Skip to main content
PLOS One logoLink to PLOS One
. 2013 Sep 12;8(9):e72410. doi: 10.1371/journal.pone.0072410

Characterization of the Complete Mitochondrion Genome of Diurnal Moth Amata emma (Butler) (Lepidoptera: Erebidae) and Its Phylogenetic Implications

Hui-Fen Lu 1,2, Tian-Juan Su 1, A-Rong Luo 1, Chao-Dong Zhu 1,*, Chun-Sheng Wu 1,*
Editor: Vladimir N Uversky3
PMCID: PMC3771990  PMID: 24069145

Abstract

Mitogenomes can provide information for phylogenetic analyses and evolutionary biology. The complete mitochondrial genome of Amata emma (Lepidoptera: Erebidae) was sequenced and analyzed in the study. The circular genome is 15,463 bp in size, with the gene content, orientation and order identical to other ditrysian insects. The genome composition of the major strand shows highly A+T biased and exhibits negative AT-skew and GC-skew. The initial codons are the canonical putative start codons ATN with the exception of cox1 gene which uses CGA instead. Ten genes share complete termination codons TAA, and three genes use incomplete stop codons TA or T. Additionally, the codon distribution and Relative Synonymous Codon Usage of the 13 PCGs in the A. emma mitogenome are consistent with those in other Noctuid mitogenomes. All tRNA genes have typical cloverleaf secondary structures, except for the trnS1 (AGN) gene, in which the dihydrouridine (DHU) arm is simplified down to a loop. The secondary structures of two rRNA genes broadly conform with the models proposed for these genes of other Lepidopteran insects. Except for the A+T-rich region, there are three major intergenic spacers, spanning at least 10 bp and five overlapping regions. There are obvious differences in the A+T-rich region between A. emma and other Lepidopteran insects reported previously except that the A+T-rich region contains an ‘ATAGA’ -like motif followed by a 19 bp poly-T stretch and a (AT)9 element preceded by the ‘ATTTA’ motif. It neither has a poly-A (in the α strand) upstream trnM nor potential stem-loop structures and just has some simple structures like (AT)nGTAT. The phylogenetic relationships based on nucleotide sequences of 13 PCGs using Bayesian inference and maximum likelihood methods provided a well-supported a broader outline of Lepidoptera and which agree with the traditional morphological classification and recently working, but with a much higher support.

Introduction

The ancestral insect mitogenome is a closed-circular DNA molecule, spanning 16–20 kilobases (kb) [1], containing 13 protein-coding genes (PCGs), two ribosomal RNA genes (rRNAs), and 22 transfer RNA genes (tRNAs). It also has a control region (A+T-rich region) of highly variable length, which regulates the transcription and replication of the genome [2]. Twenty three genes are coded on the majority strand while the rest are coded on the minority strand. Because of the characteristics of small size, maternal inheritance, relatively rapid evolutionary rate, lack of introns and genetic recombination, the mitochondrial DNA (mtDNA) has been widely used in studies on molecular evolution, molecular phylogenetics and population genetics [3]–[5]. Mitochondrial genomes (mtgenomes) are very important subject for different scientific disciplines including animal health, comparative and evolutionary genomics, molecular evolution, phylogenetic and population genetics [3].

Lepidoptera (moths and butterflies) is the second largest order in Insecta,containing over 155 000 described species [6], [7]. In Lepidoptera, Noctuoidea is the largest superfamily with about 42,400 species worldwide [7], [8]. Despite such huge taxonomic diversity the existing mtgenome information on Noctuoidea is very limited. To date, only 7 species have mtgenomes publicly available in GenBank. Erebidae was upgraded to family from Erebinae [9] within Noctuoidea and newly revised by Zahiri et al. [10]. Moreover, current genomic knowledge of which is even scantier which is limited to 3 species belonging to 2 subfamilies among 18 known. A better understanding of Noctuoidea or Erebidae all deeply requires an expansion of taxon and genome samplings using which to get datasets for a strong phylogenetic signal. Zahiri et al. (2011) proposed a newly robust phylogenetic framework of Noctuoidea with six families: Oenosandridae, Notodontidae, Erebidae, Euteliidae, Nolidae and Noctuidae, in which the relationship of Erebidae only a few lineages are well supported [11].

Ctenuchinina (Lepidoptera: Noctuoidea: Erebidae: Arctiinae) consists of four subtribes in two tribes: Syntomina and Thyretina in Syntomini as well as Euchromiina and Ctenuchina in Arctiini [9], [10], [11], which was formerly treated as an independent family named Ctenuchidae ( = Syntomidae, Euchromidae, Amatidae) (e.g. [12]). It is not a monophyletic group. Ctenuchinina contains a large number of diurnal moths which are phytophagous pests in agriculture and forest since the larvae and adults have massive economic impact on crop production and forest protection. Cisseps fulvicollis, for instance, has been recorded as an economic destructive insect on grain corn [13]. Hence, the resolution of a stable classificatory structure for the major lineages of these moths, and understanding their phylogenetic relationships, are meaningful to biological prevention and control.

Ctenuchinina was confused with the species of Zygaenidae and Sesiidae in the history, and fell into Sphingidae or Zygaenidae in early research. Herrich-Sch¨affer clearly separated this group from Zygaenidae and treated it as a family based on the type genus of Syntomis Ochsenheimer, 1808 which was the synonym of Amata Fabricius, 1807. The classification relationships of Ctenuchinina is based on the presences of a metepisternal tymbal organ, genitalic character, larvae and venation which failed to offer a clear conclusion since crossing synapomorphy is always inevitable existence. As the intricate relationship among itself as well as with close related groups, the classification status of Ctenuchinina presents long-term, constantly change. Aim to figure out some divergence in the morphological taxonomy, molecular characters were introducted to perform taxonomic studies of Ctenuchinina. But these studies are still very scant and were restricted to several molecular markers. Wink et al. used 16S rRNA sequences to construct phylogenetic relationships, in which Ctenuchidae was downgraded to subfamily status within Arctiidae [14]. Schneider et al. proposed a split of the genus Amata in two distinct genera based on mitochondrial 16S rRNA gene [15]. Therefore seeking more approach and genetic markers to slove these problems is become necessary effort.

In addition, the available gene knowledge of Ctenuchinina is limited and narrow as well exemplified by sequences available in GenBank that were obtained mostly cytochrome oxidase subunit 1 (COI) genes. There are more than 2800 sequences with about 2659(accounting for about 94.19%)are COI genes of very short length of 600–700 bp, and the remains are a handful of mRNA (about 6) and other sequences without any mtgenome. Undoubtedly, these nucleotide information is extremely limited relative to whether the entire mitochondrional length of 15–20 kb or the genes of 37 and a control region with variable length.

