Abstract
Herein we report our examination of the anti-breast cancer activity of a novel synthetic compound, 7-(benzylamino)-1, 3, 4, 8-tetrahydropyrrolo [4, 3, 2-de]quinolin-8(1H)-one (BA-TPQ). This agent is an analog of a naturally-occurring marine compound, and was found to be the most active out of more than 40 related compounds. We investigated the in vitro activity of BA-TPQ on the survival, proliferation, and apoptosis of breast cancer cells using the MTT and BrdUrd assays, and Annexin/Annexin-PI staining and flow cytometry. The in vivo anti-cancer effects of BA-TPQ were evaluated in xenograft models of breast cancer. Finally, the mechanisms of action of the compound were also assessed by cDNA microarrays, RT-PCR and Western blotting. In a dose-dependent manner, BA-TPQ inhibited cell growth and induced apoptosis and cell cycle arrest in human MCF-7 and MDA-MB-468 breast cancer cells in vitro, and showed in vivo efficacy in mice bearing MCF-7 or MDA-MB-468 xenograft tumors. We demonstrated that BA-TPQ modifies the expression of numerous molecules involved in cell cycle progression and apoptosis. Similar changes in protein expression were observed in vitro and in vivo, as determined by examination of cells and excised xenograft tumors. Our preclinical data indicate that BA-TPQ is a potential therapeutic agent for breast cancer that has multiple hormone-, Her2- and p53-independent mechanisms of action, providing a basis for further development of the compound as a novel anticancer agent.
Keywords: Breast cancer, Chemotherapy, Apoptosis, Cell cycle progression
Introduction
Despite efforts made to improve diagnostic capabilities using new instrumentation and biomarkers, breast cancer is still often diagnosed in (or progresses to) advanced, metastatic and drug-resistant stages. While patients who are diagnosed early, and especially those with hormone receptor (and Her2) positive disease, have an excellent prognosis [1, 2], those with metastatic disease or hormone- or triple-negative tumors, have dramatically lower survival rates [2, 3]. These cancers are both intrinsically more difficult to treat due to the fact they have fewer targets, and they have also often developed additional mutations that make them resistant to conventional chemotherapy [4, 5]. There is a need for effective new therapeutic agents for advanced cancers.
Although “rationally-targeted” therapies (e.g. Herceptin, Gleevec) have promise for certain cancers, these agents are effective in only a percentage of patients, and are generally ineffective against recurrent or metastatic tumors due to resistance to the agent acquired during its initial use [6]. Although it runs counter to the focus of recent research, the development of novel, broadly-effective/multi-targeted therapeutic agents can lead to improved anti-tumor efficacy. Moreover, by avoiding the need to combine several agents, the use of a single multi-faceted agent could also lead to a decrease in toxicity and adverse drug interactions for the patient.
Microbe-, plant-, and animal-based natural products are being explored as novel therapeutics or complementary and alternative medicines. These agents frequently lack a single molecular target. For example, genistein has been reported to exert its cancer preventive and therapeutic effects through several mechanisms, including inhibition of tyrosine kinase activity, agonism or antagonism of steroid receptors, inhibition of oncogenes, inhibition of angiogenesis, and anti-oxidant activity [7]. Other natural products have been shown to have a similar range of activities [8-11]. In fact, it may be that these compounds are effective for cancer prevention and therapy precisely because they act via multiple mechanisms of action.
We have been evaluating novel synthetic iminoquinone compounds based upon a natural product scaffold [12]. These compounds have potent cytotoxic activity against a variety of human cancer cell lines, including drug-resistant breast cancer cells [13]. Among the more than 40 analogs that have been synthesized, 7-(benzylamino)-1,3,4,8-tetrahydropyrrolo[4,3,2-de]quinolin-8(1H)-one (BA-TPQ) showed potent in vitro activity against several human cancer cell lines, including the greatest activity against breast cancer cells. The structure of BA-TPQ is given in Fig. 1a. In accord with studies of other natural-product based agents, the iminoquinone analogs exert a variety of anti-cancer activities, including inhibition of topoisomerase II [14], inhibition of cell survival/proliferation [13], inhibition of oncogene expression [15], and inhibition of androgen receptor expression [15]. Because preliminary studies indicated that BA-TPQ was highly effective against breast cancer cells [13, 14], the present study examined the compound’s in vivo anti-breast cancer activity, and further examine the mechanism(s) by which it exerts anti-cancer effects in vitro and in vivo.
Figure 1.
In vitro activity of BA-TPQ. (a) Chemical structure of BA-TPQ. (b) Growth inhibitory activity of BA-TPQ in breast cancer (MCF-7, MCF-7 p53 KD and MDA-MB-468) and “normal” breast epithelial (MCF-10A) cells. Cells were exposed to various concentrations of the compound for 72 h followed by MTT assay. All assays were performed in triplicate. (c) Induction of apoptosis in breast cancer cells. The cells were exposed to various concentrations of the compound for 48 h followed by assessment of apoptosis. All assays were performed in triplicate. (d) Effects of BA-TPQ on cell cycle progression of breast cancer cells. Cells were exposed to various concentrations of the compound for 24 h, followed by determination of cell cycle distribution. All assays were performed in triplicate. * P < 0.05, # P < 0.01
Materials and methods
Test compound
Approximately 300mg of BA-TPQ was synthesized for the experiments reported in this manuscript. The purity of the compound was greater than 99.0%, based on 1H-NMR, 13C-NMR and mass spectral analyses. These spectra were consistent with the structure of BA-TPQ (Fig. 1a). The MS spectra were: 1H NMR (CD3OD) δ 2.94 (t, 2H, J = 7.8 Hz), 3.82 (t, 2H, J = 7.8 Hz), 4.60 (s, 2H), 5.39 (s, 1H), 7.15 (s, 1H) and 7.20–7.40 (m, 5H); 13C NMR (CD3OD) δ 19.5, 44.2, 48.0, 86.4, 120.2, 123.7, 125.7, 127.1, 128.3 (2C), 129.0, 130.0 (2C), 137.2, 155.2, 159.9 and 168.8; MS (ES+) m/z 278 (M+).
