):711–14. doi: 10.1093/jac/dkg124. [DOI] [PubMed] [Google Scholar]
- 20.Senda K, Arakawa Y., Ichiyama S., Nakashima K., Ito H., Ohsuka S., Shimokata K., Kato N., Ohta M. PCR detection of metallo-beta-lactamase gene(blaIMP) in gram-negative rods resistant to broad-spectrum beta-lactams. J Clin Microbiol. 1996;34(12):2909–13. doi: 10.1128/jcm.34.12.2909-2913.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shibata N., Doi Y., Yamane K., Yagi T., Kurokawa H., Shibayama K., Kato H., Kai K., Arakawa Y. PCR typing of genetic determinants for metallo-b-lactamases and integrases carried by Gram negative bacteria isolated in Japan, with focus on the class 3 integron. J ClinMicrobiol. 2003;41(12):5407–13. doi: 10.1128/JCM.41.12.5407-5413.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Stokes H.W., Hall R.M. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol Microbiol. 1989;3(12):1669–83. doi: 10.1111/j.1365-2958.1989.tb00153.x. [DOI] [PubMed] [Google Scholar]
- 23.Tsakris A., Pournaras S., Woodford N., Palepou M.F., Babini G.S., Douboyas J., Livermore D.M. Outbreak of infections caused by Pseudomonas aeruginosa producing VIM-1 carbapenemase in Greece. J Clin Microbiol. 2000;38(3):1290–2. doi: 10.1128/jcm.38.3.1290-1292.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Walsh T.R., Toleman M.A., Poirel L., Nordmann P. Metallo-b-lactamases: the quiet before the storm? Clin Microbiol Rev. 2005;18(2):306–25. doi: 10.1128/CMR.18.2.306-325.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]