Considering the insufficient and perplexity above, in the present work, we sequenced, annotated and compared an entire mitogenome of A. emma (Lepidoptera: Erebidae) which would be the first complete mitochondrial genome of Ctenuchinina. What is more, we compared it with other lepidopteran genomes available so as to get conservation and variance information of Ctenuchinina relative to others, and infer a phylogenetic relationship of Lepidoptera with the expectation for providing robust molecular evidence for taxonomic status of Ctenuchinina, and providing robust information on understanding the phylogenetic relationships of Noctuoidea and Erebidae.

Materials and Methods

Sample collection and DNA extraction

One ethanol-preserved adult of A. emma was collected form an organic apple orchard in Beijing, China, in July 2011. Since this orchard is one of field stations for studying insect biodiversity, where there are no endangered or protected species and we have been working for about six years, no specific permits were required for our collecting. Total genomic DNA was extracted from the single sample with the DNeasy Blood &Tissue kit. The detailed procedures were consistent with the manufacturer instructions.

PCR amplification, cloning and sequencing

In order to get the whole genome, 14 pairs of primers were used for PCR amplification. The full list of primers is showed in Table 1. Figure 1 provides the coverage areas of PCR fragments. Eight pairs of universal primers [16] were used to amplify fragments 4, 5, 6, 10, 11, 12, 13 and 14. Primer combination LCO1490 with HCO2198 was used to amplify fragment 2. Primers for fragment 3 were modified form Simon et al. [16]. As for the other fragments 1, 7, 8 and 9, primers were designed with Primer Premier 5.0 software. Sequences of Phalera flavescens (Accession: NC016067), Sesamia inferens (Accession: NC015835), Helicoverpa armigera (Accession: NC014668), Hyphantria cunea (Accession: NC014058), Lymantria dispar (Accession: NC012893), and Ochrogaster lunifer (Accession: NC011128) were downloaded from GenBank and aligned using Clustal X [17] to obtain the conserved sequence, which can provide references for designing PCR primers. All primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. (Beijing, China).

Table 1. Regions and primers in present paper.

Fragment (Region) Primer (F/R) Primer sequence (F/R) 5′→3′
F1 nad2-cox1 Nad2-J-416/cox1-N-1693 TTTACCCTCAACTGAAGCCTCCT/TACTAATCAGTTACCAAATCCTCCA
F2 cox1 Lco1490/Hco2198 GGTCAACAAATCATAAAGATATTGG/TAAACTTCAGGGTGACCAAAAAATCA
F3 cox1-trnL2 C1-J-1751/TL2-N-3014 GGATCACCTGATATAGCATTCCC/TCCAATGCACTAATCTGCCATATTA
F4 cox1-cox2 C1-J-2797/C2-N-3494 CCTCGACGTTATTCAGATTACC/GGTAAAACTACTCGATTATCAAC
F5 cox2-trnD C2-J-3400/A8-N-3914 ATTGGACATCAATGATATTGA/TCATCTTATAGGTACTATTTGAGG
F6 cox2-nad4 C2-J-3696/N4-N-8484 GAAATTTGTGGAGCAAATCATAG/GCTAATATAGCAGCTCCTCC
F7 nad5-nad4 Nad5-J-7745/nad4-N-8820 TAAACCTAACCCATCTCACCCC/GGTTATGGGCTTTTACGATT
F8 nad4 Nad4-J-8569/nad4-N-9105 GCTAAACAAAATATCCCCGATGAAC/GTATCAGCCTGAGCGAATTAAAGCA
F9 nad4-cob Nad4-J-8887/cob-N-11326 GGAGCTTCAACATGAGCTTT/GCATAAGCAAATAAGAAATATCATTC
F10 cob-nad1 CB-J-10933/N1-N-12595 TATGTACTACCATGAGGACAAATATC/GTAGCATTTTTAACTTTATTAGAACG
F11 nad1-rrnL N1-J-12585/LR-N-13398 GGTCCCTTACGAATTTGAATATATCCT/CGCCTGTTTAACAAAAACAT
F12 rrnL-rrnS LR-J-12887/SR-N-14588 CCGGTCTGAACTCAGATCACGT/AAACTAGGATTAGATACCCTATTAT
F13 rrnL-rrnS LR-J-13331/SR-N-14756 TGATTATGCTACCTTTGCACAGT/GACAAAATTCGTGCCAGCAGT
F14 rrnS-nad2 SR-J-14612/N2-N-732 AGGGTATCTAATCCTAGTTT/GAAGTTTGGTTTAAACCTCC

Figure 1. Map of the mitochondrial genome of A. emma.

Figure 1

Protein-coding genes (names with underlines) coded on the majority strand are pink colored, while the rest and two rRNA genes coded on the minority strand are blue colored. The tRNA genes with single letter above the central axis are coded on majority strand. Underscores under the axis with F1–F14 indicate positions of 14 overlapping PCR amplified fragments.

PCR amplification conditions were as follows: an initial denaturation for 5 min at 95°C, followed by 35 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 48–55°C (depending on primer combination), elongation for 1–3 min (depending on putative length of the fragments) at 68°C, and a final extension step of 72°C for 10 min. All amplifications applied Takara LA Taq (Takara Co., Dalian, China) and performed on an Eppendorf Mastercycler and Mastercycler gradient.

The PCR products were resolved by electrophoresis in 1.0% agarose gel, purified using 3Spin PCR Product Purification Kit. All amplified products except rrnS-nad2 were sequenced directly using upstream and downstream primers along both strands by ABI-377 automatic DNA sequencers. The rrnS-nad2 fragment was sequenced after being ligated to the pEASY-T3 Cloning Vector (Beijing TransGen Biotech Co., Ltd., Beijing, China), and then sequenced by M13-F and M13-R primers and walking. Sequencing was performed using ABI BigDyever 3.1 dye terminator sequencing technology and run on ABI 3730XL PRISM 3730 × 1capillary sequencers. All sequencing procedures repeated at least three times.

Sequence assembling and annotation

The overlapping PCR product sequences were checked and assembled using BioEdit [18] and DNAStar package DNAStar package (DNAStar Inc. Madison, USA). Rough locations of genes were initially identified via BLAST on NCBI and comparison with the other lepidopteran sequences available in GenBank.

The protein-coding sequences were translated into putative proteins on the basis of the Invertebrate Mitochondrial Genetic Code. Composition skew analysis was carried out according to formulas AT skew = [A-T]/[A+T] and GC skew = [G-C]/[G+C], respectively [19]. The A+T content and Relative Synonymous Codon Usage (RSCU) were calculated by MEGA [20].

The tRNA genes were indentified using the tRNAscan-SE Search [21] or predicted by sequence features of being capable of folding into the typical cloverleaf secondary structure with legitimate anticodon, and their secondary structures were drawn by RNAstructure program [22].

The secondary structure of rrnS and rrnL were inferred from models proposed for other insects. XRNA 1.2.0.b (http://rna.ucsc.edu/rnacenter/xrna/xrna.html) was used to draw the folding structure with the reference of the results of the CRW site [23] and other insect species. The tandem repeats of A+T-rich region were found via the Tandem Repeats Finder program, and the stem-loop structure was determined by the Mfold Web Server [24].

Phylogenetic analysis

To construct a phylogenetic relationship of Lepidoptera, 54 complete or near-complete lepidopteran mitogenomes were downloaded from GenBank (Table 2). Besides, mitogenomes of Bactrocera oleae (NC_005333) [25] and Anopheles gambiae (NC_002084) [26] were downloaded and used as outgroups of the 55 taxa including the one we sequenced presently.

Table 2. List of taxa analyzed in present paper.

Subfamily Family Species Length Acc.number Reference
Bombycoidea Bombycidae Bombyx mori 15,643 bp NC_002355 Lee et al., unpulished
Bombyx mandarina 15,928 bp NC_003395 [46]
Saturniidae Antheraea pernyi 15,566 bp NC_004622 [47]
Antheraea yamamai 15,338 bp NC_012739 [48]
Samia cynthia ricini 15,384 bp NC_017869 [49]
Saturnia boisduvalii 15,360 bp NC_010613 [50]
Eriogyna pyretorum 15,327 bp NC_012727 [51]
Actias selene 15,236 bp NC_018133 [52]
Sphingidae Manduca sexta 15,516 bp NC_010266 [31]
Geometroidea Geometridae Phthonandria atrilineata 15,499 bp NC_010522 [53]
Noctuoidea Noctodontidae Phalera flavescens 15,659 bp NC_016067 [54]
Ochrogaster lunifer 15,593 bp NC_011128 [3]
Erebidae Lymantria dispar 15,569 bp NC_012893 [55]
Hyphantria cunea 15,481 bp NC_014058 [42]
Amata emma 15,463 bp KC_513737 The present study
Noctuidae Helicoverpa armigera 15,347 bp NC_014668 [43]
Sesamia inferens 15,413 bp NC_015835 Chai et al., unpublished
Pyraloidea Crambidae Ostrinia nubilalis 14,535 bp NC_003367 [56]
Diatraea saccharalis 15,490 bp NC_013274 [57]
Ostrinia furnacalis 14,536 bp NC_003368 [56]
Chilo suppressalis 15,395 bp NC_015612 [35]
Cnaphalocrocis medinalis 15,388 bp NC_015985 [35]
Pyralidae Corcyra cephalonica 15,273 bp NC_016866 Wu et al., unpublished
Tortricoidea Tortricidae Adoxophyes honmai 15,680 bp NC_008141 [39]
Grapholita molesta 15,717 bp NC_014806 [58]
Spilonota lechriaspis 15,368 bp NC_014294 [41]
Papilionoidea Papilonidae Papilio machaon 15,185 bp NC_018047 Xu et al., unpublished
Papilio bianor 15,340 bp NC_018040 Xu et al., unpublished
Teinopalpus aureus 15,242 bp NC_014398 [59]
Parnassius bremeri 15,389 bp NC_014053 [60]
Papilio maraho 16,094 bp NC_014055 Wu et al., unpublished
Nymphalidae Euploea mulciber 15,166 bp NC_016720 [61]
Libythea celtis 15,164 bp NC_016724 [61]
Melitaea cinxia 15,170 bp NC_018029 Xu et al., unpublished
Issoria lathonia 15,172 bp NC_018030 Xu et al., unpublished
Kallima inachus 15,183 bp NC_016196 [62]
Acraea issoria 15,245 bp NC_013604 [63]
Argynnis hyperbius 15,156 bp NC_015988 [64]
Apatura ilia 15,242 bp NC_016062 [65]
Sasakia charonda 15,244 bp NC_014224 Hakozaki et al., unpublished
Hipparchia autonoe 15,489 bp NC_014587 [66]
Apatura metis 15,236 bp NC_015537 [67]
Sasakia charonda kuriyamaensis 15,222 bp NC_014223 Hakozaki et al., unpublished
Athyma sulpitia 15,268 bp NC_017744 [68]
Calinaga davidis 15,267 bp NC_015480 [69]
Fabriciana nerippe 15,140 bp NC_016419 [70]
Pieridae Pieris rapae 15,157 bp NC_015895 [71]
Pieris melete 15,140 bp NC_010568 [72]
Aporia crataegi 15,140 bp NC_018346 [73]
Lycaenidae Coreana raphaelis 15,314 bp NC_007976 [36]
Spindasis takanonis 15,349 bp NC_016018 [74]
Protantigius superans 15,248 bp NC_016016 [74]
Yponomeutoidea Lyonetiidae Leucoptera malifoliel 15,646 bp JN_790955 [45]
Hepialoidea Hepialidae Thitarodes renzhiensis 16,173 bp NC_018094 [32]
Ahamus yunnanensis 15,816 bp NC_018095 [32]

Two analytical approaches, Maximum Likelihood (ML) and Bayesian Inference (BI), were used to infer phylogenetic trees. Nucleotide sequences of each of the 13 PCGs were translated into amino acid sequences then aligned with default settings by MEGA, and these 13 resultant alignments were retranslated into nucleotide alignments by MEGA separately. These processed alignments were concatenated together by BioEdit and thus got a nucleotide matrix of 11,751 sites in length. Substitution model selection was conducted by MrModeltest2.3 (http://www.abc.se/~nylander/mrmodeltest2/mrmodeltest2.html) [27]. The Bayesian analyse was performed with MrBayes [28] for Bayesian while ML analysis was performed by RAxML [29] for likelihood, and GTR + I +G model was the appropriate model of molecular evolution. The Bayesian analyse under the following conditions: 1,000,000 generations, 4 chains (1 cold chain and 3 hot chains) and a burn-in step for the first 10,000 generations. The confidence values of the BI tree were expressed as the Bayesian posterior probabilities in percentages. The ML analysis was performed using default parameters and the confidence values of the ML tree were evaluated via a bootstrap test with 1000 iteration.

Results and Discussion

Genome structure and organization

The A. emma (GenBank accession : KC_513737) mitogenome is a closed-circular molecule of 15,463 bp. It contains the typical set of 37 genes (13 PCGs, 22 tRNAs and 2 rRNAs) as in most animal mtDNA [1]. Gene order and orientation of A. emma are identical to the other ditrysian insects to date, and the locations of trnM gene follow the ditrysian type trnM-trnI-trnQ [30], [30,31] which is different from non-ditrysian groups in Lepidoptera [32]. Twenty-three genes are coded on the majority strand while the rest are coded on the minority strand (Table 3 and Figure 1).

Table 3. Summary of mitogenome of Amata emma.

Gene Direction Form To Size Inc Anticodon Start codon Stop codon
trnM F 1 68 68 6 CAT —— ——
trnI F 75 140 66 0 GAT —— ——
trnQ R 141 209 69 51 TTG —— ——
nad2 F 261 1274 1014 1 —— ATT TAA
trnW F 1276 1343 68 −8 TCA —— ——
trnC R 1336 1398 63 6 GCA —— ——
trnY R 1405 1470 66 7 GAT
cox1 F 1478 3011 1534 0 —— CGA T-trnL2
trnL2(UUR) F 3012 3079 68 0 TAA —— ——
cox2 F 3080 3759 680 0 —— ATG TA-trnK
trnK F 3760 3830 71 −1 CTT —— ——
trnD F 3830 3909 78 −10 GTC —— ——
atp8 F 3900 4076 177 −7 —— ATT TAA
atp6 F 4070 4747 678 5 —— ATG TAA
cox3 F 4753 5541 789 2 —— ATG TAA
trnG F 5544 5609 66 0 TCC —— ——
nad3 F 5610 5963 354 3 —— ATT TAA
trnA F 5967 6032 66 −1 TGC —— ——
trnR F 6032 6094 63 0 TCG —— ——
trnN F 6095 6160 66 4 GTT —— ——
trnS1(AGN) F 6165 6230 66 0 TCT —— ——
trnE F 6231 6297 67 10 TTC —— ——
trnF R 6308 6373 66 0 GAA —— ——
nad5 R 6374 8116 1743 0 —— ATA TAA
trnH R 8117 8182 66 0 GTG —— ——
nad4 R 8183 9521 1339 0 —— ATG T-nad4L
nad4L R 9522 9809 288 5 —— ATG TAA
trnT F 9815 9880 66 0 TGT —— ——
trnP R 9881 9946 66 8 TGG —— ——
nad6 F 9955 10488 534 9 —— ATA TAA
cob F 10498 11652 1155 6 —— ATG TAA
trnS2(UCN) F 11659 11725 67 20 TAG —— ——
nad1 R 11746 12684 939 1 —— ATG TAA
trnL1(CUN) R 12686 12753 68 0 TAC —— ——
rrnL R 12754 14124 1371 0 —— —— ——
trnV R 14125 14189 65 0 —— —— ——
rrnS R 14190 14981 792 0 —— —— ——
A+T-rich region 14982 15463 482 0 —— —— ——

Inc = intergenic nucleotides.

The genome composition (A: 37.8%, T: 40.8%, C: 13% and 7.5%) of the major strand shows highly A+T biased which accounts for 79.5%, and exhibits negative AT-skew (−0.026) and GC-skew (−0.268). As for the other lepidopteran mitochondrion genomes previously sequenced, the value of AT-skew (−0.026) is in the range from −0.06 (Bombyx mori) to 0.05 (Athyma sulpitia) while the GC-skew (−0.268) is in the range from −0.32 (Ochrogaster lunifer) to −0.16 (C. raphaelis). The full list of composition and skewness of A. emma is shown in Table 4.

Table 4. Composition and skewness of A. emma mitochondrional genome regions.

nt % Whole mtDNA Protein-coding sequence rRNAs tRNAs IGs
1st # 2nd # 3rd # IGs A+T-rich Short-IGs
A% 38.7 36.8 22.0 41.1 38.9 40.4 42.3 42.9 40.3
T% 40.8 36.3 48.3 48.8 44.8 40.2 49.7 49.8 49.3
C% 13.0 10.5 16.4 6.1 11.5 11.5 5.3 4.4 8.3
G% 7.5 16.4 13.2 4.0 4.7 7.9 2.7 2.9 2.1
A+T% 79.5 73.1 70.3 89.9 83.7 80.6 92 92.7 89.6
C+G% 20.5 26.9 29.6 10.1 16.2 19.4 8.0 7.3 10.4
AT-Skew% −0.026 0.007 −0.374 −0.086 −0.07 0.002 −0.08 −0.074 −0.1
GC-skew% −0.268 0.219 −0.108 −0.207 −0.42 −0.186 −0.325 −0.205 −0.596

# = position.

IGs = non-coding intergenic spacer regions.

Protein-coding genes

Among 13 protein-coding genes, nine (nad2, cox1, cox2, atp8, atp6, cox3, nad3, nad6 and cob) are coded on the majority strand while the rest (nad5, nad4, nad4L, nad1) are coded on the minority strand. The initial codons are the canonical putative start codons ATN (ATA for nad5, nad6; ATT for nad2, atp8, nad3; ATG for cox2, atp6, cox3, nad4, nad4L, cob, nad1), with the exception of cox1gene which uses CGA instead. A recent study has used expressed sequence tag to explain that cox1 may start with CGA [33]. Though controversy exists for the start codon of cox1, the present study shows the use of CGA. Ten genes share complete termination codon TAA, and three genes use incomplete stop codons (a single T for cox1 and nad4, TA for cox2). The non-canonical stop codons will be corrected via post-transcriptional polyadenylation [34]. The atp8 and the atp6 have a 7 bp overlap, which is common to all Lepidoptera mitogenomes known to date [3], [32]. The 5′ end of atp8 gene is highly conserved in Lepidoptera-IPQMMINW or MPQMMINW, and A. emma also presents this characteristic with no exception (Figure 2).

Figure 2. The highly conserved sequence of 5′ end of atp8 gene among seven superfamilies in Lepidoptera.

Figure 2

The A+T content of three codon positions of the PCGs was calculated (the stop codons were excluded from the analysis) and is showed in Table 4. The third position has a relatively high A +T content (89.9%), while the first and the second positions have 73.1% and 70.3%, respectively. In addition, both the second and the third position have negative AT-skew and GC-skew.

Comparison results of the codon usage of mitochondrial genomes across eight superfamilies of Lepidoptera are showed in Figure 3A. Fourteen species in Lepidoptera (seven belonging to Noctuoidae, the rest belonging to Bombycoidae, Geometroidae, Pyraloidea, Tortricoidea, Papilionoidea, Yponomeutoidea and Hepialoidea, respectively) (Figure 3A) were examined and the results show that Leu2, Ile, Phe, Met, and Asn are the five most frequent amino acids. Leu2, as a hydrophobic amino acid, has the highest usage rate, which may relate to the function of chondriosome of encoding many transmembrane proteins. The rarest used codon family is Cys. Codon distributions of seven species in Noctuoidae are consistency and each amino acid has equal content in different species (Figure 3B).

Figure 3. Codon distribution.

Figure 3

A: Comparison of the codon usage of mitochondrial genome across eight superfamilies in Lepidoptera. The lowercase alphabet (a, b, c, d, e, f, g and h) above the species name represent the superfamily the species belong to (a:Noctuoidea, b: Papilionoidea, c: Bombycoidea, d: Pyraloidea, e: Geometroidea, f: Tortricoidea, g: Yponomeutoidea, h: Hepialoidea). B: Codon distribution in Noctuoidae. CDspT, codons per thousand codons.

RSCU for Noctuoidae is present in Figure 4. The usage of both two-fold and four-fold degenerate codon is biased to use the codons which are abundant in A or T in third position. The codons which have relatively high content of G and C are likely to be abandoned, which is consistent with other lepidopteran insects [35].

Figure 4. Relative Synonymous Codon Usage (RSCU) in Noctuoidae.

Figure 4

Codon families are provided on the X axis. The codon above the bar indicate the one is not present in the genome.

Transfer RNA and ribosomal RNA genes

The A. emma mitogenome contains the set of 22 tRNAs genes (Figure 5) as most of lepidoptera mtDNAs though the feature is not very Conserved in the animal mtDNAs, for examples, the lepidopteran insect Coreana rapaelia (NC_013604, [36]) have an extra trnS1 (AGN) and another remarkable exceptions is the entire genus Chrysomya possessed duplicate trnI gene [37] such as Chrysomya chloropyga (NC_002697, [38]) have an extra trnS1 (AGN) and trnI. The tRNAs are scattered throughout the circular molecule and vary from 63 bp (trnC and trnR) to 78 bp (trnD) in size, and show highly A+T biased, accounting for 80.6% and exhibit positive AT-skew (0.002). Among these tRNA genes, fourteen tRNAs are coded by the H-strand with the rest by the L-strand.

Figure 5. Predicted secondary structures for 22 tRNA genes of A.emma mitogenome.

Figure 5

The tRNAs are labeled with the abbreviations of their corresponding amino acids. Dashes (−) indicate Watson-Crick base pairing and centered dots (·) indicate G-C base pairing.

All tRNA genes have typical cloverleaf secondary structures, except for the trnS1 (AGN) gene, in which the dihydrouridine (DHU) arm is simplified down to a loop. These features are common in most animal mitogenome, but exception does exist: Adoxophyes honmai tRNAs show complete clover leaf secondary structures [39].

The anticodons of A. emma tRNAs are all identical to most Lepidopteran mitogenomes, except for trnS1(AGN) which uses TCT instead of GCT as Coreana rapaelia [39], Thitarodes renzhiensis and T. yunnanensis [32].

A total of 24 mismatched base pairs and G-U wobble pairs scatter throughout the 16 tRNA genes (the amino acid acceptor (11), DHU (6), TψC (3), and anticodon stems (4)). The types are as follows: 8 mismatched base pairs (3 A–C and 5 U-U) and 16 G-U wobble pairs. The mismatched base pairs are corrected via RNA-editing mechanisms [40].

The two ribosomal RNA genes with 83.7% A+T content in total (Table 4) are located between trnL1 and trnV, trnV and the A+T-rich region, respectively. The rrnL is 1371 bp while rrnS is 792 bp. The rrnL (Figure 6) has six domains (domain III is absent) and rrnS (Figure 7) has three. Both the secondary structures of two rRNA genes broadly conform with the secondary structure models proposed for these genes from other insects.

Figure 6. Predicted rrnS secondary structure in A. emma mitogenome.

Figure 6

Tertiary interactions and base triple are shown connected by continuous lines. Dashes indicate Watson-Crick base pairing, centered dots indicate G-C base pairing and circles indicate other non-canonical pairs.

Figure 7. Predicted rrnL secondary structure in A. emma mitogenome.

Figure 7

Tertiary interactions and base triple are shown connected by continuous lines. Dashes indicate Watson-Crick base pairing, centered dots indicate G-C base pairing and circles indicate other non-canonical pairs.

Non-coding and overlapping genes

The non-coding regions of mtDNA of A. emma is 144 bp in total, is highly A+T biased (92.0%) (Table 3 and 4), and made up of 16 intergenic spacer sequences, ranging from 1 bp to 51 bp. There are three major intergenic spacers at least 10 bp in length (S1, S2 and S3). The S1 spacer (51 bp), located between trnQ and nad2, is common in lepidopteran mtDNA. The S2 spacer (10 bp), between trnE and trnF, varies widely in Lepidopteran insects. For instance, trnE and trnF have a 7 bp overlap in Lechriaspis meyrick [41], while in the mtDNA of Ochrogaster lunifer [3], the length of the spacer was 70 bp. The S3 spacer (20 bp), located between the trnS2 and nad1, contains the “ATACTAA” motif, which is a common feature across Lepidopteran insects [31], [42]. This special motif was proposed to be a recognition site performed by mtTERM protein [2].

In addition, there are 4 overlapping regions belonging to two types of locations: between tRNA and tRNA (trnW and trnC, trnK and trnD, trnA and trnR) and protein and protein (atp6 and atp8). The atp8 and atp6 have a 7 bp overlap, which is common in Lepidoptera mitogenomes. The intergenic nucleotides between atp8 and atp6 belonging to 10 species of Lepidoptera were examined and shown in Figure 8. Strikingly, these seven nucleotides “ATGATAA” is a commom feature across lepidoptera mtgenome.

Figure 8. Alignment of overlapping region between atp8 and atp6 across Lepidoptera and other insects.

Figure 8

The numbers on the right refer to intergenic nucleotides.

The A+T-rich region

The A+T-rich region, located between rrnS and trnM, spans 482 bp. The region contains 92.7% AT nucleotides,with negative AT skew and GC skew. The pattern of a motif “ATAGA” following rrnS and followed by 18–22 bp poly-T stretch which is considered to be a gene regulation element is a common feature occurring in Lepidoptera [3], [41] and in A. emma, the motif “ATAGA” located 17 bp downstream from rrnS and the poly-T stretch is 19 bp in length. A poly-A (in majority strand) is present upstream trnM in most Lepidopteran insects, but A. emma does not have the motif, and shares the feature with another lepidopteran insect Helicoverpa armigera [43]. In addition, the region of A. emma lacks conspicuous long repeated segments and just has several short repeats. The potential stable stem-and-loop structures were detected in AT region, which are inferred to be gene regulation elements. A microsatellite preceded by the ‘ATTTA’ motif is common across the region of Lepidopteran mitogenomes (e.g. Ochrogaster lunifer, [3]). In A. emma, (AT)9 element preceded by the ‘ATTTA’ motif is present in the 3′ end of the A. emma A+T- rich region. (AT)nGTAT is another feature of A. emma and there are three DNA fragments able to form this type of structures [(AT)9GTAT, (AT)7GTAT and (AT)10GTAT]. These structures could be the result of miss-pairing duplication [3].

Phylogenetic relationships

Our analyses are based on sequence data from 13 protein-cording gene regions derived from 55 lepidopteran insects. Data matrix (11,751 bp of total) was analyzed by model-based evolutionary methods (Bayesian Inference and Maximum Likelihood) (Figure 9A and 9B).

Figure 9. Inferred phylogenetic relationship among Lepidoptera based on amino acid sequence of mitochondrional 13 PCGs using Bayesian Inference (BI) (A) and maximum likelihood (ML) (B).

Figure 9

Number at each node show posterior probabilities (A) and bootstrap percentages (B), respectively. Bactrocera oleae (NC_005333) and Anopheles gambiae (NC_002084) were used as outgroups.

The optimal cladograms infered by these two methods are very similar which are agree almost perfectly with he previously obtained by other studies [44], [45], however the nodes have a higher support and thus many interrelationships are well-resolved within Lepidoptera.

It is clearly that A. emma shares a close ancestry with Hyphantria cunea with quite well supported both by BI and ML analysis. Our findings provide strong support ( = 100;  = 1) for the monophyly of Noctuoidea which is higher than Zahiri et al [12]. Some traditionally families and subfamilies show clear evolutionary relationship with strong posterior probabilities and bootstrap support. For example, there is well-support for a clade with Notodontidae as sister to another well-support clade comprising Noctuidae + Erebidae. Erebidae comes out as a well-supported (posterior probabilities = 1; bootstrap = 100) monophyletic clade, which Lymantriinae (represented by Lymantria dispar) and Arctiinae (represented by Hyphantria cunea and Amata emma) are clearly confirmed as belonging to.

Within Papilionoidea, the clade comprising Pieridae and (Lycaenidae + Nymphalidae) form a separate but lower-supported lineage in ML method while well support (bootstrap<50) by BI method (posterior probabilities = 1). To confirm these relationships, more studies need to be performed.

In addition, there is rather strong support (posterior probabilities >0.9; bootstrap>80) for the clade of Bombycoidea, Pyralioidea, Tortricoidea and Hepialidae. However, for Geometroidea, though the support is well, the result really requires advanced studies based on massive samples to provide a robust phylogenetic framework.

Conclusion

In this study, the mtgenome of Amata emme was sequenced, analyzed and compared with other lepidopteran insects, which would be the first whole mtgenome record of Ctenuchinina. The mtgenome shares many features with those of most Lepidopteran instects reported previously, just with some subtle differences in A+T region. In addition, we clarified the taxonomic status of Ctenuchinina using model-based phylogenetic inference and thus provide evidence for biological protection based on molecular markers.

The phylogenetic relationships based on nucleotide sequences of 13 PCGs using Bayesian inference and maximum likelihood methods provided a well-supported a broader outline of Lepidoptera and which agree with the traditional morphological classification and recently working, but with a much higher support. In this study, despite we have not performed much process on data matrix such as partition by codes, the result really provide a robust phylogenetic framework, which may imply that 13PCGs which have the function of express protein determining biological trait can be used as materials for phylogenetic inference just under a simple organization. However, this implication deeply needs more studies to verify whether it is universally applicable or not.

Acknowledgments

We would like to thank Fu-Qiang Chen and Fang Yu (Institute of Zoology, Chinese Academy of Sciences, Beijing) for their kind supports.

Funding Statement

This work was supported mainly by the Knowledge Innovation Program of the Chinese Academy of Sciences (grant no. KSXC2-EW-B-02), partially by the Public Welfare Project from the Ministry of Agriculture, China (grant no. 201103024); grants from National Science Foundation, China (grants 30870268, 31172048, J0930004) to Chao-Dong ZHU, and one grant (31172129) to Chun-Sheng Wu. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Research 27: 1767–1780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Taanman JW (1999) The mitochondrial genome: structure, transcription, translation and replication. Biochim Biophys Acta 1410: 103–123. [DOI] [PubMed] [Google Scholar]
  • 3. Salvato P, Simonato M, Battisti A, Negrisolo E (2008) The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC genomics 9: 331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Reyes A, Gissi C, Pesole G, Saccone C (1998) Asymmetrical directional mutation pressure in the mitochondrial genome of mammals. Molecular Biology and Evolution 15: 957–966. [DOI] [PubMed] [Google Scholar]
  • 5. Ingman M, Kaessmann H, Paabo S, Gyllensten U, Ingman M, et al. (2000) Mitochondrial genome variation and the origin of modern humans. Nature 408: 708–712. [DOI] [PubMed] [Google Scholar]
  • 6. Kristensen NP, Scoble M, Karsholt O (2007) Lepidoptera phylogeny and systematics: the state of inventorying moth and butterfly diversity. Zootaxa 1668: 699–747. [Google Scholar]
  • 7. van Nieukerken E, Kaila L, Kitching I, Kristensen N, Lees D, et al. (2011) Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness. Zootaxa 3148: 1–237. [DOI] [PubMed] [Google Scholar]
  • 8. Speidel W, Naumann C (2004) A survey of family - group names in noctuoid moths (Insecta: Lepidoptera). Systematics and Biodiversity 2: 191–221. [Google Scholar]
  • 9. Lafontaine JD, Fibiger M (2006) Revised higher classification of the Noctuoidea (Lepidoptera). The Canadian Entomologist 138: 610–635. [Google Scholar]
  • 10. Zahiri R, Kitching IJ, Lafontaine JD, Mutanen M, Kaila L, et al. (2011) A new molecular phylogeny offers hope for a stable family level classification of the Noctuoidea (Lepidoptera). Zoologica Scripta 40: 158–173. [Google Scholar]
  • 11. Zahiri R, Holloway JD, Kitching IJ, Lafontaine D, Mutanen M, et al. (2012) Molecular phylogenetics of Erebidae (Lepidoptera Noctuoidea). Systematic Entomology 37: 102–124. [Google Scholar]
  • 12. Kumar V, Rajadurai S, Babu AM, Kariappa BK (2003) Eggshell Fine Structure of Amata passalis F. (Lepidoptera: Amatidae), A Pest of Mulberry. International Journal of Tropical Insect Science 23: 325–330. [Google Scholar]
  • 13. Hudon M, Perron JP (1970) First record of cisseps fulvicollis (Lepidoptera: Amatidae) as aneconomic destructive insect on grain corn Canada. The Canadian Entomologist 102: 1052–1054. [Google Scholar]
  • 14. Wink M, Von Nickisch-Rosenegk E (1997) Sequence Data of Mitochondrial 16S rDNA of Arctiidae and Nymphalidae: Evidence for a Convergent Evolution of Pyrrolizidine Alkoloid and Cardiac Glycoside Sequestration. Journal of Chemical Ecology 23: 1549–1568. [Google Scholar]
  • 15. Schneider D, Legal L, Dierl W, Wink M (1999) Androconial hairbrushes of the Syntomis (Amata) phegea (L.) group (Lepidoptera, Ctenuchinae): A synapomorphic character supported by sequence data of the mitochondrial 16S rRNA gene. Zeitschrift Für Naturforschung 54: 1119–1139. [DOI] [PubMed] [Google Scholar]
  • 16. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, et al. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Ent Soc Am 87: 651–701. [Google Scholar]
  • 17. Larkin M, Blackshields G, Brown N, Chenna R, McGettigan P, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
  • 18. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. [Google Scholar]
  • 19. Perna NT, Kocher TD (1995) Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41: 353–358. [DOI] [PubMed] [Google Scholar]
  • 20. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596–1599. [DOI] [PubMed] [Google Scholar]
  • 21. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25: 0955–0964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Reuter JS, Mathews DH (2010) RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11: 129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Cannone JJ, Subramanian S, Schnare MN, Collett JR, D'Souza LM, et al. (2002) The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinformatics 3: 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31: 3406–3415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Nardi F, Carapelli A, Dallai R, Frati F (2003) The mitochondrial genome of the olive fly Bactrocera oleae: two haplotypes from distant geographical locations. Insect Molecular Biology 12: 605–611. [DOI] [PubMed] [Google Scholar]
  • 26. Beard CB, Hamm DM, Collins FH (1993) The mitochondrial genome of the mosquito Anopheles gambiae: DNA sequence, genome organization, and comparisons with mitochondrial sequences of other insects. Insect Molecular Biology 2: 103–124. [DOI] [PubMed] [Google Scholar]
  • 27. Posada D, Crandall KA (1998) MODELTEST: Testing the model of DNA substitution. Bioinformatics 14: 817–818. [DOI] [PubMed] [Google Scholar]
  • 28. Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. [DOI] [PubMed] [Google Scholar]
  • 29. Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. [DOI] [PubMed] [Google Scholar]
  • 30. Negrisolo E, Babbucci M, Patarnello T (2011) The mitochondrial genome of the ascalaphid owlfly Libelloides macaronius and comparative evolutionary mitochondriomics of neuropterid insects. BMC genomics 12: 221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Cameron SL, Whiting MF (2008) The complete mitochondrial genome of the tobacco hornworm, Manduca sexta,(Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408: 112–123. [DOI] [PubMed] [Google Scholar]
  • 32. Cao YQ, Ma C, Chen JY, Yang DR (2012) The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics 13: 276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Margam VM, Coates BS, Hellmich RL, Agunbiade T, Seufferheld MJ, et al. (2011) Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae). PloS one 6: e16444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ojala D, Montoya J, Attardi G (1981) tRNA punctuation model of RNA processing in human mitochondria. Nature 290: 470–474. [DOI] [PubMed] [Google Scholar]
  • 35. Chai HN, Du YZ, Zhai BP (2012) Characterization of the complete mitochondrial genomes of Cnaphalocrocis medinalis and Chilo suppressalis (Lepidoptera: Pyralidae). International Journal of Biological Sciences 8: 561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Kim I, Lee E, Seol K, Yun E, Lee Y, et al. (2006) The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae). Insect Molecular Biology 15: 217–225. [DOI] [PubMed] [Google Scholar]
  • 37. Nelson LA, Lambkin CL, Batterham P, Wallman GF, Dowton M, et al. (2012) Beyond barcoding: A mitochondrial genomics approach to molecular phylogenetics and diagnostics of blowflies (Diptera: Calliphoridae). Gene 51: 131–142. [DOI] [PubMed] [Google Scholar]
  • 38. Junqueira ACM, Lessinger AC, Torres TT, da Silva FR, Vettore AL, et al. (2004) The mitochondrial genome of the blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene 339: 7–15. [DOI] [PubMed] [Google Scholar]
  • 39. Lee ES, Shin KS, Kim MS, Park H, Cho S, et al. (2006) The mitochondrial genome of the smaller tea tortrix Adoxophyes honmai (Lepidoptera: Tortricidae). Gene 373: 52–57. [DOI] [PubMed] [Google Scholar]
  • 40. Lavrov DV, Brown WM, Boore JL (2000) A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus . Proceedings of the National Academy of Sciences 97: 13738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Zhao JL, Zhang YY, Luo AR, Jiang GF, Cameron SL, et al. (2011) The complete mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae). Molecular Biology Reports 38: 3757–3764. [DOI] [PubMed] [Google Scholar]
  • 42. Liao F, Wang L, Wu S, Li YP, Zhao L, et al. (2010) The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae). International Journal of Biological Sciences 6: 172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Yin J, Hong GY, Wang AM, Cao YZ, Wei ZJ (2010) Mitochondrial genome of the cotton bollworm Helicoverpa armigera (Lepidoptera: Noctuidae) and comparison with other Lepidopterans. Mitochondrial DNA 21: 160–169. [DOI] [PubMed] [Google Scholar]
  • 44. Mutanen M, Wahlberg N, Kaila L (2010) Comprehensive gene and taxon coverage elucidates radiation patterns in moths and butterflies. Proceedings of the Royal Society B: Biological Sciences 277: 2839–2848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Wu YP, Zhao JL, Su TJ, Li J, Yu F, et al. (2012) The Complete Mitochondrial Genome of Leucoptera malifoliella Costa (Lepidoptera: Lyonetiidae). DNA and Cell Biology 31(10): 1508–1522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Yukuhiro K, Sezutsu H, Itoh M, Shimizu K, Banno Y (2002) Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori . Molecular Biology and Evolution 19: 1385–1389. [DOI] [PubMed] [Google Scholar]
  • 47. Liu Y, Li Y, Pan M, Dai F, Zhu X, et al. (2008) The complete mitochondrial genome of the Chinese oak silkmoth, Antheraea pernyi (Lepidoptera: Saturniidae). Acta biochimica et biophysica Sinica 40: 693–703. [PubMed] [Google Scholar]
  • 48. Kim SR, Kim MI, Hong MY, Kim KY, Kang PD, et al. (2009) The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae). Molecular biology reports 36: 1871–1880. [DOI] [PubMed] [Google Scholar]
  • 49. Kim JS, Park JS, Kim MJ, Kang PD, Kim SG, et al. (2012) Complete nucleotide sequence and organization of the mitochondrial genome of eri-silkworm,Samia cynthia ricini (Lepidoptera: Saturniidae). Journal of Asia-Pacific Entomology 15: 162–173. [Google Scholar]
  • 50. Hong MY, Lee EM, Jo YH, Park HC, Kim SR, et al. (2008) Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects. Gene 413: 49–57. [DOI] [PubMed] [Google Scholar]
  • 51. Jiang ST, Hong GY, Yu M, Li N, Yang Y, et al. (2009) Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae). International journal of biological sciences 5: 351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Liu QN, Zhu BJ, Dai LS, Wei GQ, Liu CL (2012) The complete mitochondrial genome of the wild silkworm moth, Actias selene . Gene 505: 291–299. [DOI] [PubMed] [Google Scholar]
  • 53. Yang L, Wei ZJ, Hong GY, Jiang ST, Wen LP (2009) The complete nucleotide sequence of the mitochondrial genome of Phthonandria atrilineata (Lepidoptera: Geometridae). Molecular biology reports 36: 1441–1449. [DOI] [PubMed] [Google Scholar]
  • 54. Hao J (2012) Complete sequence of the mitochondrial genome of the Japanese buff-tip moth, Phalera flavescens (Lepidoptera: Notodontidae). Genetics and Molecular Research 11: 4213–4225. [DOI] [PubMed] [Google Scholar]
  • 55. Yajun Z, Guoliang Z, Rui F, Jun Y, Jianping Y (2010) The complete sequence determination and analysis of Lymantria dispar (Lepidoptera: Lymantriidae) mitochondrial genome. Plant Quarantine 4: 005. [Google Scholar]
  • 56. Coates BS, Sumerford DV, Hellmich RL, Lewis LC (2005) Partial mitochondrial genome sequences of Ostrinia nubilalis and Ostrinia furnicalis . International journal of biological sciences 1: 13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Li W, Zhang X, Fan Z, Yue B, Huang F, et al. (2011) Structural characteristics and phylogenetic analysis of the mitochondrial genome of the sugarcane borer, Diatraea saccharalis (Lepidoptera: Crambidae). DNA and Cell Biology 30: 3–8. [DOI] [PubMed] [Google Scholar]
  • 58. Son Y, Kim Y (2011) The complete mitochondrial genome of Grapholita molesta (Lepidoptera: Tortricidae). Annals of the Entomological Society of America 104: 788–799. [Google Scholar]
  • 59. Qin F, Jiang GF, Zhou SY (2012) Complete mitochondrial genome of the Teinopalpus aureus guangxiensis (Lepidoptera: Papilionidae) and related phylogenetic analyses. Mitochondrial DNA 23: 123–125. [DOI] [PubMed] [Google Scholar]
  • 60. Kim MI, Baek JY, Kim MJ, Jeong HC, Kim KG, et al. (2009) Complete nucleotide sequence and organization of the mitogenome of the red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects. Molecules and cells 28: 347–363. [DOI] [PubMed] [Google Scholar]
  • 61.Yang Q (2013) Complete Mitogenomes of Euploea mulciber (Nymphalidae: Danainae) and Libythea celtis (Nymphalidae: Libytheinae) and Their Phylogenetic Implications. ISRN Genomics 2013.
  • 62. Qin XM, Guan QX, Zeng DL, Qin F, Li HM (2012) Complete mitochondrial genome of Kallima inachus (Lepidoptera: Nymphalidae: Nymphalinae): Comparison of K. inachus and Argynnis hyperbius. Mitochondrial DNA 23: 318–320. [DOI] [PubMed] [Google Scholar]
  • 63. Hu J, Zhang D, Hao J, Huang D, Cameron S, et al. (2010) The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event. Molecular biology reports 37: 3431–3438. [DOI] [PubMed] [Google Scholar]
  • 64. Wang XC, Sun XY, Sun QQ, Zhang DX, Hu J, et al. (2011) Complete mitochondrial genome of the laced fritillary Argyreus hyperbius (Lepidoptera: Nymphalidae). Zool Res 32: 465–475. [DOI] [PubMed] [Google Scholar]
  • 65. Chen M, Tian LL, Shi QH, Cao TW, Hao JS (2012) Complete mitogenome of the Lesser Purple Emperor Apatura ilia (Lepidoptera: Nymphalidae: Apaturinae) and comparison with other nymphalid butterflies. Zoological Research 33: 191–201. [DOI] [PubMed] [Google Scholar]
  • 66. Kim MJ, Wan X, Kim K, Hwang JS, Kim I (2010) Complete nucleotide sequence and organization of the mitogenome of endangered Eumenis autonoe (Lepidoptera: Nymphalidae). African Journal of Biotechnology 9. [Google Scholar]
  • 67. Zhang M, Nie X, Cao T, Wang J, Li T, et al. (2012) The complete mitochondrial genome of the butterfly Apatura metis (Lepidoptera: Nymphalidae). Molecular biology reports 39: 6529–6536. [DOI] [PubMed] [Google Scholar]
  • 68. Tian LL, Sun XY, Chen M, Gai YH, Hao JS, et al. (2012) Complete mitochondrial genome of the Five-dot Sergeant Parathyma sulpitia (Nymphalidae: Limenitidinae) and its phylogenetic implications. Zoological Research 33: 133–143. [DOI] [PubMed] [Google Scholar]
  • 69. Jing X, Jing H, GuoPing Z, ChaoDong Z, JiaSheng H (2011) Sequencing and analysis of the complete mitochondrial genome of Calinaga davidis Oberthür (Lepidoptera: Nymphalidae). Acta Entomologica Sinica 54: 555–565. [Google Scholar]
  • 70. Kim MJ, Jeong HC, Kim SR, Kim I (2011) Complete mitochondrial genome of the nerippe fritillary butterfly, Argynnis nerippe (Lepidoptera: Nymphalidae). Mitochondrial DNA 22: 86–88. [DOI] [PubMed] [Google Scholar]
  • 71. Mao Z, Hao J, Zhu G, Hu J, Si M, et al. (2010) Sequencing and analysis of the complete mitochondrial genome of Pieris rapae Linnaeus (Lepidoptera: Pieridae). Acta Entomol Sin 53: 1295–1304. [Google Scholar]
  • 72. Hong G, Jiang S, Yu M, Yang Y, Li F, et al. (2009) The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae). Acta biochimica et biophysica Sinica 41: 446–455. [DOI] [PubMed] [Google Scholar]
  • 73. Park JS, Cho Y, Kim MJ, Nam SH, Kim I (2012) Description of complete mitochondrial genome of the black-veined white, Aporia crataegi (Lepidoptera: Papilionoidea), and comparison to papilionoid species. Journal of Asia-Pacific Entomology 15: 331–341. [Google Scholar]
  • 74. Kim MJ, Kang AR, Jeong HC, Kim KG, Kim I (2011) Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids,Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae). Molecular phylogenetics and evolution 61: 436–445. [DOI] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES