Skip to main content
PLOS One logoLink to PLOS One
. 2013 Sep 11;8(9):e73794. doi: 10.1371/journal.pone.0073794

SNP (–617C>A) in ARE-Like Loci of the NRF2 Gene: A New Biomarker for Prognosis of Lung Adenocarcinoma in Japanese Non-Smoking Women

Yasuko Okano 1,2, Uru Nezu 1,3, Yasuaki Enokida 1,4, Ming Ta Michael Lee 5,6, Hiroko Kinoshita 1, Alexander Lezhava 1, Yoshihide Hayashizaki 1, Satoshi Morita 6, Masataka Taguri 7, Yasushi Ichikawa 2, Takeshi Kaneko 1,8, Yutaka Natsumeda 9, Tomoyuki Yokose 10, Haruhiko Nakayama 11, Yohei Miyagi 12, Toshihisa Ishikawa 1,*
Editor: Pan-Chyr Yang13
PMCID: PMC3770684  PMID: 24040073

Abstract

Purpose

The transcription factor NRF2 plays a pivotal role in protecting normal cells from external toxic challenges and oxidative stress, whereas it can also endow cancer cells resistance to anticancer drugs. At present little information is available about the genetic polymorphisms of the NRF2 gene and their clinical relevance. We aimed to investigate the single nucleotide polymorphisms in the NRF2 gene as a prognostic biomarker in lung cancer.

Experimental Design

We prepared genomic DNA samples from 387 Japanese patients with primary lung cancer and detected SNP (c.–617C>A; rs6721961) in the ARE-like loci of the human NRF2 gene by the rapid genetic testing method we developed in this study. We then analyzed the association between the SNP in the NRF2 gene and patients’ overall survival.

Results

Patients harboring wild-type (WT) homozygous (c.–617C/C), SNP heterozygous (c.–617C/A), and SNP homozygous (c.–617A/A) alleles numbered 216 (55.8%), 147 (38.0%), and 24 (6.2%), respectively. Multivariate logistic regression models revealed that SNP homozygote (c.–617A/A) was significantly related to gender. Its frequency was four-fold higher in female patients than in males (10.8% female vs 2.7% male) and was associated with female non-smokers with adenocarcinoma. Interestingly, lung cancer patients carrying NRF2 SNP homozygous alleles (c.–617A/A) and the 309T (WT) allele in the MDM2 gene exhibited remarkable survival over 1,700 days after surgical operation (log-rank p = 0.021).

Conclusion

SNP homozygous (c.–617A/A) alleles in the NRF2 gene are associated with female non-smokers with adenocarcinoma and regarded as a prognostic biomarker for assessing overall survival of patients with lung adenocarcinoma.

Introduction

Lung cancer is the leading cause of cancer-related death in many industrial countries. It is classified into two major types, namely, small-cell lung carcinoma (SCLC) and non-small-cell lung carcinoma (NSCLC). While long-term exposure to cigarette smoke is the most common cause of lung cancer (80–90% of lung cancers), non-smokers account for 10–15% of lung cancer cases, which are often attributed to a combination of genetic and environmental factors [1]–[3]. The transcription factor NF-E2-related factor 2 (NRF2) is known to control cellular adaptation/protection to reactive oxygen species and electrophiles by inducing antioxidation and detoxification genes [4]–[6] as well as mediate cancer cell proliferation and drug resistance [7]–[12]. We have undertaken the present study to examine the clinical impact of the NRF2 gene and its genetic polymorphisms on the risk and prognosis of lung cancer.

NRF2 is a “cap‘n’collar” basic region-leucine zipper (CNC-bZip) transcription factor and plays a pivotal role in the induction of antioxidant response element (ARE)-regulated genes [4]–[13]. Under non-stressed conditions, NRF2 protein is associated with Kelch-like ECH associating protein 1 (KEAP1) [14]. KEAP1 is known to be a negative regulator of NRF2 by retrieving it in the cytoplasm. Oxidative stress and/or electrophilic attack lead to the dissociation of NRF2 from KEAP1 and thereby the NRF2 protein is translocated into the nucleus. NRF2 together with small multiple alignment format (MAF) sequences binds to ARE sequences [15]. Many genes encoding detoxifying and antioxidant enzymes have been found to be regulated by NRF2 [4]–[6], [15]–[18]. It has recently been reported that NRF2 contributes to malignant phenotypes of cancer cells in vitro, including aggressive cell proliferation, drug resistance, and metabolic re-programming [7]–[11], [19], [20]. In this context, the NRF2 gene is considered to play split roles, for example, in the protection of normal cells and progression of cancer malignancy.

In 2004, Yamamoto and colleagues first reported the structure of the NRF2 gene and found three SNPs (−653A>G, −651G>A, and –617C>A) and one triplet repeat polymorphism in its regulatory region [21]. Three years later, Marzec et al. examined the impact of those SNPs on the regulation of NRF2 gene expression [22]. In transient transfection assays, they found that the –617C>A SNP significantly affects basal NRF2 protein levels and its function in vitro [22]. SNP –617C>A was found to be associated with a higher risk of oxidant-induced acute lung injury in humans [22]. It has been reported that a SNP (c.–617C>A) in the ARE-like loci of the human NRF2 gene is important for self induction of the NRF2 gene. NRF2 regulates the transcription of numerous phase II drug-metabolizing enzymes and phase III drug-transporters (e.g., ABCC1, ABCC2, ABCC4, and ABCG2) in response to oxidative stress via direct binding to the ARE sequences in those target genes [23]–[26]. At present, however, little information is available as to the clinical impact of genetic polymorphisms of the NRF2 gene and the prognosis of lung cancer.

To gain insight into the genetic polymorphisms of the NRF2 gene, we have developed rapid genotyping primer sets by utilizing the SmartAmp method, an isothermal DNA amplification process [27], [28]. Among a total of 387 lung cancer patients, we found that SNP (c.–617C>A) in the NRF2 gene is a prognostic biomarker for assessing the gender (female)-related risk of lung adenocarcinomas in the Japanese non-smoking sub-population of lung cancer patients. The epidermal growth factor receptor (EGFR) gene was frequently mutated in those female patients harboring the SNP homozygous SNP allele (–617A/A), suggesting a potential link between the SNP homozygote (–617A/A) and EGFR gene mutations. Furthermore, NRF2 reportedly regulates expression of the MDM2 gene that encodes a negative regulator of p53, and this study shows that lung cancer patients with homozygous SNP alleles (–617A/A) in the NRF2 gene and the 309T (WT) allele in the MDM2 gene had markedly better overall survival. This is the first report providing clinical evidence that homozygous SNP (–617A/A), as one of the intrinsic genetic polymorphisms in the NRF2 gene, is associated with the overall survival of lung cancer patients. Our clinical research data strongly suggest that the SNP homozygous allele (–617A/A) is a useful biomarker for clinical diagnosis.