Chemicals, plasmids, and reagents
To generate the MCF-7 p53 knockdown (KD) cells, parental MCF-7 cells were transfected with an expression plasmid containing a siRNA directed against p53. To construct the short interfering RNA (siRNA) expression plasmids under the control of the U6 promoter, selected oligonucleotides were cloned into pBabe-U6 at BamHI and XhoI sites for expression of siRNA in vivo. One pair of siRNA oligonucleotides from p53 were synthesized and cloned into pBabe-U6. The target sequence of the oligonucleotides for p53 knockdown (derived from the p53 gene) was 5’-GACTCCAGTGGTAATCTAC.
All chemicals and solvents used were of the highest analytical grade available. Anti-human Bax (N-20), Bcl-2 (100), Cdk2 (M2), Cdk4 (H-22), Cdk6 (C-21), Cyclin D1 (DCS-6), E2F1 (KH95), MDM2 (SMP14), PARP1 (H-250), p21 (C19), and p27 (C19) antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). The anti-human p53 (Ab-6) antibody was from EMD Chemicals, Inc. (Gibbstown, NJ), and the Caspase-3 (9662), Caspase-8 (9746), and Caspase-9 (9502) antibodies were from Cell Signaling Technology, Inc (Danvers, MA).
Cell lines and culture
Human breast cancer and non-malignant epithelial cells were obtained from the American Type Culture Collection (Rockville, MD), and were cultured according to their instructions. The MCF-7 cells positive for the pBabe-U6-p53 vector were selected, and grown in the same media as parental MCF-7 cells, and expression of the vector was maintained with puromycin (0.5 μg/mL; Sigma, St. Louis, MO).
Assays for cell viability, apoptosis, and cell cycle progression
The effects of test compounds on human cancer cell growth, apoptosis and cell cycle progression were determined using MTT, Annexin V-FITC and propidium iodide as previously reported [16]. In brief, 4-5×103 cells per well were exposed to the test compounds (0 to 1.0μM) for 72 hr for MTT assay. To assess apoptosis using the apoptosis detection kit from BioVision (Mountain View, CA), 2-3×105 cells were exposed to the test compound (0, 0.1, 0.5 or 0.75μM) and incubated for 24 hr prior to analysis. Cells that were positive for Annexin V-FITC alone (early apoptosis) and Annexin V-FITC and PI (late apoptosis) were counted. To determine the effects of the compound on the cell cycle, cells (2-3×105/well) were exposed to the test compound (0, 0.1, 0.5 or 0.75μM) and incubated for 24 hr prior to analysis. Cells were then trypsinized, washed with PBS, and fixed in 1.5mL of 95% ethanol at 4°C overnight, followed by incubation with RNAse and staining with propidium iodide (Sigma). The DNA content was determined by flow cytometry.
Human breast cancer xenograft models and animal treatment
The animal protocol was approved by the Institutional Animal Use and Care Committee of the University of Alabama at Birmingham. Female athymic pathogen-free nude mice (nu/nu, 4-6 weeks) were purchased from Frederick Cancer Research and Development Center (Frederick, MD). To establish MCF-7 human breast cancer xenografts, each of the female nude mice was first implanted with a 60-day sc slow release estrogen pellet (SE-121, 1.7mg 17β-estradiol/pellet; Innovative Research of America, Sarasota, FL). The next day, cultured MCF-7 cells were harvested from confluent monolayer cultures, washed twice with serum-free medium, resuspended and injected subcutaneously (s.c.) (5 × 106 cells, total volume 0.2mL) into the left inguinal area of the mice. For the MDA-MB-468 xenograft model, 5 × 106cells (total volume 0.2mL) were injected s.c. into the left inguinal area of the mice. All animals were monitored for activity, physical condition, body weight, and tumor growth. Tumor size was determined by caliper measurement in two perpendicular diameters of the implant every other day. Tumor weight (in g) was calculated by the formula, 1/2a × b2 where “a” is the long diameter and “b” is the short diameter (in cm).
The animals bearing human cancer xenografts were randomly divided into various treatment groups and a control group (7-10 mice/group). The untreated control group received the vehicle only. For the MCF-7 xenograft model, BA-TPQ was dissolved in PEG400:ethanol:saline (57.1: 14.3: 28.6, v/v/v), and was administered by intraperitoneal (i.p.) injection at doses of 5 and 10 mg/kg/d, 3 d/wk for 3 weeks. For the MDA-MB-468 xenograft model, BA-TPQ was administered by i.p. injection at doses of 1 mg/kg/d and 10 mg/kg/d, 5 d/wk for 6 weeks. At the end of the experiments, xenograft tumors were removed and homogenized, and the resultant supernatants were used for Western blotting analysis of several proteins.
Western blot analysis
In the in vitro studies, cells were exposed to various concentrations of BA-TPQ for 24 hr. In vivo tissue homogenates were prepared in RIPA buffer (100mg tumor tissue/1ml RIPA) for immunoblotting analysis as reported previously [16].
Microarrays
Affymetrix GeneChip® Human Gene 1.0 ST (HuGene-1_0-st-v1) arrays were used for comprehensive analysis of genome-wide expression. Each of the 28,869 known genes was represented on the array by approximately 26 probes spread across the full length of the gene. The GeneChip analysis was carried out at by the Gene Expression Shared Facility located in the Heflin Center for Human Genetics at UAB. The quality of each RNA sample was determined by analysis on a 2100 Agilent Bioanalyser prior to RNA labeling. Detailed GeneChip analysis procedures are presented in the Manufacturer’s GeneChip Expression Technical Manual (Affymetrix, Santa Clara, CA). Briefly, 100ng of total RNA from each sample was used to generate double stranded cDNA by linear amplification using random primer linked-T7 primers and reverse transcriptase. Subsequently, biotin-labeled cRNA was synthesized by in vitro transcription (IVT) using the WT-Amplification Reagents for whole transcript labeling (Affymetrix) followed by cRNA fragmentation and preparation of hybridization cocktail. The arrays were hybridized overnight at 45°C, and then washed, stained, and scanned the next day. GeneChip data was extracted, normalized and summarized using the robust multi-average (RMA) method included in the Affymetrix Expression Console.