Results

Clinicopathological Characterization

The clinicopathological characterization data for the 387 primary lung cancer patients are summarized in Table 1. The patient population comprised 221 men and 166 women, with an overall mean age of 66 years (range 35 to 87 years). The histological type of lung cancer was determined according to the protocol of the third World Health Organization/International Association for the Study of Lung Cancer Classifications [29]. Among the lung cancer patients, 298 were classified as having adenocarcinomas and 89 non-adenocarcinomas. The p-stage was determined by pathological examination of surgical specimens for 376 patients, and their tumours were staged according to the tumor nodes metastasis (TNM) classification of malignant tumours: 292, 46, 35, and 3 patients were respectively classified into stages I, II, III, and IV. For the remaining 11 patients, the p-stage could not be determined. The smoking history was obtained from each lung cancer patient at Kanagawa Cancer Center Research Institute: 154 patients had no smoking history, whereas 233 patients were smokers.

Table 1. Clinicopathological characterization of primary lung cancer patients.

Variable No. of patients (%)
Gender
Male 221 (57.1)
Female 166 (42.9)
Age (years old)
≤50 25 (6.4)
>50 362 (93.5)
Histopathology
Adeno 298 (77.0)
Non-adeno 89 (23.0)
Smoking
Non-smoker 154 (39.8)
Smoker 233 (60.2)
p-Stage
I 292 (75.4)
II 46 (11.9)
III 35 (9.0)
IV 3 (0.8)
Undetermined 11 (2.8)

Ages of all patients, 66.4±9.9 (mean±S.D.).

Abbreviation: Adeno, adenocarcinoma.

Preparation of Genotyping Primers for Detection SNP (c.– 617 C>A) in NRF2 Gene

The NRF2 gene is located on the negative strand of genomic DNA at q31.2 of chromosome 2. To create the template for preparation of genotyping primers, we synthesized double stranded DNA encoding a 424-bp region of nt.178129735 to nt.178130158, including the SNP (c. –617 C>A) in the NRF2 gene by means of PCR with human genomic DNA. PCR primers used for the DNA synthesis were GACCACTCTCCGACCTAAAGG (forward) and CGAGATAAAGAGTTGTTTGCGAA (reverse). The resulting PCR product was then inserted into the TA-cloning site of the pGEM®-T Easy Vector (Promega, Madison, WI, USA). The vector was amplified in JM109 High Efficiency Competent Cells (Promega), and vector DNA was purified by using the GeneGET™ Plasmid Miniprep Kit (Fermentas, Thermo Fisher Scientific Inc., Waltham, MA, USA). The sequence of the inserted DNA was analyzed with a laser-based automated DNA sequencer (ABI PRISM 3100 DNA Analyzer, Applied Biosystems Ltd., Tokyo, Japan). We designed a number of SNP-typing primer candidates and repeatedly tested them by using the vector-inserted DNA as a template until we obtained the best primer set.

The schematic illustration in Figure 1A shows the annealing sites of the best primer set, which comprises four different primers, i.e., TP, OP, FP, and BP. The TP primer was designed such that its turn-back region can discriminate the nucleotide of C or A at c.–617 in the negative DNA strand extended from the 3′-end of the primer (see Figure 1A). Furthermore, two SNPs, c.−651G>A and c.653A>G, were not included in the annealing sites of the four primers. Figure 1B depicts the sequences of primers in the WT (–617C)-typing and SNP (–617)-typing sets. Exciton dye was linked to thymine in the FP primer as symbolized by “Z” in the lower panel of Figure 1B.

Figure 1. SmartAmp-based detection of SNP (c.–617C>A) in the NRF2 gene.

Figure 1

SNP (c.–617C>A) resides in the promoter region of the NRF2 gene on chromosome 2q31.2. Panel A presents a schematic illustration of annealing sites of the TP, FP, and OP primers. Panel B shows cDNA encoding a partial sequence of the NRF2 gene and primer annealing sites. Panel C depicts the results of SNP detection. a.u. = arbitrary unit.

Figure 1C shows the time courses of genotyping reactions as functions of fluorescence intensity. By using the genotyping primer sets, we could detect the WT homozygote (–617C/C), WT/SNP heterozygote (–617C/A), and SNP homozygote (–617A/A) in genomic DNA samples. These results were verified by DNA sequence analysis. Namely, we performed sequencing analysis for determination of the WT homozygote (–617C/C), WT/SNP heterozygote (–617C/A), and SNP homozygote (–617A/A) in those genomic DNA samples. We tested 24 samples for each group (i.e., C/C, C/A, and A/A) and confirmed the 100% accordance between the SmartAmp method and the DNA sequencing analysis method.

Detection of SNP (c.–617 C>A) in the NRF2 Gene in Lung Cancer Patients

Using the genomic DNA samples prepared from a total of 387 lung cancer patients, we have detected WT and SNP alleles in the NRF2 gene by the rapid genotyping method described above. Table 2 summarizes these results, showing that 216, 147, and 24 patients could be typed as WT homozygote (–617C/C), WT/SNP heterozygote (–617C/A), and SNP homozygote (–617A/A), respectively. Accordingly, the allele frequency was calculated to be 74.8% and 25.2% for WT (c.–617C) and SNP (c.–617A), respectively, when both male and female patients were grouped together. It is of interest to note, however, that the allele frequency of SNP (c.–617A) was 28.6% for female patients, compared with 22.6% for male patients. Indeed, 18 female patients carried the SNP homozygote (–617A/A), a number three-fold higher than that of male patients. The ratio of homozygous SNP (–617A/A) was 10.8% for female patients, about four-fold higher than the 2.7% found in males (Table 2; P = 0.004). In contrast, the ratios of WT homozygote (–617C/C) and heterozygote (–617 C/A) were moderately higher in male patients than in female patients (Table 2). On the other hand, with respect to smoking experience, the ratio of homozygous SNP (–617A/A) was 10.4% in the non-smoker sub-population, being about three times (P = 0.021) higher than the ratio (4.5%) observed in the smokers (Table 2).

Table 2. Classification of primary lung cancer patients with respect to NRF2 genotypes, gender, and histopathology.

NRF2 gene SNP (–617)
C/C C/A A/A P-value*
Patients 216 (55.8) 147 (38.0) 24 (6.2)
Gender*
Male 127 (57.5) 88 (39.8) 6 (2.7)
Female 89 (53.6) 59 (35.5) 18 (10.8) 0.004
Histopathology
Adeno 164 (55.0) 114 (38.3) 20 (6.7)
Non-adeno 52 (58.4) 33 (37.0) 4 (4.5) 0.687
Smoking behavior*
Smoker 133 (58.4) 92 (37.0) 8 (4.5)
Non-smoker 83 (53.9) 55 (35.7) 16 (10.4) 0.021
p-Stage
I 156 (53.4) 114 (39.0) 22 (7.5)
II 28 (60.9) 16 (34.8) 2 (4.3)
III 23 (65.7) 12 (34.3) 0 (0)
IV 1 (33.3) 2 (66.7) 0 (0) 0.459

The number of patients (%).

*

P- values were calculated by Fisher’s exact test.

Abbreviation: Adeno, adenocarcinoma.

By multivariate analysis, the SNP homozygote (–617A/A) in the NRF2 gene was found to be independently associated with gender (Table 3). Among a total of 20 adenocarcinoma patients (females+males) carrying the SNP homozygote (–617A/A), 16 patients were females who had no cigarette-smoking experience (Table 4). In contrast, there were no male adenocarcinoma patients in the sub-group of non-smokers carrying the SNP homozygote (–617A/A) (Table 4). These results demonstrate a marked gender difference in terms of non-smoking patients carrying the SNP homozygote (–617A/A).

Table 3. Logistic regression analysis for evaluation of the association among homozygous SNP alleles (–617A/A) in the NRF2 gene and gender/smoking experience of lung cancer patients.

Variable P Odds Ratio 95% CI
Gender 0.041 3.48 1.05 to 11.51
Smoking 0.463 0.66 0.22 to 2.00

Abbreviation: CI, confidence interval.

Gender code: 1 = female; 0 = male.

Smoking experience code: 1 = smoker; 0 = non-smoker.

The multivariate logistic regression analysis was performed under two categories, i.e., the gender (female and male) and the smoking experience (smoker and non-smoker).

Table 4. Classification of primary lung cancer patients with respect to NRF2 genotypes, smoking behavior, adenocarcinoma, and gender.

NRF2 gene SNP (–617)
C/C C/A A/A P-value*
Patients (M+F) 216 147 24
Smoking behavior
Smoker (M) 114 75 6
Smoker (F) 19 17 2
Non-smoker (M) 13 13 0
Non-smoker (F) 70 42 16 0.014
Adenocarcinoma
Smoker (M) 75 48 4
Smoker (F) 15 16 0
Non-smoker (M) 11 13 0
Non-smoker (F) 63 37 16 0.003
*

P-values were calculated by Fisher’s exact test.

Abbreviation: M, male; F, female.

To gain more insight into the gender difference among 24 patients homozygous for the SNP (c.–617A/A), we have analyzed the genetic polymorphisms of human CYP2A6*4 (whole gene deletion) and the numbers of (GT)n repeats in the HO-1 gene 5′-flanking region. These data are summarized in Table 5. CYP2A6*4/*4 (whole gene deletion) was found in only one female patient in this subgroup (Table 5), whereas among 387 lung cancer patients, CYP2A6*4/*4 was detected in seven patients (1.8%) with lung adenocarcinoma. The number of (GT)n repeats in the HO-1 gene 5′-flanking region varied greatly (14 to 34 repeats) among these 24 patients.

Table 5. Clinicopathological profiling of 24 patients harboring homozygous SNP alleles (–617A/A) in the NRF2 gene.

Case Histology p stage Age Gender smoker (GT)n repeats CYP2A6 EGFR mutation Gefitinib therapy
1 Ad IIA 74 F non-smoker 19,30 Wt Exon 21 Yes
2 Ad IA 53 F non-smoker 23 *4/*4 Exon 19 –
3 Ad IB 70 F non-smoker 24 Wt Exon 21 –
4 Mix IB 63 F non-smoker 34 Wt Exon 21 –
†5 Ad IB 61 F non-smoker 23 Wt Exon 19 –
6 Ad IB 72 F non-smoker 22 Wt Exon 21 –
7 Ad IA 40 F non-smoker 19 Wt Exon 19 –
8 Ad IA 71 F non-smoker 17 Wt Exon 21 –
9 Ad IA 45 F non-smoker 30 Wt Exon 21 –
10 Ad IA 74 F non-smoker 30 Wt Exon 21 –
11 Ad IA 73 F non-smoker 22 Wt Exon 19 –
12 Ad IA 69 F non-smoker 22 Wt Exon 21 –
13 Ad IA 62 F non-smoker 28 Wt None –
14 Ad IA 73 F non-smoker 14 Wt Exon 19 –
15 Ad IA 63 F non-smoker 15 Wt Exon 19 –
16 Ad IIA 73 F non-smoker 30 Wt None Yes
17 Sq IA 72 F smoker 20 Wt None –
18 Ple IA 75 F smoker 29 Wt None –
19 Ad IA 74 M smoker 23,27 Wt None –
20 Sq IA 78 M smoker 23 Wt None –
21 Ad IA 65 M smoker 30 Wt Exon 21 –
22 Sq IB 75 M smoker 20 Wt None –
23 Ad IA 77 M smoker 28,31 Wt Exon 21 –
24 Ad IA 80 M smoker 29,30 Wt Exon 19 –

Abbreviation: Ad, adenocarcinoma; Mix, adenocarcinoma and squamous cell carcinoma; Ple, pleomorphic carcinoma; Sq, squamous cell carcinoma; F, female; M, male; Wt, wild type.

†

Patient (case 5) died because of primary pancreatic cancer.

Interestingly, as shown in Table 5, either exon 19 or exon 21 of the EGFR gene was frequently mutated in female patients who were non-smokers and had homozygous SNP alleles (–617A/A). Two of those patients were diagnosed as p-stage IIA (cases 1 and 16). They were treated first surgically and then with gefitinib. These patients had no relapse over 1879 days (case 1) and 939 days (case 16).

Association of SNP (c.–617 C>A) in the NRF2 Gene with Overall Survival of Lung Cancer Patients

We investigated a potential association between SNP (c.–617 C>A) in the NRF2 gene and the overall survival of lung cancer patients, since we could obtain follow-up information on 369 patients among the total of 387 lung cancer patients over 1,700 days after surgical operation at Kanagawa Cancer Center. A survival Kaplan-Mayer plot is shown in Figure 2A. Our univariate analysis has revealed that lung cancer patients (p-stages I to IV) carrying homozygous SNP alleles (–617A/A) in the NRF2 gene experienced significantly better overall survival, as compared with patients with heterozygous alleles (c.–617C/A) (log-rank P = 0.021). In contrast, no association was found between patients with homozygous WT alleles (–617C/C) and those with heterozygous alleles (c.–617C/A) (Figure 2A). It is important to mention that one female patient with the homozygous SNP (–617A/A) (case 5 in Table 5) died due to primary pancreatic cancer during the follow-up study.

Figure 2. Kaplan-Meier plots showing the overall survival of patients harboring the WT homozygote (–617C/C), WT/SNP heterozygote (–617C/A), or SNP homozygote (–617A/A) in the NRF2 gene.

Figure 2

Patients with p-stages I to IV (A) and p-stage I only NSCLC (B). The number of patients at times 0, 500, 1000, or 1500 days after surgical operation is described along with genotypes of the NRF2 gene.

We further analyzed the associations between the NRF2 genotypes and patients’ overall survival in the p-stage I of non-small cell lung cancer (NSCLC) including adenocarcinoma, squamous cell cancer, and large cell cancer. In the case of stage I, patients (n = 285) were treated by surgical excision of the tumor, with no follow-up treatment by adjuvant therapy or chemotherapy. Nonetheless, patients harboring homozygous alleles (–617A/A) in the NRF2 gene exhibited the best record of overall survival among the members of these three different allele groups (Figure 2B).

Potential Link between NRF2 and MDM2 Genotypes

NRF2 reportedly regulates expression of the MDM2 gene that encodes a crucial negative regulator of p53. To gain insight into a potential link between MDM2 and NRF2 genotypes, we have analyzed the SNP (c.309T>G) in the MDM2 gene as well as the SNP (–617C>A) in the NRF2 gene using the genomic DNA samples from lung cancer patients. Table 6 summarizes the corresponding results, where the number of patients harboring T/T, T/G, or G/G genotype in the MDM2 gene has been given for each genotype of the NRF2 gene (i.e., –617C/C, C/A. or A/A). In the genotype groups of –617C/C and –617C/A, the 309G (SNP) allele frequency was 0.606 and 0.541, respectively. In contrast, the SNP allele frequency was found to be markedly lower (0.333) in the genotype group of NRF2 –617A/A. In the case of adenocarcinoma, female patients harboring 309T/T, T/G, and G/G genotype in the MDM2 gene were 7, 8, and 1, respectively (Table S1); most patients were harboring the 309T (WT) allele in the MDM2 gene.

Table 6. Classification of primary lung cancer patients with respect to genotypes of NRF2 and MDM2 genes.

NRF2 (–617)
C/C C/A A/A
Patients (N) 216 147 24
MDM2 (c.309) N (%) N (%) N (%)
T/T 35 (16.2) 36 (24.5) 11 (45.8)
T/G 100 (46.3) 63 (42.9) 10 (41.7)
G/G 81 (37.5) 48 (32.6) 3 (12.5)

N, the number of patients; % in parentheses.

Discussion

SNP (c.–617C>A) in the NRF2 Gene and Female Non-smokers with Adenocarcinoma

Recent genome-wide association studies (GWAS) have identified several loci associated with lung cancer susceptibility in never-smoking women in Asia; they were, 5p15.33 (rs2736100) [30], 6p21.3 (rs3817963) [30], 3q28 (rs10937405 and rs4488809) [31], 10q25.2 (rs7086803) [32], 6q22.2 (rs9387478) [32], and 6p21.32 (rs2395185) [32].

In the present study, differing from those reports, we found that SNP (c.–617C>A; rs6721961) in the NRF2 gene located on chromosome 2q31.2 is associated with Japanese non-smoking female patients with adenocarcinoma and their overall survival. While the allele frequency of SNP c.–617C>A in the NRF2 gene was estimated to be 25.2%, non-smoking females harboring homozygous alleles (–617A/A) had a markedly higher incidence of adenocarcinoma (Table 4, Table 5), as compared with non-smoking males harboring the same genotype. In other words, the –617 C>A SNP in the ARE-like loci of the human NRF2 gene seems to be associated with female non-smokers with adenocarcinoma. Furthermore, it is noteworthy that the EGFR gene was frequently mutated in female patients who were non-smokers and had homozygous SNP alleles (–617A/A) in the NRF2 gene (Table 5), suggesting a potential link between the SNP homozygote (–617A/A) and EGFR gene mutations.

Recent studies have demonstrated that mutations in the tyrosine kinase domain of the EGFR are frequently found among non-smoker patients with NSCLC [33]. Approximately 90% of these mutations are exon 19 deletions or exon 21 L858R point mutations in the tyrosine kinase domain [34]. In the vast majority of cases, EGFR mutations are non-overlapping with other oncogenic mutations (e.g., KRAS mutations, ALK rearrangements) found in NSCLC [34]. A large randomized clinical study named the “IRESSA Pan-Asian Study (IPASS)” has reported that high rates of mutations in the EGFR gene were observed in female NSCLC patients without smoking experience [35]. A high incidence of EGFR gene mutations was reported in female non-smokers with adenocarcinoma of lung: 30–40% in East Asians, as compared with 15% in Caucasians [36]–[38]. Both EGFR gene mutations and homozygous SNP alleles (–617A/A) in the NRF2 gene were frequently observed in Japanese female adenocarcinoma patients without smoking experience (Table 4). As shown in Table 7, ethnic group-dependent difference was observed in the NRF2 genotype, where the frequency of the –617A allele is high in Japanese, Taiwanese, and Chinese populations. Thus, it is of great interest to investigate the link between the SNP homozygote (–617A/A) and EGFR gene mutations and to gain insight into the underlying molecular mechanism.

Table 7. Frequencies of wild type (–617C) and SNP (–617A) alleles in the NRF2 gene among different ethnic groups.

Allele frequency NRF2 (–617)
Ethnic group C A C/C C/A A/A N Data source
African 0.925 0.075 0.850 0.150 0.000 246 *
African-American 0.893 0.107 0.787 0.213 0.000 61 *
European 0.883 0.117 0.778 0.208 0.013 379 *
American in Utah 0.888 0.112 0.788 0.200 0.012 85 *
American mixed 0.862 0.138 0.757 0.210 0.033 181 *
Mexican in Los Angels 0.803 0.197 0.667 0.273 0.061 66 *
Japanese 0.775 0.225 0.618 0.315 0.067 89 *
Japanese (lung cancer) 0.748 0.252 0.558 0.380 0.062 387 This study
Taiwanese 0.726 0.274 0.524 0.405 0.071 168 This study
Chinese in Beijing 0.722 0.278 0.515 0.412 0.072 97 *
Southern Han Chinese 0.710 0.290 0.500 0.420 0.080 100 *

N, the number of subjects.

*

1000 Genomes. http://browser.1000genomes.org/Homo_sapiens/Variation/Population?db=corer=2∶178129537–178130537;v = rs6721961;vdb = variation;vf = 4574214.

SNP (c.–617C>A) in the NRF2 Gene as a Biomarker for Prognosis of Lung Cancer

The NRF2 gene is regarded as a double-edged sword. It plays an important role in protecting normal cells from external toxic challenges and oxidative stress, whereas it can also endow cancer cells resistance to anticancer drugs. Recently it has been reported that NRF2 contributes to the malignant phenotypes of cancer cells in vitro, including aggressive cell proliferation, drug resistance, and metabolic re-programming [8],[20]. Indeed, NRF2 activation is involved in the emergence of cancer resistance to various anticancer drugs by transcriptionally activating a battery of self-defense genes, such as those encoding antioxidant enzymes, phase II detoxifying enzymes, and ABC transporters [23]–[25]. ABCG2 is known to mediate the efflux of gefitinib (Iressa®) from cancer cells [39], and its expression is regulated by NRF2 [26] and the EGFR-tyrosine kinase cascade [40], [41].

As revealed in the Kaplan-Meier plot (Figure 2), lung cancer patients (both females and males) with homozygous SNP alleles (–617A/A) in the NRF2 gene had markedly high overall survival. Univariate analysis showed a significant difference between the –617 A/A and –617 C/A groups in terms of overall survival (log-rank P = 0.021). It is important to note that, except for one patient (case 5 in Table 5) who died because of primary pancreatic cancer, all of the adenocarcinoma patients with homozygous SNP alleles (–617A/A) in the NRF2 gene survived over 1,000 days after surgical excision of the tumor that was followed up with neither adjuvant therapy nor chemotherapy, even when p-stage I patients were considered alone (Figure 2B). To our knowledge, this is the first report providing clinical evidence that homozygous SNP (–617A/A), as one of the intrinsic genetic polymorphisms in the NRF2 gene, is associated with overall survival of lung cancer patients.

SNP –617C>A is considered to play a pivotal role in the positive feedback loop of transcriptional activation of the NRF2 gene to regulate the NRF2 protein level (Figure 3). Since the SNP (c.–617A) in the ARE-like loci of the human NRF2 gene decreases the binding affinity to the transcription factors of NRF2/small MAF [22], it is anticipated that the homozygote –617A/A significantly attenuates the positive feedback loop of transcriptional activation of the NRF2 gene.

Figure 3. Schematic illustration showing the effect of NRF2 SNP–617C>A and MDM2 SNP c.309 T>G on the p53-mediated suppression of cancer cell proliferation and drug resistance.

Figure 3

In response to oxidative stress, electrophiles challenge, or protein kinase-mediated phosphorylation (e.g., via the PI3K-Akt pathway), the NRF2 protein is released from KEAP1 and then translocated into the nuclei. The SNP–617C>A in the ARE-like motif is considered to play a role in the positive feedback loop of transcriptional activation of the NRF2 gene. The SNP homozygote (–617 A/A) significantly attenuates the positive feedback loop and also expression of NRF2-target genes, such as MDM2 and ABCG2. In the case of MDM2 gene expression, the SNP (c.309 T>G) in the first intron of the MDM2 gene increases the binding affinity toward Sp1 and results in higher expression levels of MDM2 protein. MDM2 protein, thus highly expressed, binds to p53 (wild type; Wt) protein and leads to ubiquitination and proteasomal degradation of p53 (Wt) protein. Combination of the 309G (SNP) allele of the MDM2 gene and the –617C (Wt) allele of the NRF2 gene may have negative impacts on p53 (Wt)-mediated tumor suppression. On the other hand, lung cancer patients harboring both the 309T (Wt) allele of the MDM2 gene and the –617A (SNP) allele of the NRF2 gene may have better prognosis due to the tumor suppressor function of p53 (Wt), such as apoptosis and p21WAF1/cip1-mediated cell cycle arrest. Expression of the ABCG2 gene is known to be up-regulated by NRF2. Gefitinib, an inhibitor of EGFR tyrosine kinase, is extruded by ABCG2 out of cancer cells. Thus, NRF2-mediated induction of ABCG2 expression can confer cancer cells with acquired resistance to gefitinib and other anticancer drugs.

It has recently been reported that NRF2 regulates the basal expression of the murine double minute-2 (Mdm2) gene [42]. Since human MDM2 is an oncoprotein that binds to p53 protein and inactivates the tumor suppressor activity of p53 [43], NRF2 can indirectly contribute to p53-mediated cell cycle control and/or apoptosis [44]. One SNP in the MDM2 promoter region, a T-to-G change at nucleotide c.309 (rs2279744) in the first intron, increases the binding affinity toward stimulatory protein 1 (Sp1) and results in higher expression levels of MDM2 protein [45]. This, in turn, attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans [45]. Asians, including Japanese, have higher frequencies of the 309G allele as compared with African-Americans and Caucasians [46]. It has been reported that this polymorphism in the MDM2 gene is associated with the prognosis for several types of tumors, including lung cancer [47].

As demonstrated in Table 6, the 309G (SNP) allele frequency of the MDM2 gene was markedly lower (0.333) in the genotype group of NRF2 –617A/A, as compared with those observed in the genotype groups of NRF2 –617C/C and –617C/A. It is suggested that lung cancer patients harboring both the 309T (WT) allele in the MDM2 gene and the –617A allele in the NRF2 gene have better prognosis owing to well-controlled tumor suppression via cell cycle arrest and/or apoptosis mediated by p53 (WT); refer to Figure 3. This may explain, in part, our finding that the lung cancer patients with homozygous SNP alleles (–617A/A) in the NRF2 gene had markedly high overall survival rates (Figure 2).

In cancer tissues, somatic mutations take place frequently. In addition to the above-mentioned genetic polymorphisms as the “intrinsic” mechanism, mutations in the KEAP1 and/or NRF2 genes are the “acquired” mechanisms that lead to constitutive activation of NRF2. In fact, mutations in the NRF2 and KEAP1 genes have been found in carcinomas of the lung [12], breast [48], liver [49], and stomach [49]. Abnormalities in NRF2 activity were correlated with poor prognosis, when measured either as recurrence-free or overall 5-year survival. A recent immunohistochemical study has revealed that increased expression of NRF2 protein and decreased expression of KEAP1 protein are common abnormalities in NSCLC and are associated with poor prognosis [50]. Importantly, abnormal expression of NRF2 and KEAP1 proteins was more common than that of the corresponding gene mutaions [50], suggesting the involvement of other mechanisms such as intrinsic genetic polymorphisms of those genes. To bridge the gap between the homozygous SNP alleles (–617A/A) in the NRF2 gene and the high overall survival of lung cancer patients shown in this study, we need to carry out further clinical follow-up studies with lung cancer patients (p-stages III and IV) who have been subjected to chemotherapeutic treatments. As exemplified in the present study, genetic polymorphisms/mutations and fine balances among NRF2, KEAP1, MDM2, p53, p21WAF1/cip1 and other genes are likely to contribute to the progression of cancer and, consequently, the prognosis of cancer patients.

Development of a Rapid Genotyping Method for Personalized Cancer Therapy

One of the challenges in lung cancer management is to identify biomarkers for personalized cancer therapy. To effectively advance personalized medicine, cost-effective methods should be developed for genotyping. It would be desirable to include such information in each patient’s record as guidance for medial doctors to provide individualized treatment. In the present study, we have developed a rapid genetic testing method to elucidate the impact of genetic polymorphisms in the NRF2 gene on the risk and survival of patients with primary lung cancer. The method enables the detection of genetic polymorphisms in target genes within 30 to 45 minutes under isothermal conditions that do not require DNA isolation and PCR amplification. Thus, this genotyping method would provide a simple and practical tool for personalized cancer therapy and assessment of prognosis.

Materials and Methods

Patients and Sample Collection

This clinical research was conducted according to the Declaration of Helsinki Principles. Under written informed consent, we collected blood samples from patients with primary lung cancer who received surgical operation at the Kanagawa Cancer Center. Protocols for sample collection, anonymity, storage, and transportation to RIKEN Yokohama Institute required for the present study were approved by both the Institutional Review Board of the Kanagawa Cancer Center Research Institute and the Research Ethics Committee at RIKEN Yokohama Institute. Procedures for analyzing the HO-1 gene 5′-flanking region sequence as well as for genotyping the NRF2, CYP2A6, and MDM2 genes in the genomic DNA samples were approved by the Research Ethics Committee at RIKEN Yokohama Institute.

The Taiwanese samples (N = 168) used in this study were randomly selected from the Han- Chinese Cell and Genome Bank in Taiwan described previously [51], in which more than 3,300 healthy controls were collected and randomly selected through registry.

Preparation of Genomic DNA

Peripheral venous blood samples from lung cancer patients were collected into tubes containing Na2EDTA. Genomic DNA was extracted by the use of the QIAamp blood kit (QIAGEN K.K., Tokyo, Japan) according to the manufacturer’s instructions.

Genotyping

Based on the SmartAmp method, rapid genotyping primers were developed for detecting both the SNP (c.–617C/A) in the ARE-like loci of the human NRF2 gene (Figure 1) and the CYP2A6*4 genotype (whole gene deletion) [51]. We used exciton-controlled hybridization-sensitive fluorescent primers for optical detection of genotyping reactions (Figure 1). After genomic DNA was denatured at 98°C for 3 min, the genotyping reactions were allowed to proceed isothermally at 60°C for 60 min in a Mx3000P PCR system (Agilent Technologies, Santa Clara, CA, USA). The SNP c.309T>G in of the MDM2 gene were detected by the Duplex SmartAmp method, as described previously [46].

Analysis of Length Variability of (GT)n Repeats in the HO-1 Gene Promoter

The partial genomic DNA including (GT)n repeats located in the 5′-flanking region of the HO-1 gene was amplified by the polymerase chain reaction (PCR) [53], [54] with a fluorescence probe-labeled sense primer p1-s (5′-AGAGCCTGCAGCTTCTCAGA-3′) and an unlabeled anti-sense primer p1-as (5′-ACAAAGTCTGGCCATAGGAC-3′). These primers were designed according to the previously reported sequences [55]. The PCR cycle program of 95°C for 30 seconds, 63°C for 30 seconds, and 60°C for 30 seconds was carried out for a total of 30 cycles. The resulting PCR products were visualized by electrophoresis in 3% agarose gels containing ethidium bromide. The electrophoresis revealed two differently-sized PCR products attributable to two alleles with different (GT)n repeat sequences in the HO-1 gene. The (GT)n repeats in the PCR products were analyzed with a laser-based automated DNA sequencer (ABI PRISM 3100 DNA Analyzer, Applied Biosystems Ltd., Tokyo, Japan).

Analysis of Mutation Status in the EGFR Gene

DNA samples were isolated from frozen tissues or formalin-fixed and paraffin-embedded tissue sections that had been surgically excised from lung cancer loci. Epidermal growth factor receptor (EGFR) gene exons 19 and 21 were analyzed for their mutational status by the loop-hybrid mobility shift assay, a PCR-based heteroduplex analysis method, as described previously [56], [57].

Statistical Analysis

The association of lung cancer with the allele frequency of the gene of interest was assessed by considering the confounding effects derived from known risk factors, such as age, gender, smoking history, and histopathology. After preliminary bivariate analysis by using Fisher’s exact test or χ2test, the multivariate logistic regression method was performed to estimate independent variables associated with the SNP homozygote (–617A/A) in the NRF2 gene. Furthermore, the Kaplan-Meier method was used to estimate survival curves for overall survival. Log-rank tests were used to compare the survival curves of patients in different NRF2 subgroups. The statistical significance of all the data was tested by the analysis of variance. We performed statistical analysis with the SPSS statistics program (v.19.0; SPSS Inc., Chicago, USA). Values of P<0.05 were considered to indicate statistical significance.

Supporting Information

Table S1

Classification of female adenocarcinoma patients with respect to genotypes of NRF2 and MDM2 genes.

(DOC)

Acknowledgments

The authors thank Dr. Taisei Mushiroda (RIKEN Center for Integrative Medical Sciences) for his kind advice on the ethnic difference of NRF2 genotypes. In addition, thanks go to members of the SmartAmp team for their generous support in performing the DNA sequencing experiments at RIKEN Omics Science Center.