RNA extraction and RT-PCR
Cells were exposed to 0 or 0.5μM BA-TPQ for 16 hr, then were resuspended in 1mL of Trizol reagent (Carlsbad, CA), passed several times through a pipette to form a homogenous lysate, and incubated at room temperature for 5 min. Chloroform (0.2 ml) was added to each tube, mixed well by shaking vigorously for 15 s, incubated at room temperature for 2-3 min, and centrifuged at 13,000 × g for 10 min at 4°C. The aqueous phase was collected in a fresh tube. Total RNA was precipitated with 500μL of isopropanol, washed with 75% ethanol for 2 min, and resuspended in DEPC-treated water. RNA yields and purity were determined spectrophotometrically by measuring the absorbance of aliquots at 260 and 280 nm. RNA integrity was checked by visualizing the relative intensities of the 28S and 18S rRNA separated by agarose gel electrophoresis in the presence of formaldehyde. RNA was stored at −80°C until cDNA synthesis using the SuperScript RT-PCR kit from Invitrogen. The sequence of the sense (S) and antisense (AS) primers used for RT-PCR are given in Table 1.
Table 1.
Primer sequences used for RT-PCR
| Symbol | Primer Sequences (5’-3’) |
|---|---|
| p53 | F:GCTGCTCAGATAGCGATGG |
| R:GATGGTGGTACAGTCAGAGCC | |
| CDC25A | F:ATACGAGGGAGGCCACATC |
| R:CGATATCTCTATCTCACATACCG | |
| CCNE1 | F:TCTGGATTGGTTAATGGAGGT |
| R:TGGTGCAACTTTGGAGGA | |
| CCNE2 | F:GAAAGAAGAGAATGTCAAGACGAA |
| R:GATAATACAGGTGGCCAACAATTC | |
| CDC7 | F:CAGCAATTGACATGTGGTCTG |
| R:TGCTGGAACTTCTTTGCTACA | |
| ANXA1 | F:AAGTCATCCAAAGGTGGTCC |
| R:GTTTCCTGGAGATATGCTGCT | |
| DUSP1 | F:CGGAATCTGGGTGCAGTTC |
| R:GGACAATTGGCTGAGACGTT | |
| SPBC25 | F:CCTACAAGGATTCCATCAAAGC |
| R:AGTCAGTACTTCCAATTCCTGCTT | |
| CCND1 | F:GCATCTACACCGACAACTCC |
| R:CGGATGATCTGTTTGTTCTCC | |
| RAD50 | F:AAATGGGTCAAATGCAGGTT |
| R:CGAAATTGTGGTTCTCGAAG | |
| TXNIP | F:GTTCGGCTTTGAGCTTCC |
| R:CATCCACCAGATCCACTACTTC | |
| ATR | F:ATCCCTTCAGATTTCCCTTG |
| R:TTGACAGTCCTTGAAAGTACGG | |
| RSL1 | F:TTAGGGAAACTGACAGCACAG |
| R:AATACTCTGTAACCGGCTCACA | |
| PCNA | F:CTGAGGGCTTCGACACCTA |
| R:TTCAAATACTAGCGCCAAGG | |
| MYC | F:GCTGCTTAGACGCTGGATT |
| R:TGCTGCTGCTGGTAGAAGTT | |
| BRCA1 | F:AAGTATGGGCTACAGAAACCG |
| R:CCCAATTCAATGTAGACAGACG | |
| TNFRSF21 | F:AGTCCCTTCCTCCACTTATGTT |
| R:GGAGGGTCTTGTTCACGTC | |
| TNFRSF12A | F:CTCTGAGCCTGACCTTCGT |
| R:TGAATGATGAGTGGGCGA | |
| PARP1 | F:AATGACCTGAAGGAGCTACTCA |
| R:ACTTGGTCCAGGCAGTGAC | |
| AP15 | F:GGGTTGTTCAGCCAAATACTT |
| R:ACCAGTCACATCTTCTAGGACCT | |
| HDAC | F:GAGGGTGCTGTACATTGACATT |
| R:TAATACTTGCCTTTGCCAGC | |
| P21 | F:TGTGGACCTGTCACTGTCTTG |
| R:GGATTAGGGCTTCCTCTTGG | |
| GAPDH | F:GGAGTCCACTGGCGTCTTCAC |
| R:GAGGCATTGCTGATGATCTTGAGG |
Statistical and bioinformatics analyses
The majority of quantitative data in the present study are reported as means ± SD from at least three independent experiments. One-way ANOVA was used to test differences for single group analysis, followed by Tukey’s multiple comparisons. Two-way ANOVA was used for grouped analysis of differences followed by Bonferroni post-tests.
Statistical and bioinformatics analysis of microarray data was conducted using the software packages ArrayAssist Enterprise, PathwayAssist (Stratagene/Agilent, Santa Clara, CA), and GeneSpring (Agilent, Santa Clara, CA). Briefly, the raw GeneChip files from GeneChip Operating Software (GCOS, Affymetrix, CA) were uploaded, background-subtracted, variance stabilized, and normalized using the GC-RMA method [17]. Additional filters, such as presence (P) and absence (A) call, were applied for quality control purposes. The control (or otherwise indicated) group was used as a baseline to calculate the intensity ratio/fold changes of the treated versus the control group. The ratio was log2-transformed before further statistical analysis. The p-values were obtained by an unpaired t-test assuming unequal variance.
Results
BA-TPQ has in vitro anticancer activity
Inhibition of cancer cell growth
Three human breast cancer cell lines (MCF-7/p53 wt; MCF-7/p53 KD, and MDA-MB-468/p53 mt) and one “normal” (immortalized but non-malignant) breast epithelial cell line (MCF-10A) were cultured with the compound at concentrations ranging from 0-1.0 μM for 72 hr, and cell viability was determined. The MCF-7 and MDA-MB-468 cell lines were selected because they both represent advanced breast cancers, but are of different backgrounds with regard to genomic classification (MCF-7 are luminal, MDA-MB-468 are basal-like; [18]), reflecting their differences in expression of a number of genes, including the estrogen receptor and p53. This allows for an initial assessment of the activity of the compound against diverse breast cancers.
The inhibitory effects of the compound on cell growth are illustrated in Fig. 1b. BA-TPQ showed a strong dose-dependent cell growth inhibition, with significant (p<0.01) activity beginning at the 0.01μM and 0.1μM concentrations for the MCF-7 wt and MDA-MB-468 cells, respectively, and at the 0.1μM concentration (p<0.05) for the MCF-7 p53 KD cells. In fact, there was a 94.3% (P<0.01), 81.8% (P<0.01) and 99.6% (P<0.01) inhibition of cell viability at 1 μM in the different cell lines, respectively. Although the MCF-10A non-malignant breast epithelial cells demonstrated a significant (p<0.05) decrease in viability at the 0.1μM concentration, they were less sensitive to the inhibitory effects of BA-TPQ than the breast cancer cells, never showing any significant increase in cell growth inhibition over that observed at the 0.1μM concentration. Moreover, by the 0.1μM concentration, there were significant (p<0.01) differences in the sensitivity of all three of the cancer cells to the compound compared to the “normal” MCF-10A cells.
Induction of apoptosis in human breast cancer cells
As illustrated in Fig. 1c, BA-TPQ induced apoptosis in a dose-dependent manner in all three cell lines. In the p53 wt MCF-7 and p53 KD MCF-7 cells, a 0.75 μM concentration of BA-TPQ increased the apoptotic index sixteen-fold and six-fold higher than that seen in control (vehicle-treated) cells, respectively. In the MDA-MB-468 cells, BA-TPQ led to a 4.5-fold increase in apoptosis at 0.75 μM (P<0.01). Although all of the cell lines showed a significant increase in apoptosis beginning at the 0.5μM concentration (p<0.05), the MCF-7 cells (both wt and p53 KD) were significantly more sensitive (p<0.01) than the MDA-MB-468 cells.
BA-TPQ exposure results in cell cycle arrest
The effects of BA-TPQ on cell cycle distribution were not the same among the tested cell lines (Fig. 1d). At a concentration of 0.75 μM, BA-TPQ induced arrest in the G1 phase (P<0.01) in MCF-7 cells; in MCF-7 p53 KD and MDA-MB-468 cells, it induced arrest in the S phase (P<0.01). These differences are likely due to the different backgrounds of p53 in these cells. In the p53 wt MCF-7 cells, it is likely that p53 is activated by the compound, leading to increased p21 transcription and inhibition of cyclin dependent kinases, resulting in cell cycle arrest in the G1 phase [19]. In contrast, when p53 is lacking, the compound induces arrest in the S-phase, perhaps as a result of its inhibition of Cdc25A and other cell cycle regulators, resulting in faulty dephosphorylation of cyclin E [20]
BA-TPQ decreases the growth of xenograft tumors
To obtain a preliminary assessment of the in vivo anti-tumor activity of the compound, BA-TPQ was first evaluated in an MCF-7 mouse xenograft model of breast cancer. The higher dose (10 mg/kg/d, 3 d/wk) inhibited MCF-7 xenograft tumor growth by about 60% (P<0.01) on day 18 (Fig. 2a), with significant differences in tumor size being observed between the BA-TPQ- and vehicle-treated animals being observed beginning on day 6.
Figure 2.
In vivo antitumor activity of BA-TPQ. BA-TPQ was administered to nude mice bearing (a) MCF-7 or (b) MDA-MB-468 xenograft tumors. For the MCF-7 model, BA-TPQ was administered by i.p. injection at doses of 5 mg/kg/d or 10 mg/kg/d, 3 d/wk for 3 weeks. For the MDA-MB-468 model, BA-TPQ was administered by i.p. injection at doses of 1 mg/kg/d or 10 mg/kg/d, 5 d/wk for 6 weeks. The effects of BA-TPQ on body weight (as a marker of toxicity) when it was administered to nude mice bearing (c) MCF-7 or (d) MDA-MB-468 xenograft tumors. # P < 0.01
The in vivo anticancer activity of BA-TPQ was then further investigated in the MDA-MB-468 xenograft model (Fig. 2b). In this model, BA-TPQ was administered by i.p. injection at doses of 1 mg/kg/d or 10 mg/kg/d, 5 d/wk for 6 weeks. Even at the 1 mg/kg dose, there was still considerable in vivo activity, with xenograft tumor growth being inhibited by about 46% at the end of the six weeks (P<0.01), and significant tumor growth inhibition noted beginning on day 6. In both models, there were obvious dose-responses, with significant differences in the tumor sizes of animals in the higher and lower treatment groups occurring on days 15 (MCF-7) and 27 (MDA-MB-468). Minimal (but significant) host toxicity (followed using body weight as a surrogate marker) was observed at the 10 mg/kg dose in both models (Fig. 2c and d).
Determination of the mechanism(s) of action of BA-TPQ
BA-TPQ alters the expression of proteins involved in cell cycle progression and apoptosis
We next investigated the mechanism(s) of action of BA-TPQ by examining its effects on the expression level of various proteins involved in these cell cycle progression and apoptosis (Fig. 3). In MCF-7 cells, BA-TPQ increased p53 and down-regulated MDM2, cyclin D1, Cdk2, Cdk4, Cdk6, and E2F1 (Fig. 3a). Similar effects on cell cycle/proliferation-related proteins were observed in the MCF-7 p53 KD cells and MDA-MB-468 (p53 mutant) cells, indicating that the activity of BA-TPQ is p53-independent.
Figure 3.
Effects of BA-TPQ on the expression of various proteins. BA-TPQ altered the expression of cell cycle regulatory (a) and apoptosis-related (b) proteins in human breast cancer cells. Cells were exposed to various concentrations of the compound for 24 h, and the target proteins were detected by immunoblotting with specific antibodies. (c) Similar patterns of protein expression were observed in vivo. At the end of the experiment, tumor xenografts were removed from the mice, and proteins from the tumor homogenates were analyzed by Western blotting.
To determine the potential mechanisms responsible for BA-TPQ-induced apoptosis, the levels of Bax, cleaved PARP1, and cleaved caspases 3, 8, and 9 were analyzed. All of these apoptosis-related molecules increased following exposure of all three cell lines (MCF-7, MCF-7 p53 KD and MDA-MB-468) to BA-TPQ (Fig. 3b). Both caspases -8 and -9 were activated, indicating that the compound induces apoptosis via both the intrinsic and extrinsic pathways. Analysis of MCF-7 tumors collected at the end of the in vivo experiment showed that the pattern of protein expression in the treated xenograft tissues was the same as that observed in vitro (Fig. 3c).
Microarray analysis of gene expression in MCF-7 cells following BA-TPQ exposure
To further examine the mechanism(s) by which BA-TPQ exerts its effects, we accomplished a gene microarray study of MCF-7 cells following exposure to the compound. Of the more than 28,000 genes examined, thirteen genes related to cell cycle progression/proliferation or apoptosis were up- or down-regulated by at least 3-fold (Table 2), including E2F2, CDC25A, and SPC25 (down-regulated), and DUSP1, TNFRSF21, and DDIT4 (up-regulated). Other up-regulated genes included GADD45A, TNFRSF21, and TNFAIP3. These are related to the stress response and apoptosis, further supporting the increase in apoptosis induced by the compound. The expression of a variety of other genes related to proliferation and/or apoptosis were also modified, many by more than 2-fold (Table 2).
Table 2.
A partial list of cell cycle and apoptosis-related genes up- and down-regulated in MCF-7 cells exposed to BA-TPQ
| Gene name | Description | Probe Set ID |
Gene ID |
P Value |
Fold change |
|---|---|---|---|---|---|
| DDIT3 | DNA-damage-inducible transcript 3 | 7964460 | NM_004083 | 0.0015 | 21.31 |
| ANXA1 | Annexin A1 | 8155849 | NM_000700 | 0.0221 | 7.61 |
| TNFAIP3 | Tumor necrosis factor, alpha-induced protein 3 | 8122265 | NM_006290 | 0.0095 | 5.70 |
| HMOX1 | Heme oxygenase (decycling) 1 | 8072678 | NM_002133 | 0.0037 | 5.30 |
| GADD45A | Growth arrest and DNA-damage-inducible, alpha |
7902227 | NM_001924 | 0.0015 | 4.62 |
| TNFRSF21 | Tumor necrosis factor receptor superfamily, member 21 |
8126839 | NM_014452 | 0.0055 | 4.46 |
| DDIT4 | DNA-damage-inducible transcript 4 | 7928308 | NM_019058 | 0.0118 | 3.71 |
| DUSP1 | Dual specificity phosphatase 1 | 8115831 | NM_004417 | 0.0051 | 3.65 |
| PHLDA1 | Pleckstrin homology-like domain, family A, member 1 |
7965040 | NM_007350 | 0.0246 | 3.08 |
| NUPR1 | Nuclear protein 1 | 8000574 | NM_001042483 | 0.0184 | 2.99 |
| KLF10 | Kruppel-like factor 10 | 8152215 | NM_005655 | 0.0095 | 2.94 |
| SESN2 | Sestrin 2 | 7899436 | NM_031459 | 0.0074 | 2.93 |
| TRIB3 | Tribbles homolog 3 (Drosophila) | 8060344 | NM_021158 | 0.0034 | 2.81 |
| TXNIP | Thioredoxin interacting protein | 7904726 | NM_006472 | 0.0038 | 2.79 |
| MAFG | V-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) |
8019796 | NM_002359 | 0.0034 | 2.74 |
| EXT1 | Exostoses (multiple) 1 | 8152491 | NM_000127 | 0.0103 | 2.71 |
| KLF11 | Kruppel-like factor 11 | 8040211 | NM_003597 | 0.0062 | 2.67 |
| CEBPB | CCAAT/enhancer binding protein (C/EBP), beta |
8063386 | NM_005194 | 0.0105 | 2.66 |
| GADD45G | Growth arrest and DNA-damage-inducible, gamma |
8156309 | NM_006705 | 0.0199 | 2.66 |
| ASNS | Asparagine synthetase | 8141150 | NM_133436 | 0.0035 | 2.48 |
| AREG | Amphiregulin (schwannoma-derived growth factor) |
8095744 | NM_001657 | 0.0067 | 2.44 |
| HBP1 | HMG-box transcription factor 1 | 8135392 | NM_012257 | 0.0038 | 2.42 |
| RRAGC | Ras-related GTP binding C | 7915160 | NM_022157 | 0.0109 | 2.41 |
| VEGFA | Vascular endothelial growth factor A | 8119898 | NM_001025366 | 0.0038 | 2.40 |
| TGFB2 | Transforming growth factor, beta 2 | 7909789 | NM_003238 | 0.0456 | 2.39 |
| ERN1 | Endoplasmic reticulum to nucleus signaling 1 | 8017555 | NM_001433 | 0.0052 | 2.31 |
| TXNRD1 | Thioredoxin reductase 1 | 7958174 | NM_003330 | 0.0073 | 2.31 |
| KLF4 | Kruppel-like factor 4 (gut) | 8163002 | NM_004235 | 0.0118 | 2.29 |
| WEE1 | WEE1 homolog (S. pombe) | 7938348 | NM_003390 | 0.0062 | 2.28 |
| TNFRSF12A | Tumor necrosis factor receptor superfamily, member 12A |
7992789 | NM_016639 | 0.0120 | 2.27 |
| AHR | Aryl hydrocarbon receptor | 8131614 | NM_001621 | 0.0050 | 2.17 |
| MYC | V-myc myelocytomatosis viral oncogene homolog (avian), similar to ORF 114 |
8148317 | NM_002467 | 0.0069 | 2.16 |
| FOXO3 | Forkhead box O3 | 8013307 | NM_001455 | 0.0103 | 2.15 |
| CYR61 | Cysteine-rich, angiogenic inducer, 61 | 7902687 | NM_001554 | 0.0121 | 2.13 |
| PAWR | PRKC, apoptosis, WT1, regulator | 7965112 | NM_002583 | 0.0038 | 2.10 |
| TRIB1 | Tribbles homolog 1 (Drosophila) | 8148304 | NM_025195 | 0.0102 | 2.10 |
| CCNG2 | Cyclin G2 | 8095870 | NM_004354 | 0.0191 | 2.04 |
| KLF5 | Kruppel-like factor 5 (intestinal) | 7969414 | NM_001730 | 0.0257 | 2.04 |
| NAMPT | Nicotinamide phosphoribosyltransferase | 8142120 | NM_005746 | 0.0065 | 2.01 |
| TIMP3 | TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoinflammatory) |
8072626 | NM_000362 | 0.0343 | 2.01 |
| NFKBIA | Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha |
7978644 | NM_020529 | 0.0082 | 1.96 |
| SIAH1 | Seven in absentia homolog 1 (Drosophila) | 8001306 | NM_001006610 | 0.0120 | 1.95 |
| SQSTM1 | Sequestosome 1 | 8110569 | NM_003900 | 0.0045 | 1.94 |
| CBX4 | Chromobox homolog 4 (Pc class homolog, Drosophila) |
8019018 | NM_003655 | 0.0143 | 1.93 |
| OSR2 | Odd-skipped related 2 (Drosophila) | 8147573 | NM_053001 | 0.0088 | 1.93 |
| GADD45B | Growth arrest and DNA-damage-inducible, beta |
8024485 | NM_015675 | 0.0244 | 1.90 |
| MXD1 | MAX dimerization protein 1 | 8042503 | NM_002357 | 0.0203 | 1.90 |
| CDK7 | Cyclin-dependent kinase 7 | 8105862 | NM_001799 | 0.0045 | 1.89 |
| SERTAD1 | SERTA domain containing 1 | 8036902 | NM_013376 | 0.0045 | 1.89 |
| PIM1 | Pim-1 oncogene | 8119161 | NM_002648 | 0.0116 | 1.85 |
| CDKN1A | Cyclin-dependent kinase inhibitor 1A (p21, Cip1) |
8119088 | NM_078467 | 0.0214 | 1.84 |
| DAPK3 | Death-associated protein kinase 3 | 8032718 | NM_001348 | 0.0166 | 1.81 |
| STK17A | Serine/threonine kinase 17a | 8132503 | NM_004760 | 0.0095 | 1.75 |
| TP53 | Tumor protein 53 | 8012257 | NM_000546 | 0.0183 | 1.34 |
| CCND1 | Cyclin D1 | 7942123 | NM_053056 | 0.0067 | −1.26 |
| API5 | Apoptosis inhibitor 5 | 7939424 | NM_006595 | 0.0165 | −1.71 |
| CDK6 | Cyclin-dependent kinase 6 | 8140955 | NM_001259 | 0.0274 | −1.75 |
| CDC26 | Cell division cycle 26 homolog (S. cerevisiae) | 8142878 | AF503918 | 0.0450 | −1.80 |
| CDC16 | Cell division cycle 16 homolog (S. cerevisiae) | 7970347 | NM_001078645 | 0.0213 | −1.81 |
| CCNF | Cyclin F | 7992594 | NM_001761 | 0.0107 | −1.82 |
| MSH2 | MutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) |
8041867 | NM_000251 | 0.0288 | −1.82 |
| KIF11 | Kinesin family member 11 | 7929258 | NM_004523 | 0.0063 | −1.83 |
| RBL1 | Retinoblastoma-like 1 (p107) | 8066136 | NM_002895 | 0.0196 | −1.83 |
| ATR | Ataxia telangiectasia and Rad3 related | 8091190 | NM_001184 | 0.0270 | −1.84 |
| ZMYND11 | Zinc finger, MYND domain containing 11 | 7925792 | NM_006624 | 0.0074 | −1.84 |
| CTF8 | Chromosome transmission fidelity factor 8 homolog (S. cerevisiae) |
8002266 | NM_001039690 | 0.0309 | −1.87 |
| DOCK1 | Dedicator of cytokinesis 1 | 7931293 | NM_001380 | 0.0247 | −1.87 |
| CCNE1 | Cyclin E1 | 8027402 | NM_001238 | 0.0486 | −1.88 |
| CDC123 | Cell division cycle 123 homolog (S. cerevisiae) | 7926207 | NM_006023 | 0.0177 | −1.88 |
| SKP2 | S-phase kinase-associated protein 2 (p45) | 8104912 | NM_005983 | 0.0136 | −1.90 |
| APPL2 | Adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2 |
7966003 | NM_018171 | 0.0088 | −1.92 |
| HSPA1A | Heat shock 70kDa protein 1A | 8179322 | NM_005345 | 0.0272 | −1.92 |
| MAEA | Macrophage erythroblast attacher | 8093462 | NM_001017405 | 0.0270 | −1.92 |
| RASA1 | RAS p21 protein activator (GTPase activating protein) 1 |
8106784 | NM_002890 | 0.0303 | −1.93 |
| KITLG | KIT ligand | 7965322 | NM_000899 | 0.0063 | −1.96 |
| TIPIN | TIMELESS interacting protein | 7989915 | NM_017858 | 0.0197 | −1.98 |
| RIPK1 | Receptor (TNFRSF)-interacting serine-threonine kinase 1 |
8116622 | NM_003804 | 0.0269 | −1.99 |
| UBE4B | Ubiquitination factor E4B (UFD2 homolog, yeast) |
7897527 | NM_001105562 | 0.0187 | −1.99 |
| DIDO1 | Death inducer-obliterator 1 | 8067563 | NM_033081 | 0.0265 | −2.04 |
| HDAC1 | Histone deacetylase 1 | 7899774 | NM_004964 | 0.0091 | −2.11 |
| MAGEH1 | Melanoma antigen family H, 1 | 8167887 | NM_014061 | 0.0350 | −2.19 |
| UTP11L | UTP11-like, U3 small nucleolar ribonucleoprotein, (yeast) |
7900201 | NM_016037 | 0.0224 | −2.20 |
| DLG1 | Discs, large homolog 1 (Drosophila) | 8093191 | NM_001098424 | 0.0436 | −2.23 |
| UNC5C | Unc-5 homolog C (C. elegans) | 8101788 | NM_003728 | 0.0198 | −2.24 |
| NAE1 | NEDD8 activating enzyme E1 subunit 1 | 8001876 | NM_001018159 | 0.0206 | −2.25 |
| PARP1 | Poly (ADP-ribose) polymerase family, member 1 |
7924733 | NM_001618 | 0.0069 | −2.29 |
| E2F8 | E2F transcription factor 8 | 7947110 | NM_024680 | 0.0105 | −2.35 |
| HELLS | Helicase, lymphoid-specific | 7929438 | NM_018063 | 0.0085 | −2.36 |
| BRCA1 | Breast cancer 1, early onset | 8015769 | NM_007296 | 0.0420 | −2.38 |
| CDC7 | Cell division cycle 7 homolog (S. cerevisiae) | 7902913 | NM_003503 | 0.0409 | −2.42 |
| ZNF443 | Zinc finger protein 443 | 8034393 | NM_005815 | 0.0227 | −2.48 |
| PCNA | Proliferating cell nuclear antigen | 8064844 | NM_002592 | 0.0067 | −2.49 |
| RAD50 | RAD50 homolog (S. cerevisiae) | 8107942 | NM_005732 | 0.0302 | −2.52 |
| CCNE2 | Cyclin E2 | 8151871 | NM_057749 | 0.0123 | −2.78 |
| NAIP | NLR family, apoptosis inhibitory protein | 8112478 | NM_022892 | 0.0335 | −2.86 |
| E2F2 | E2F transcription factor 2 | 7913644 | NM_004091 | 0.0118 | −3.01 |
| CDC25A | Cell division cycle 25 homolog A (S. pombe) | 8086880 | NM_001789 | 0.0105 | −3.15 |
| DSCC1 | Defective in sister chromatid cohesion 1 homolog (S. cerevisiae) |
8152582 | NM_024094 | 0.0139 | −4.28 |
| SPC25 | SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae) |
8056572 | NM_020675 | 0.0201 | −4.35 |
Confirmation of microarray data
Selected genes that had altered expression levels by microarray analysis were confirmed by RT-PCR. The expression levels of various genes, including DUSP1, TNFRSF21, and SPC25 were all shown to have increased or decreased mRNA expression in BA-TPQ-treated cells that correlated with the microarray findings (Fig. 4). In all, we examined the mRNA expression of 21 different cell cycle- and apoptosis-related targets, and found that the changes in all of the mRNA levels (up/down-regulation following exposure to BA-TPQ) correlated with the results observed from the microarray studies (Fig. 4, Table 2).
Figure 4.
Confirmation of changes in gene expression at the mRNA level. Several of the genes observed to be up- or down-regulated during microarray analyses were examined for mRNA expression by RT-PCR following exposure of MCF-7 cells to 0 or 0.5 μM BA-TPQ for 16 hr.
Discussion
Previous studies indicated that BA-TPQ had activity against various human cancer cell lines, and that it was especially effective against breast cancer cells [13-15]. The mechanism(s) of action of BA-TPQ were not examined previously, but studies of related compounds have indicated various possible mechanisms of action for the iminoquinone analogs, including inhibition of topoisomerase II, inhibition of cell survival/proliferation, inhibition of oncogene expression, and interference with hormone receptor signaling [13-15].
In the present study, we observed that BA-TPQ significantly decreased breast cancer cell growth, increased apoptosis and led to cell cycle arrest. BA-TPQ also decreased the growth of both MCF-7 (ER+/+, p53+/+) and MDA-MB-468 (ER−/−, p53−/−) xenograft tumors, with a 1 mg/kg dose leading to approximately 50% tumor growth inhibition (46%) in the MDA-MB-468 model after 6 wks of treatment. Further studies to optimize the treatment schedule are needed. Additional studies of the potential of the compound for preventing and treating metastases (using an orthotopic model) would also be informative. Since there are no published reports about the pharmacokinetics, toxicity, or bioavailability of BA-TPQ or any related compounds, we have started evaluating these factors.
As a preliminary step in evaluating the mechanisms of action of BA-TPQ, we examined the expression of several proteins known to be involved in these processes. In the three cell lines, there was decreased expression of various proteins, including E2F1, Bcl-2, cyclin D1, cdk2, cdk4 and cdk6, and increased expression of Bax and p53 (in the MCF-7 cells). Similar effects on protein expression were observed in excised xenograft tumors. We then made use of cDNA microarrays to further explore the activities of the compound. Using this method, we found that BA-TPQ altered the expression of a number of cell cycle regulatory and apoptosis-related genes in MCF-7 cells exposed to the compound. The changes in the mRNA level of several of these genes were then confirmed using RT-PCR.
Together, these results indicated that BA-TPQ exerts its effects primarily by inhibiting cell cycle progression and inducing apoptosis, making use of both p53-dependent and – independent pathways. It is also possible that the compound activates the DNA damage response, and may inhibit topoisomerase II [10], although the effects on apoptosis and the cell cycle appear to be the most important mechanisms of action for the compound. BA-TPQ therefore exerts its potent anti-cancer effects via a variety of mechanisms.
This multi-faceted activity may prove to be a major benefit to using BA-TPQ and similar agents in the clinic. While “rationally-targeted” therapeutics have helped increase survival for some patients, these agents are generally limited in their applications to small sub-sets of patients. For example, Herceptin is only useful for 20-30% of breast cancer patients [21], and many patients develop resistance to the drug after initial treatment [6]. To successfully eradicate a larger number of cancers, and especially to destroy advanced and metastatic cancers, it will be necessary to target multiple pathways. It may also be necessary to target multiple molecules/pathways in localized and early-stage disease in order to avoid the development of drug resistance. BA-TPQ, via its actions through the p53/MDM2 axis, p53-independent cell cycle and apoptosis-related pathways, topoisomerase inhibition, and other pathways, is likely to prevent or overcome drug resistance, and to exert potent effects against cancer cells regardless of their genetic background. Moreover, since BA-TPQ does not depend on the genetic background of the cells, it is appropriate to use against a variety of breast cancers, including triple negative breast cancers.
In summary, the observations from this study provide strong support for the use of BA-TPQ as an anti-tumor agent for human breast cancer. Further studies of the compound in comparison with its analogs, including studies of its activity against drug-resistant tumors and studies of its distribution and possible host toxicity, will increase understanding of its mode of action and contribute to the better design of future preclinical and clinical trials.
Acknowledgements
RZ was supported by NIH grants R01 CA112029 and R01 CA121211 and a grant (BCTR070731) from Susan G Komen for the Cure. E. Rayburn was supported by a T32 fellowship from the NIH/UAB Gene Therapy Center (CA075930). The apoptosis analyses were performed by the Flow Cytometry Core of the Arthritis and Musculoskeletal Center, which is supported by NIH grant P60 AR20614. S. Velu was supported by a UAB Breast Spore pilot grant, a Collaborative Programmatic Development grant from the UAB Comprehensive Cancer Center, and by grant number 1UL1RR025777 from the NIH National Center for Research Resources.
References
- 1.American Cancer Society . Breast Cancer Facts & Figures 2007-2008. American Cancer Society, Inc; Atlanta: [Accessed 20 July 2009]. Available via http://www.cancer.org/downloads/STT/BCFF-Final.pdf. [Google Scholar]
- 2.Payne SJ, Bowen RL, Jones JL, Wells CA. Predictive markers in breast cancer--the present. Histopathology. 2008;52:82–90. doi: 10.1111/j.1365-2559.2007.02897.x. doi: 10.1111/j.1365-2559.2007.02897.x. [DOI] [PubMed] [Google Scholar]
- 3.Nicolini A, Giardino R, Carpi A, Ferrari P, Anselmi L, Colosimo S, Conte M, Fini M, Giavaresi G, Berti P, Miccoli P. Metastatic breast cancer: an updating. Biomed Pharmacother. 2006;60:548–56. doi: 10.1016/j.biopha.2006.07.086. doi: 10.1016/j.physletb.2003.10.071. [DOI] [PubMed] [Google Scholar]
- 4.Wang W, Figg WD. [Accessed 3 August 2009];Secondary BRCA1 and BRCA2 alterations and acquired chemoresistance. Cancer Biol Ther. 2008 7:1004–1005. doi: 10.4161/cbt.7.7.6409. Available via: http://www.landesbioscience.com/journals/cbt/article/04WangCBT7-7.pdf. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yeang CH, McCormick F, Levine A. Combinatorial patterns of somatic gene mutations in cancer. FASEB J. 2008;22:2605–2622. doi: 10.1096/fj.08-108985. doi: 10.1096/fj.08-108985. [DOI] [PubMed] [Google Scholar]
- 6.Calabrich A, Fernandes Gdos S, Katz A. [Accessed 3 August 2009];Trastuzumab: mechanisms of resistance and therapeutic opportunities. Oncology (Williston Park) 2008 22:1250–1258. Available via: http://cancernetwork.com/display/article/10165/1341250. [PubMed] [Google Scholar]
- 7.Banerjee S, Li Y, Wang Z, Sarkar FH. Multi-targeted therapy of cancer by genistein. Cancer Lett. 2008;269:226–242. doi: 10.1016/j.canlet.2008.03.052. doi: 10.1016/j.canlet.2008.03.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Desai AG, Qazi GN, Ganju RK, El-Tamer M, Singh J, Saxena AK, Bedi YS, Taneja SC, Bhat HK. Medicinal plants and cancer chemoprevention. Curr Drug Metab. 2008;9:581–591. doi: 10.2174/138920008785821657. doi: 10.2174/138920008785821657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Goel A, Jhurani S, Aggarwal BB. Multi-targeted therapy by curcumin: how spicy is it? Mol Nutr Food Res. 2008;52:1010–1030. doi: 10.1002/mnfr.200700354. doi: 10.1002/mnfr.200700354. [DOI] [PubMed] [Google Scholar]
- 10.Mahadevan S, Park Y. Multifaceted therapeutic benefits of Ginkgo biloba L.: chemistry, efficacy, safety, and uses. J Food Sci. 2008;73:R14–19. doi: 10.1111/j.1750-3841.2007.00597.x. doi: 10.1111/j.1750-3841.2007.00597.x. [DOI] [PubMed] [Google Scholar]
- 11.Safe S, Papineni S, Chintharlapalli S. Cancer chemotherapy with indole-3-carbinol, bis(3′-indolyl)methane and synthetic analogs. Cancer Lett. 2008;269:326–338. doi: 10.1016/j.canlet.2008.04.021. doi: 10.1016/j.canlet.2008.04.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Antunes EM, Copp BR, Davies-Coleman MT, Samaai T. Pyrroloiminoquinone and related metabolites from marine sponges. Nat Prod Rep. 2005;22:62–72. doi: 10.1039/b407299p. doi: 10.1039/b407299p. [DOI] [PubMed] [Google Scholar]
- 13.Shinkre BA, Raisch KP, Fan L, Velu SE. Synthesis and antiproliferative activity of benzyl and phenethyl analogs of makaluvamines. Bioorg Med Chem. 2008;16:2541–2549. doi: 10.1016/j.bmc.2007.11.051. doi: 10.1016/j.bmc.2007.11.051. [DOI] [PubMed] [Google Scholar]
- 14.Shinkre BA, Raisch KP, Fan L, Velu SE. Analogs of the marine alkaloid makaluvamines: synthesis, topoisomerase II inhibition, and anticancer activity. Bioorg Med Chem Lett. 2007;17:2890–2893. doi: 10.1016/j.bmcl.2007.02.065. doi: 10.1016/j.bmcl.2007.02.065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang F, Ezell SJ, Zhang Y, Wang W, Rayburn ER, Nadkarni DH, Murugesan S, Velu E, Zhang R. FBA-TPQ, a novel marine-derived compound as experimental therapy for prostate cancer. Invest New Drugs. 2009 Mar 10; doi: 10.1007/s10637-009-9232-x. [Epub ahead of print]. doi: 10.1007/s10637-009-9232-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wang H, Yu D, Agrawal S, Zhang R. Experimental therapy of human prostate cancer by inhibiting MDM2 expression with novel mixed-backbone antisense oligonucleotides: in vitro and in vivo activities and mechanisms. Prostate. 2003;54:194–205. doi: 10.1002/pros.10187. doi: 10.1002/pros.10187. [DOI] [PubMed] [Google Scholar]
- 17.Wu Z, Irizarry RA, Gentleman R, Martinez-Murillo R, Spencer R. A Model-Based Background Adjustment for Oligonucleotide Expression Arrays. Journal of the American Statistical Association. 2004;99:909–917. doi: 10.1198/016214504000000683. [Google Scholar]
- 18.Jönsson G, Staaf J, Olsson E, Heidenblad M, Vallon-Christersson J, Osoegawa K, de Jong P, Oredsson S, Ringnér M, Höglund M, Borg A. High-resolution genomic profiles of breast cancer cell lines assessed by tiling BAC array comparative genomic hybridization. Genes Chromosomes Cancer. 2007;46:543–558. doi: 10.1002/gcc.20438. doi: 10.1002/gcc.20438. [DOI] [PubMed] [Google Scholar]
- 19.el-Deiry WS, Harper JW, O’Connor PM, Velculescu VE, Canman CE, Jackman J, Pietenpol JA, Burrell M, Hill DE, Wang Y, et al. WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Res. 1994;54:1169–1174. [PubMed] [Google Scholar]
- 20.Eastman A. Cell cycle checkpoints and their impact on anticancer therapeutic strategies. J Cell Biochem. 2004;91:223–231. doi: 10.1002/jcb.10699. doi: 10.1002/jcb.10699. [DOI] [PubMed] [Google Scholar]
- 21.Ignatiadis M, Desmedt C, Sotiriou C, de Azambuja E, Piccart M. HER-2 as a target for breast cancer therapy. Clin Cancer Res. 2009;15:1848–1852. doi: 10.1158/1078-0432.CCR-08-1844. doi: 10.1158/1078-0432.CCR-08-1844. [DOI] [PubMed] [Google Scholar]