Funding Statement

This study was supported by a Japan Science and Technology Agency (JST) research project named “Development of the world’s fastest SNP detection system” (to TI) and Research This study was supported by a grant for RIKEN Omics Science Center from the Ministry of Education, Culture, Sports, Science and Technology (to YH). The funders had no role in study design, data, collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Centers for Disease Control and Prevention (CDC) website. Available: http://www.cdc.gov/cancer/lung/basic_info/risk_factors.html. Accessed 2013 Feb 10.
  • 2.National Cancer Institute (NCI) website. Available: http://www.cancer.gov/cancertopics/types/lung. Accessed 2013 Feb 10.
  • 3. Stämpfli MR, Anderson GP (2009) How cigarette smoke skews immune responses to promote infection, lung disease and cancer. Nature Reviews 9: 377–84. [DOI] [PubMed] [Google Scholar]
  • 4. Motohashi H, Yamamoto M (2004) Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol Med 10: 549–57. [DOI] [PubMed] [Google Scholar]
  • 5. Kobayashi M, Yamamoto M (2006) Nrf2-Keap1 regulation of cellular defense mechanisms against electrophiles and reactive oxygen species. Adv Enzyme Regul 46: 113–40. [DOI] [PubMed] [Google Scholar]
  • 6. Nguyen T, Nioi P, Pickett CB (2009) The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J Biol Chem 284: 13291–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Lau A, Villeneuve NF, Sun Z, Wong PK, Zhang DD (2008) Dual roles of Nrf2 in cancer. Pharmacol Res 58: 262–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Homma S, Ishii Y, Morishima Y, Yamadori T, Matsuno Y, et al. (2009) Nrf2 enhances cell proliferation and resistance to anticancer drugs in human lung cancer. Clin Cancer Res 15: 3423–32. [DOI] [PubMed] [Google Scholar]
  • 9. Hayes JD, McMahon M (2009) NRF2 and KEAP1 mutations: permanent activation of an adaptive response in cancer. Trends Biochem Sci 34: 176–88. [DOI] [PubMed] [Google Scholar]
  • 10. Taguchi K, Motohashi H, Yamamoto M (2011) Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells 16: 123–40. [DOI] [PubMed] [Google Scholar]
  • 11. Yamadori T, Ishii Y, Homma S, Morishima Y, Kurishima K, et al. (2012) Molecular mechanisms for the regulation of Nrf2-mediated cell proliferation in non-small-cell lung cancers. Oncogene 31: 4768–77. [DOI] [PubMed] [Google Scholar]
  • 12. Sporn MB, Liby KT (2012) NRF2 and cancer: the good, the bad and the importance of context. Nature Rev Cancer 12: 564–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Moi P, Chan K, Asunis I, Cao A, Kan YW (1994) Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc Natl Acad Sci U S A 91: 9926–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Itoh K, Wakabayashi N, Katoh Y, Ishii Y, Igarashi K, et al. (1999) Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 13: 76–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Itoh K, Igarashi K, Hayashi N, Nishizawa M, Yamamoto M (1995) Cloning and characterization of a novel erythroid cell-derived CNC family transcription factor heterodimerizing with the small Maf family proteins. Mol Cell Biol 15: 4184–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, et al. (2000) Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biol Chem 275: 16023–9. [DOI] [PubMed] [Google Scholar]
  • 17. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, et al. (2001) Sensitivity to carcinogenesis is increased and chemoprotective efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient mice. Proc Natl Acad Sci USA 98: 3410–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Cho HY, Reddy SP, DeBiase A, Yamamoto M, Kleeberger SR (2005) Gene expression profiling of NRF2-mediated protection against oxidative injury. Free Radic Biol Med 38: 325–43. [DOI] [PubMed] [Google Scholar]
  • 19. Kwak MK, Itoh K, Yamamoto M, Kensler TW (2002) Enhanced expression of the transcription factor Nrf2 by cancer chemopreventive agents: role of antioxidant response element-like sequences in the nrf2 promoter. Mol Cell Biol 22: 2883–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Mitsuishi Y, Taguchi K, Kawatani Y, Shibata T, Nukiwa T, et al. (2012) Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell 22: 66–79. [DOI] [PubMed] [Google Scholar]
  • 21. Yamamoto T, Yoh K, Kobayashi A, Ishii Y, Kure S, et al. (2004) Identification of polymophisms in the promoter region of the human NRF2 gene. Biochem Biophys Res Commun 321: 72–9. [DOI] [PubMed] [Google Scholar]
  • 22. Marzec JM, Christie JD, Reddy SP, Jedlica AE, Vuong H, et al. (2007) Functional polymorphisms in the transcription factor NRF2 in humans increase the risk of acute lung injury. FASEB 21: 2237–46. [DOI] [PubMed] [Google Scholar]
  • 23. Nakata K, Tanaka Y, Nakano T, Adachi T, Tanaka H, et al. (2006) Nuclear receptor-mediated transcription regulation in phase I, II, and III xenobiotic metabolizing systems. Drug Metab Pharmacokinet 21: 437–57. [DOI] [PubMed] [Google Scholar]
  • 24. Shen G, Kong AN (2009) Nrf2 plays an important role in coordinated regulation of phase II drug metabolism enzymes and phase III drug transporters. Biopharm Drug Dispos 30: 345–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Adachi T, Nakagawa H, Chung I, Hagiya Y, Hoshijima K, et al. (2007) Nrf2-dependent and -independent induction of ABC transporters ABCC1, ABCC2, and ABCG2 in HepG2 cells under oxidative stress. J Exp Ther Oncol 6: 335–48. [PubMed] [Google Scholar]
  • 26. Sing A, Wu H, Zhang P, Happel C, Ma J, et al. (2010) Expression of ABCG2 (BCRP) is regulated by Nrf2 in cancer cells that confers side population and chemoresistance phenotype. Mol Cancer Ther 9: 2365–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Mitani Y, Lezhava A, Kawai Y, Kikuchi T, Oguchi-Katayama A, et al. (2007) Rapid SNP diagnostics using asymmetric isothermal amplification and a new mismatch-suppression technology. Nat Methods 4: 257–62. [DOI] [PubMed] [Google Scholar]
  • 28. Ishikawa T, Hayashizaki Y (2013) Clinical SNP detection by SmartAmp method. Methods Mol Biol 1015: 55–69. [DOI] [PubMed] [Google Scholar]
  • 29.Travis WD, Brambilla E, Müller-Hermelink HK, Harris CC (2004) Pathology and genetics of tumours of the lung, pleura, thymus and heart. Lyon, France: IARC Press.
  • 30.Hsiung CA, Lan Q, Hong YC, Chen CJ, Hosgood HD, et al.. (2010) The 5p15.33 locus is associated with risk of lung adenocarcinoma in never-smoking females in Asia. PLoS Genet 6: pii: e1001051. [DOI] [PMC free article] [PubMed]
  • 31. Hosgood HD 3rd, Wang WC, Hong YC, Wang JC, Chen K, et al. (2012) Genetic variant in TP63 on locus 3q28 is associated with risk of lung adenocarcinoma among never-smoking females in Asia. Hum Genet. 131: 1197–203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Lan Q, Hsiung CA, Matsuo K, Hong YC, Seow A, et al. (2012) Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. Nature Genet 44: 1330–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Toyooka S, Matsuo K, Shigeharu H, Kosaka T, Tokumo M, et al. (2007) The impact of sex and smoking status on the mutational spectrum of epidermal growth factor receptor gene in non small cell lung cancer. Clin Cancer Res 13: 5622–5. [DOI] [PubMed] [Google Scholar]
  • 34. Ladanyi M, Pao W (2008) Lung adenocarcinoma: guiding EGFR-targeted therapy and beyond. Mod Pathol 21 Suppl 2S16–22. [DOI] [PubMed] [Google Scholar]
  • 35. Fukuoka M, Wu YL, Thongprasert S, Sunpaweravong P, Leong SS, et al. (2011) Biomarker analyses and final overall survival results from a phase III, randomized, open-label, first-line study of gefitinib versus carboplatin/paclitaxel in clinically selected patients with advanced non-small-cell lung cancer in Asia (IPASS). J Clin Oncol 29: 2866–74. [DOI] [PubMed] [Google Scholar]
  • 36. Paez JG, Jänne PA, Lee JC, Tracy S, Greulich H, et al. (2004) EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 304: 1497–500. [DOI] [PubMed] [Google Scholar]
  • 37. Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, et al. (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 350: 2129–39. [DOI] [PubMed] [Google Scholar]
  • 38. Pao W, Miller V, Zakowski M, Doherty J, Politi K, et al. (2004) EGF receptor gene mutations are common in lung cancers from “never smokers” and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 101: 13306–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Saito H, Hirano H, Nakagawa H, Fukami T, Oosumi K, et al. (2006) A new strategy of high-speed screening and quantitative structure-activity relationship analysis to evaluate human ATP-binding cassette transporter ABCG2-drug interactions. J Pharmacol Exp Ther 317: 1114–24. [DOI] [PubMed] [Google Scholar]
  • 40. Meyer zu Schwabedissen HE, Grube M, Dreisbach A, Jedlitschky G, Meissner K, et al. (2006) Epidermal growth factor-mediated activation of the map kinase cascade results in altered expression and function of ABCG2 (BCRP). Drug Metab. Dispos. 34: 524–33. [DOI] [PubMed] [Google Scholar]
  • 41. Huang WC, Chen YJ, Li LY, Wei YL, Hsu SC, et al. (2011) Nuclear translocation of epidermal growth factor receptor by Akt-dependent phosphorylation enhances breast cancer-resistant protein expression in gefitinib-resistant cells. J. Biol. Chem. 286: 20558–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. You A, Nam CW, Wakabayashi N, Yamamoto M, Kensler TW, et al. (2011) Transcriptional factor Nrf2 maintains the basal expression of Mdm2: An implication of the regulation of p53 signaling by Nrf2. Arch Biochem Biophys 507: 356–364. [DOI] [PubMed] [Google Scholar]
  • 43. Freedman DA, Wu L, Levine AJ (1999) Functions of the MDM2 oncoprotein. Cell Mol Life Sci 55: 96–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Rotblat B, Melino G, Knight RA (2012) NRF2 and p53: Januses in cancer? Oncotarget 3: 1272–1283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Bond GL, Hu WW, Bond EE, Robins H, Lutzker SG, et al. (2004) A single nucleotide polymorphism in the MDM2 promoter attenuates the p53 tumor suppressor pathway and accelerates tumor formation in humans. Cell 119: 591–602. [DOI] [PubMed] [Google Scholar]
  • 46. Enokida Y, Shimizu K, Atsumi J, Lezhava A, Tanaka Y, et al. (2013) Rapid detection of SNP (c.309T>G) in the MDM2 gene by the Duplex SmartAmp method. PLoS One. 8: e60151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Han JY, Lee GK, Jang DH, Lee SY, Lee JS (2008) Association of p53 codon 72 polymorphism and MDM2 SNP309 with clinical outcome of advanced nonsmall cell lung cancer. Cancer 113: 799–807. [DOI] [PubMed] [Google Scholar]
  • 48. Sjöblom T, Jones S, Wood LD, Parsons DW, Lin J, et al. (2006) The consensus coding sequences of human breast and colorectal cancers. Science 314: 268–74. [DOI] [PubMed] [Google Scholar]
  • 49. Yoo NJ, Kim HR, Kim YR, An CH, Lee SH (2012) Somatic mutations of the KEAP1 gene in common solid cancers. Histopathology 60: 943–52. [DOI] [PubMed] [Google Scholar]
  • 50. Solis LM, Behrens C, Dong W, Suraokar M, Ozburn NC, et al. (2010) Nrf2 and Keap1 abnormalities in non-small cell lung carcinoma and association with clinicopathologic features. Clin Cancer Res 16: 3743–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Pan WH, Fann CS, Wu JY, Hung YT, Ho MS, et al. (2006) Han Chinese cell and genome bank in Taiwan: purpose, design and ethical considerations. Hum Hered 61: 27–30. [DOI] [PubMed] [Google Scholar]
  • 52. Azuma K, Lezhava A, Shimizu M, Kimura Y, Ishizu Y, et al. (2011) Direct genotyping of Cytochrome P450 2A6 whole gene deletion from human blood samples by the SmartAmp method. Clin Chim Acta 412: 1249–51. [DOI] [PubMed] [Google Scholar]
  • 53. Kimpara T, Takeda A, Watanabe K, Itoyama Y, Ikawa S, et al. (1997) Microsatellite polymorphism in the human heme oxygenase-1 gene promoter and its application in association studies with Alzheimer and Parkinson disease. Hum Genet 100: 145–7. [DOI] [PubMed] [Google Scholar]
  • 54. Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, et al. (1996) Regulation of human heme oxygenase-1 gene expression under thermal stress. Blood 87: 5074–84. [PubMed] [Google Scholar]
  • 55. Shibahara S, Sato M, Muller RM, Yoshida T (1989) Structural organization of the human heme oxygenase gene and the function of its promoter. Eur J Biochem 179: 557–63. [DOI] [PubMed] [Google Scholar]
  • 56. Oshita F, Matsukuma S, Yoshihara M, Sakuma Y, Ohgane N, et al. (2006) Novel heteroduplex method using small cytology specimens with a remarkably high success rate for analysing EGFR gene mutations with a significant correlation to gefitinib efficacy in non-small-cell lung cancer. Br J Cancer 95: 1070–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Matsukuma S, Yoshihara M, Kasai F, Kato A, Yoshida A, et al. (2006) Rapid and simple detection of hot spot point mutations of epidermal growth factor receptor, BRAF, and NRAS in cancers using the loop-hybrid mobility shift assay. J Mol Diagn 8: 504–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1

Classification of female adenocarcinoma patients with respect to genotypes of NRF2 and MDM2 genes.

(DOC)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES