Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2013 Jun 3;288(29):21267–21278. doi: 10.1074/jbc.M112.448134

Structure-Function Studies of the Staphylococcal Methicillin Resistance Antirepressor MecR2*

Pedro Arêde ‡,1,2, Tiago Botelho §,1,3, Tibisay Guevara §, Isabel Usón , Duarte C Oliveira ‡, F Xavier Gomis-Rüth §,4
PMCID: PMC3774396  PMID: 23733184

Background: PBP2a-based methicillin resistance in S. aureus is regulated by the protein MecR2.

Results: The structure of MecR2 shows a dimeric multidomain ROK family protein, which nonspecifically binds oligonucleotides but not sugar ligands.

Conclusion: MecR2 represents an evolution within ROK proteins to give rise to a protein-binding antirepressor.

Significance: The present results pave the way for the design of new antimicrobials.

Keywords: Antibiotic Resistance, Microbiology, Molecular Biology, Protein Structure, Structural Biology, MRSA

Abstract

Methicillin resistance in Staphylococcus aureus is elicited by the MecI-MecR1-MecA axis encoded by the mec locus. Recently, MecR2 was also identified as a regulator of mec through binding of the methicillin repressor, MecI. Here we show that plasmid-encoded full-length MecR2 restores resistance in a sensitive S. aureus mecR2 deletion mutant of the resistant strain N315. The crystal structure of MecR2 reveals an N-terminal DNA-binding domain, an intermediate scaffold domain, and a C-terminal dimerization domain that contributes to oligomerization. The protein shows structural similarity to ROK (repressors, open reading frames, and kinases) family proteins, which bind DNA and/or sugar molecules. We found that functional cell-based assays of three point mutants affecting residues participating in sugar binding in ROK proteins had no effect on the resistance phenotype. By contrast, MecR2 bound short double-stranded DNA oligonucleotides nonspecifically, and a deletion mutant affecting the N-terminal DNA-binding domain showed a certain effect on activity, thus contributing to resistance less than the wild-type protein. Similarly, a deletion mutant, in which a flexible segment of intermediate scaffold domain had been replaced by four glycines, significantly reduced MecR2 function, thus indicating that this domain may likewise be required for activity. Taken together, these results provide the structural basis for the activity of a methicillin antirepressor, MecR2, which would sequester MecI away from its cognate promoter region and facilitate its degradation.

Introduction

Staphylococcus aureus is the most prevalent human infectious agent associated with nosocomial and community infections. It has an extraordinary capacity to become resistant to antibiotics: it was the first bacterial pathogen reported to have become insensitive to penicillin (1–4). Among the distinct strains is methicillin-resistant S. aureus (MRSA),5 which currently refers to strains that are generally resistant to β-lactam antibiotics (BLAs; penicillins and cephalosporins). Some strains are also resistant to other chemotherapeutics such as aminoglycosides, glycopeptides, macrolides, lincosamides, and fluoroquinolones (3, 5–8). MRSA is characterized by its ability to thrive in the presence of BLAs because of the biosynthesis of a penicillin-binding protein with low susceptibility to BLAs, termed PBP2a, PBP2′, or MecA. The latter is encoded by the gene mecA, which is contained in a transducible mobile element, staphylococcal chromosomal cassette mec (9–11). Staphylococcal chromosomal cassette mec also includes two genes, mecI and mecR1, which encode a transcriptional DNA-binding repressor, MecI, and an integral membrane zinc-dependent sensor/signal transducer metalloproteinase, MecR1, respectively (12, 13). This system is homologous to the blaI-blaR1-blaZ signal transduction system that triggers synthesis of a β-lactamase (BlaZ) in both MRSA and methicillin-susceptible S. aureus, as well as in Bacillus licheniformis (14–16). The currently accepted working model hypothesis for these systems predicts that MecI/BlaI constitutively represses its own biosynthesis and that of MecR1/BlaR1 and MecA/BlaZ through binding to the mec/bla promoter (10, 13, 17). Once MecR1/BlaR1 detects the presence of BLAs through its extracellular sensor domain (18–22), a signal is transmitted across the membrane to the intracellular zinc-dependent metalloproteinase domain, which becomes activated through proteolytic cleavage (23–25). This yields functional MecR1/BlaR1, which in turn would—directly or indirectly—cause cleavage of MecI/BlaI (26, 27). This cleavage would render the dimeric repressor inactive and release it from its DNA-binding site. A similar effect of inhibitor inactivation, which was not based, however, on a proteolytic pathway but on the intracellular presence of a short dipeptidic peptidoglycan fragment induced by BLA stress, has been recently described for B. licheniformis (28). Finally, release of transcriptional repression would elicit biosynthesis of MecA/BlaZ.

However, some lines of evidence are not explained by this ternary model. First, the reported cleavage sites of MecR1/BlaR1 and MecI/BlaI are not compatible with a single proteolytic substrate specificity (29). Second, the structure of MecI and BlaI in complexes with target DNA revealed that the repressor cleavage site is found within an α-helix and is not surface-accessible (29–32), as would be required for proper proteolytic processing. Third, highly resistant MRSA strains did not show significant variation in the phenotypic expression of resistance when wild-type MecI was overexpressed in trans (33). Lastly, the presence of functional MecR1-MecI did not correlate with the level of BLA resistance in a representative collection of epidemic MRSA strains (33). These and other findings led several authors to postulate the existence of a further regulatory element, MecR2/BlaR2, although no candidate molecules were suggested (4, 10, 17, 18, 31, 32, 34–38).

Most recently, comparative genomic sequence analysis revealed that, in some clinical MRSA strains, a putative gene is found upstream of mecA, which is co-transcribed with mecI and mecR1 (34). Its transcript could be detected by reverse transcriptase PCR of cultures induced with oxacillin—a methicillin analog that has replaced the latter in clinical use—from a set of prototype clinical MRSA strains, paralleling mecA induction. Furthermore, in the presence of fully functional MecR1 and MecI, this gene was essential for the optimal expression of BLA resistance. Finally, in vitro and in vivo assays showed that the encoded protein acted as an antirepressor by disrupting MecI binding to the mecA promoter and fostering its MecR1-independent proteolytic inactivation (34). Collectively, these findings indicated that the long sought-for gene encoding MecR2/BlaR2 had been found, and so it was termed mecR2 (34).

To shed light on the structural determinants of folding and function of MecR2, we developed an efficient protocol to produce and purify large quantities of the functional wild-type protein. Furthermore, we assayed activity of MecR2 in cell-based assays and in vitro and determined its x-ray crystal structure. We report here the molecular determinants of its function, which were further validated by mutational studies.

EXPERIMENTAL PROCEDURES

Recombinant Overexpression and Purification

The mecR2gene was amplified from genomic DNA from S. aureus strain HU25 (Met1–Ala376; see GenBankTM accession number AF422694, protein sequence identical to UniProt entry Q99XE2) by PCR and cloned into expression vector pCri8a between NcoI and XhoI restriction sites, giving rise to plasmid pCri8::mecR2 (for strains and plasmids used in this study, see Table 1). This construct added an N-terminal His6 tag and a tobacco etch virus (TEV) protease cleavage site, so that the N terminus of the mature protein was preceded by a 20-residue segment (−21MGSSHHHHHHSSGENLYFQGP−1; negative superscript numbers refer to extra N-terminal residues preceding the mature N terminus, which is Met1 according to Q99XE2). A mutant, in which segment Thr150–Ile160 had been replaced by four glycine residues (termed MecR2 Thr150–Ile160 → GGGG), was amplified from the pST181::spac::mecR2 recombinant plasmid by PCR and cloned into expression vector pCri8a at the NcoI and XhoI restriction sites. Expression vectors were transformed into Escherichia coli BL21 DE3 cells, and 1-liter cultures of transformed bacteria were induced for protein expression with 0.1 mm isopropyl-β-d-1-thiogalactopyranoside (IPTG) at 18 °C for 24 h when the optical density at λ = 600 nm (A600) reached 0.6. Cultures were subsequently centrifuged at 7,000 × g (4 °C, 20 min), and pellets were resuspended in 70 ml of ice-cold buffer A (20 mm Tris·HCl, 0.5 m sodium chloride, pH 8.0). The cells were lysed with a cell disruptor (Constant Cell Disruption Systems Ltd.) operated at 1.35 KBar, and the lysate was subsequently centrifuged at 75,600 × g in an Avanti J-25 centrifuge with a JA-25.50 rotor (4 °C, 20 min). The soluble fraction containing His6-TEV-MecR2 was applied onto a His-trap FF crude column (GE Healthcare) attached to an ÄKTA Purifier UPC-10 FPLC system previously equilibrated with buffer A. The protein was eluted with an imidazole gradient (0–0.5 m imidazole in buffer A), and fractions containing the protein were subjected to a final size exclusion chromatography step in a Superdex 75 16/60 column (GE Healthcare), previously equilibrated with 20 mm Tris·HCl, 0.2 m sodium chloride, pH 7.4. Protein purity was assessed by 10% Tricine SDS-PAGE. TEV protease digestion of the N-terminal His6 tag was assayed under different conditions, but yields were not satisfactory. As such, crystallization trials were performed using tagged MecR2 (hereafter wild-type MecR2). The selenomethionine variant of MecR2 was obtained in the same manner, except that 30 min before induction, the cells were added to 500 ml of medium lacking methionine and containing 25 mg of selenomethionine (Sigma-Aldrich) instead.

TABLE 1.

Strains and plasmids

Strain/plasmid Relevant characteristics Source
Strains
    E. coli DH5α Recipient strain for recombinant plasmids Stratagene
    E. coli BL21 (DE3) Recipient strain for expression vector pCri8a Novagene
    BL21 + pCri8a::mecR2 E. coli BL21 (DE3) overexpressing mecR2 with an N-terminal His6 tag and a TEV protease cleavage site This study
    S. aureus RN4220 Restriction-deficient derivative of reference strain NCTC8325–4 R. Novick
    S. aureus N315 Prototype MRSA strain, heterogeneous Oxar, wild-type mecR1-mecI, mecR2 positive (short variant ΔN87), β-lactamase positive, clone ST5-II K. Hiramatsu
    S. aureus HU25 Homogeneous Oxar, wild-type mecR1, truncated mecI, mecR2 positive (full-length protein), β-lactamase positive, clone ST239-III Ref. 33
    N315::ΔmecR2 N315 mecR2 deletion backcross, β-lactamase positive Ref. 34
    N315::ΔmecR2 + pSPT::spac-mecR2 N315::ΔmecR2 expressing mecR2 from strain N315 in trans from the inducible Pspac promoter Ref. 34

Plasmids
    pCri8a pET30 (Invitrogen) derivative for recombinant overexpression containing His6-GST-TEV fragment, Kanr Ref. 78
    pSPT181::spac pSPT181 with 1.6-kb EcoRI-BamHI fragment containing the IPTG-inducible Pspac promoter and the transcriptional repressor LacI from pDH88, Apr, Tcr Ref. 34
    pCri8a::mecR2 pCri8a expression vector with mecR2 gene from strain HU25 This study
    pSPT181::spac-mecR2 3D (wild-type) pSPT181 vector containing the mecR2 gene from strain HU25 with an N-terminal His6 tag and a TEV protease cleavage site from pCri8a::mecR2 This study
    pCri8a::mecR2 Thr150–Ile160 → GGGG pCri8a expression vector containing the mecR2 mutant variant Thr150–Ile160 → GGGG This study
    pSPT181::spac-mecR2 ΔSer55–Lys62 pSPT181 vector containing the mecR2 mutant variant ΔSer55–Lys62 This study
    pSPT181::spac-mecR2 Thr150–Ile160 → GGGG pSPT181 vector containing the mecR2 mutant variant Thr150–Ile160 → GGGG This study
    pSPT181::spac-mecR2 N178A,E179A pSPT181 vector containing the mecR2 mutant variant N178A,E179A This study
    pSPT181::spac-mecR2 E228A pSPT181 vector containing the mecR2 mutant variant E228A This study
    pSPT181::spac-mecR2 E248A pSPT181 vector containing the mecR2 mutant variant E248A This study
Circular Dichroism Experiments

The CD spectra of wild-type MecR2 and MecR2 Thr150–Ile160 → GGGG were recorded with a JASCO J-815 CD spectrometer operated with the following parameters: response, 1 s; scan speed, 50 nm/min; data acquisition interval, 0.1 nm; accumulations, 3; and bandwidth, 1 nm. Quartz cuvettes for far UV (190–250 nm) with path lengths of 1 mm were used. The samples contained 0.2 mg/ml protein in 10 mm sodium phosphate, 40 mm sodium chloride, pH 7.0. The CD spectrum of cuvette and buffer alone was subtracted from the protein solution spectra.

MecR2 DNA Binding Assays in Vitro

Recombinant wild-type MecR2 was assayed for DNA binding capacity by electrophoretic mobility shift analysis. The 25-bp oligonucleotides encompassing the Z-dyad sequence of the bla promoter sequence with an additional 1-bp overhang on either end (C/G), which had been employed in structure-function studies with MecI (15, 29, 30) (termed here MR2-EMSA1 and 2; Table 2), were purchased from Sigma and annealed as described to yield 200 nmol of dsDNA in buffer 20 mm Tris·HCl, 0.1 m sodium chloride, pH 7.4. Purified MecR2 (100 and 200 μm) in buffer 20 mm Tris·HCl, 0.2 m sodium chloride, pH 7.4, was mixed with DNA solution at 0.5:1, 1:1, 2:1, and 4:1 protein:dsDNA molar ratios and analyzed in a band shift assay in an 18.5% PAGE gel using annealed oligonucleotides as negative control. The same experiment was repeated with 25-bp nucleotides of the same nucleotide composition but scrambled sequence (MR2-EMSA3 and 4).

TABLE 2.

Primers and oligonucleotides

Name Sequence (5′ → 3′)a
MR2–3D F1 TATACCCGGGAAGGAGATATACCATGGGCA
MR2–3D R1 TATACCCGGGGCTATTATGCTTTTATATCTA
Spac F1 GAAGATTTATTTGAGGTAGC
Spac R1 TTATGGCTTGAACAATCACG
MR2-RT1 AATGAAGCGAATCTTTCAGC
MR2-RT2 AATTGCTAATGTACCACCTAGC
MR2-SDM1 ATGAGGTTGGTGAGGGTGATAAACCTATTCTTCTGAAGGT
MR2-SDM2 ACCTTCAGAAGAATAGGTTTATCACCCTCACCAACCTCAT
MR2-SDM3 TGGATAATGAGCAGCATGTGGGTGGAGGTGGAATTTCAATTCCTAAGAA
MR2-SDM4 TTCTTAGCAATTGAAATTCCACCTCCACCCACATGGTGCTCATTATCCA
MR2-SDM9 ATGGGGAAGCGGGTGCAATTGGAAAAACACT
MR2-SDM10 AGTGTTTTTCCAATTGCACCCGCTTCCCCAT
MR2-SDM11 TCTTTCATAAGATTGCAGATATTTTTTCACA
MR2-SDM12 TGTGAAAAAATATCTGCAATCTTATGAAAGA
MR2-SDM13 CCAGTCGTAGTTGAAGCTGCAGCGAATCTTTCAGC
MR2-SDM14 GCTGAAAGATTGGCTGCAGCTTCAACTACGACTCC
MR2-EMSA1 CAAAATTACAACTGTAATATCGGAG
MR2-EMSA2 GCTCCGATATTACAGTTGTAATTTT
MR2-EMSA3 CAACGGCGAAAATTCGCCAGTATAG
MR2-EMSA4 GCTATACTGGCGAATTTTCGCCGTT

a Restriction sites are underlined.

Site-directed Mutagenesis of MecR2

MecR2 mutant variants were obtained as described previously (39, 40). Briefly, a round of two independent PCRs was performed on pCri8::mecR2 with two complementary mutagenic primers and the two flanking mecR2 primers generating two intermediate PCR products with overlapping terminals (for primers and nucleotides; Table 2). For the deletion mutant lacking segment Ser55–Lys62 (protein MecR2-ΔSer55–Lys62), primer pairs MR2–3D F1/MR2-SDM2 and MR2–3D R1/MR2-SDM1 were used; for deletion mutant MecR2-Thr150–Ile160 → GGGG, primers MR2-SDM4 and MR2-SDM3 were used; and for point mutants E228A (MecR2-Glu228 → Ala), N178A,E179A (MecR2-Asn178-Glu179 → Ala-Ala), and E248A (MecR2-Glu248 → Ala), the respective primers were MR2-SDM10 and MR2-SDM9, MR2-SDM14 and MR2-SDM15, and MR2-SDM12 and MR2-SDM11. Both intermediate PCR products were then diluted 50 times and mixed to form the DNA template of the second PCR, using primers spanning the entire mecR2 gene (MR2–3D F1/R1). All PCRs were performed with the Phusion high fidelity DNA polymerase (New England Biolabs).

Cell-based Activity of Recombinant MecR2

To assess the activity of recombinant wild-type MecR2 expressed from vector pCri8a::mecR2 and the aforementioned mutants generated by site-directed mutagenesis, the full respective inserts were cloned into a S. aureus expression vector containing the Pspac IPTG-inducible promoter (pSPT181::spac). Briefly, using flanking primers MR2–3D F1/R1, the insert sequence was amplified using the Phusion high fidelity DNA polymerase (New England Biolabs) and, after digestion with XmaI (New England Biolabs), inserted into the XmaI-linearized pSPT181::spac plasmid using the Rapid DNA dephosphorylation and ligation kit (Roche Applied Science), according to the manufacturer's recommendations. Ligation reactions were transformed into E. coli DH5α cells. Recombinant plasmid integrity was confirmed by restriction analysis, and the correct insert orientation was confirmed by PCR using primer pairs spacF1/MR2-RT2 and spacR1/MR2-RT1. Insert sequences were also confirmed by DNA sequencing at STAB Vida. After stabilization in E. coli, the recombinant plasmid was electroporated into S. aureus restriction-deficient strain RN4220 and finally transduced by the 80α phage to the knock-out mecR2 mutant strain N315 (N315::ΔmecR2), as described previously (41, 42). The ability of the recombinant wild-type and mutant MecR2 expressed in trans to complement the N315::ΔmecR2 oxacillin resistance phenotype was then evaluated, as described previously (34).

Cross-linking Experiments

Recombinant MecR2 (45.0 kDa) was mixed with MecI (14.8 kDa)—produced as described previously (30)—at a molar ration of 1:2.8 in 50 μl of 100 mm HEPES, pH 9.0. Paraformaldehyde was added as cross-linking agent at 0.1% (v/v), and the mixture was incubated at room temperature. The reaction was stopped at distinct time points by adding 10 μl of 5× Laemmli buffer with β-mercaptoethanol. Samples were analyzed by 10% Tricine SDS-PAGE gels stained with Coomassie Blue. Control experiments were performed with both purified proteins alone under the same experimental conditions.

Western Blotting Analysis

The cross-linking reaction was performed as described above, and three different time points (0, 10, and 30 min) were analyzed in 15% Tris-glycine SDS-PAGE. After electrophoresis, the proteins were transferred to 0.45-μm nitrocellulose membranes (Trans-Blot; Bio-Rad), which were blocked at room temperature for 1 h with 20 ml of blocking solution (137 mm sodium chloride, 2.7 mm potassium chloride, 4.3 mm disodium hydrogen phosphate, 1.47 mm potassium dihydrogen phosphate, 0.05% Tween 20) with 6% low fat milk. MecI and MecR2 were detected by immunoblot analysis using custom polyclonal antibodies (from Eurogentec) at dilution 1:1000 and a secondary antibody (goat anti-rabbit IgG (H+L) peroxidase-conjugated antibody; Pierce) at dilution 1:50,000 in 10% blocking solution. The immune complexes were detected using an enhanced chemiluminescence system (SuperSignal West Pico Chemiluminescent; Pierce) according to the manufacturer's instructions. The membranes were exposed to hyperfilm ECL films (GE Healthcare).

Crystallization and Structure Analysis

Crystallization assays were performed by the sitting drop vapor diffusion method. Reservoir solutions were prepared by a Tecan robot, and 100-nl crystallization drops were dispensed on 96 × 2-well MRC plates (Innovadyne) by a Cartesian nanodrop robot (Genomic Solutions) at the High-Throughput Crystallography Platform at Barcelona Science Park for initial screenings at both 20 and 4 °C in Bruker steady temperature crystal farms and using initial protein concentrations of 5.4 and 2.7 mg/ml. Preliminary crystallization hits were improved, and the best conditions were scaled up to the microliter range in 24-well Cryschem crystallization dishes (Hampton Research). Crystals suitable for structure analysis were obtained at 5.4 mg/ml protein concentration in 20 mm Tris·HCl, 200 mm sodium chloride, pH 7.4, by using 0.2 m sodium chloride, 20% PEG 1000, 0.1 m potassium dihydrogen phosphate/disodium hydrogen phosphate, pH 6.2, as reservoir solution. The crystals were cryoprotected with reservoir solution supplemented with 30% glycerol. Crystallization conditions for the selenomethione-derivatized protein were similar to the native ones. Complete diffraction data sets were collected from liquid N2 flash cryocooled crystals at 100 K (provided by an Oxford Cryosystems 700 series cryostream) at beam lines ID23–1 on an ADSC Quantum Q315r CCD detector and ID29 on a Dectris PILATUS 6M pixel detector, respectively, of the European Synchrotron Radiation Facility (Grenoble, France) within the “Block Allocation Group Barcelona.” Crystals were orthorhombic, with two molecules per asymmetric unit. The diffraction data were integrated, scaled, merged, and reduced with programs XDS (43) and SCALA (44) within the CCP4 suite of programs (45) (Table 3).

TABLE 3.

Crystallographic data

Data set Native 1 Native 2 Selenomethionine absorption peak Selenomethionine inflection point
Cell constants (P212121; a, b, c in Å) 66.47, 73.22, 157.38 67.39, 73.14, 157.22 66.62, 73.25, 157.82 66.62, 73.25, 157.82
Wavelength (Å) 0.97626 0.97919 0.97881 0.97908
No. of measurements/unique reflections 402,549/45,488 356,882/39,911 213,853/34,902 154,830/24,460
Resolution range (Å) (outermost shell)a 49.2–2.10 (2.21–2.10) 49.6–2.20 (2.32–2.20) 49.3–2.30 (2.42–2.30) 49.3–2.57 (2.75–2.57)
Completeness (%) 99.6 (98.7) 99.1 (95.0) 99.5 (97.2) 99.9 (100.0)
Rmergeb,c 0.087 (0.716) 0.104 (0.420) 0.054 (0.454) 0.089 (0.708)
Rr.i.m. (= Rmeas)b,c/Rp.i.m.b,c 0.092 (0.777)/0.030 (0.299) 0.110 (0.465)/0.035 (0.194) 0.065 (0.568)/0.035 (0.336) 0.106 (0.843)/0.057 (0.451)
Average intensity (<[<I>/σ(<I>)]>) 19.8 (2.7) 17.0 (3.6) 22.9 (3.1) 19.8 (2.6)
B-Factor (Wilson) (Å2)/average multiplicity 32.4/8.8 (6.4) 27.4/8.9 (5.2) 45.7/6.1 (4.7) 55.8/6.3 (6.4)
Overall anomalous completeness (%)/multiplicity 98.3/3.2 99.4/3.3
Resolution range used for refinement (Å) 49.2–2.10
No. of reflections used (among these, test set) 45,433 (762)
Crystallographic Rfactor (free Rfactor)c 0.190 (0.229)
No. of protein atoms/solvent molecules/ligands/ions 5,813/278/6 (CH2OH)2CHOH/4 K+, 1 PO43 −
Root mean square deviation from target values
    Bonds (Å)/angles (°) 0.010/1.04
Average B-factors for protein atoms (Å2) 49.2
Main chain conformational angle analysisd
    Residues in favored regions/outliers/all residues 705/0/714

a The values in parentheses refer to the outermost resolution shell.

b Friedel mates were treated separately during processing of selenomethionine-derivative data.

c For definitions, see Table I in Ref. 79.

d According to MolProbity (53).

The structure of MecR2 was solved by a combination of multiple-wavelength anomalous diffraction with SHELXE/D (46) and fragment search and density modification with ARCIMBOLDO (47) by using two native data sets and two data sets from a selenomethionine-derivatized crystal collected at the selenium absorption peak and the inflection point as determined by a previous XANES scan (Table 3). The resulting electron density map enabled straightforward tracing of the entire polypeptide chain on a Silicon Graphics Octane2 work station with the program TURBO-Frodo (48). Subsequent crystallographic refinement with BUSTER/TNT (49), which included translation libration screw motion refinement and noncrystallographic symmetry restraints, alternated with manual model building until completion of the model. The latter comprised residues Met1–Ala376, according to UniProt entry Q99XE2 plus an N-terminal proline resulting from the cloning strategy (termed Pro−1; see above) of molecule A and Asp3–Ala376 of molecule B. Three loop segments were disordered and were thus omitted from the final model: Glu52–Ser58 and Leu152–Glu158 of molecule A and Gly51–Pro63 of molecule B. In addition, 1 phosphate anion, 4 potassium cations, 6 glycerol molecules, and 278 solvent molecules were tentatively assigned (Table 3).

Miscellaneous

The figures were prepared with SETOR (50), CHIMERA (51), and TURBO-Frodo. Structure similarities were determined with DALI (52). Experimental model validation was performed with MolProbity (53) and WHATIF (54). Close contacts (<4 Å) and interaction surfaces (taken as half of the surface area buried at the complex interface) were calculated with CNS (55), and interface shape complementarity was computed with SC (56) within CCP4 (45). In all cases, a probe radius of 1.4 Å was used. Interdomain flexibility was ascertained with HingeProt employing standard settings (Ref. 57). The final coordinates are available from the Protein Data Bank (PDB; code 4IJA).

RESULTS AND DISCUSSION

Recombinant Overexpression and Purification of MecR2

Previously, the effects of MecR2 on oxacillin resistance had been studied with a short N-terminally truncated variant of the protein as present in the S. aureus prototype strain N315 (34). Preliminary recombinant overexpression assays in E. coli revealed that this short variant was unstable, and as such, an efficient recombinant overexpression system was developed for full-length MecR2 of S. aureus strain HU25 (GenBankTM accession number AF422694) containing an additional 20-residue N-terminal tag for purification (45.0 kDa; hereafter referred to as wild-type MecR2) by means of expression vector pCri8::mecR2. The protein was folded correctly, eluted as a dimer (see Fig. 2C), and proved suitable for structural and functional studies.

FIGURE 2.

FIGURE 2.

In vitro studies of MecR2 and MecI proteins in solution. A, SDS-PAGE analysis of the time-dependent transition caused by the action of paraformaldehyde from a mixture of purified MecI and MecR2 (14.8 and 45.0 kDa, respectively) to MecR2-MecI heterotetramers. Because of the excess of MecI over MecR2 in the reaction mixture (2.8:1 molar ratio), MecR2 progresses directly from the monomer to the heterotetrameric complex. In contrast, MecI proceeds from a monomer over a homodimer to the heterotetramer. B, Western blot analysis of three different time points of the reaction shown in A (0, 10, and 30 min), confirming the presence of both MecI and MecR2 in the ∼120-kDa heterotetrameric complex bands (framed in A). C, elution profile of recombinant wild-type MecR2 (wt, blue curve) and MecR2-Thr150–Ile160 → GGGG mutant (mut, red curve) proteins on a calibrated Superdex 75 size exclusion chromatography column operated at 0.5 ml/min using 20 mm Tris·HCl, 0.2 m sodium chloride, pH 7.4, as buffer. Cytochrome c (13.08 ml; 12 kDa) was used as an internal marker for reference. 9.60 ml of elution volume correspond to ∼90 kDa. D, far UV CD spectra of wild-type MecR2 (wt, green curve) and MecR2-Thr150–Ile160 → GGGG (mut, red curve) proteins reveal correctly folded species in solution.

Cell-based Activity of Recombinant MecR2

To assess the activity of full-length wild-type MecR2 (including the tag), the insert of vector pCri8::mecR2 was transferred into S. aureus expression vector pSPT181::spac (containing the IPTG-inducible Pspac promoter) to give recombinant plasmid pSPT::spac-mecR2-3D. This plasmid was then transduced into the S. aureus strain N315 mecR2 deletion mutant (N315::ΔmecR2), and its ability to restore the oxacillin resistance phenotype of parental strain N315 was evaluated. As illustrated in Fig. 1, the phenotype of N315 was fully restored in the presence of the inducer (IPTG), demonstrating that the present full-length wild-type MecR2 variant is biologically active.

FIGURE 1.

FIGURE 1.

Biological activity of wild-type and mutant MecR2 variants. The genes encoding wild-type full-length MecR2 (WT), as well as point and replacement mutants of the protein, were cloned into the S. aureus expression vector pSPT181::spac under the control of the IPTG-inducible Pspac promoter. The biological activity of the MecR2 variants was then evaluated by the inhibition halos produced by transformed S. aureus strains on oxacillin disks (containing 1 mg/ml of oxacillin), thus testing the complementation of the phenotype of the mecR2 null mutant in prototype strain N315 (N315::ΔmecR2). Top panel, resistant N315 strain (left panel) and susceptible N315::ΔmecR2 strain (right panel). The second through seventh panels depict the effect of distinct MecR2 variants after induction with IPTG (left panels) and without induction (right panels): WT, MecR2-Thr150–Ile160 → GGGG, MecR2-ΔSer55–Lys62, and point mutants MecR2-Asn178-Glu179 → Ala-Ala, MecR2-Glu228 → Ala, and MecR2-Glu248 → Ala. Variants MecR2-Thr150–Ile160 → GGGG and MecR2-ΔSer55–Lys62 (framed) cannot reconstitute the resistant phenotype, whereas the three latter point mutants can, i.e., these mutations are functionally not relevant.

MecR2 Binds MecI in Cross-linking Experiments

Previous studies had suggested a direct interaction between MecR2 and MecI in a bacterial two-hybrid system and in electrophoretic shift assays of the binding of MecI to the mecA promoter in the presence of MecR2 (34). In this study, we sought to evaluate the binding of recombinant MecI and wild-type MecR2 proteins in vitro. Control cross-linking experiments with each protein alone indicated concentration-dependent dimerization of both proteins (data not shown), in accordance with their dimeric behavior in solution (see above for MecR2 and (30) for MecI). When performing SDS-PAGE of cross-linking reactions of a mixture of MecI and MecR2 with paraformaldehyde, a time-dependent transition leading to a band migrating at ∼120 kDa was observed (Fig. 2A). Western blotting analysis with polyclonal antibodies against both proteins at three different time points of the cross-linking reaction confirmed in the ∼120-kDa band (Fig. 2A, black boxes) the presence of both MecI and MecR2 (Fig. 2B), which is consistent with a MecR2 dimer (2 × 45.0 kDa) binding to a MecI dimer (2 × 14.8 kDa).

Overall Structure of MecR2

The crystal structure of MecR2 was determined by a combination of multiple-wavelength anomalous diffraction and ab initio approaches, and two molecules are present in the asymmetric unit of the crystal, monomers A and B (see Table 3 for crystallographic data). The monomer structure reveals an elongated shape of roughly 45 × 60 × 80 Å that is subdivided into three domains: an N-terminal DNA-binding domain (NDD), an intermediate scaffold domain (ISD), and a C-terminal dimerization domain (CDD) (Fig. 3A; the orientation of the left panel is hereafter taken as a reference). NDD (residues Pro−1/Asp3–His70) starts at the front surface, close to the top of the molecule, and enters a small αβ domain. It consists of three α-helices (α1–α3) followed by a β-ribbon (β1β2) whose tip—the loop connecting β1 and β2 (Lβ1β2)—is disordered (Fig. 3, A and B). These elements conform to the architecture of a winged helix-turn-helix domain as observed in DNA-binding transcriptional repressors, which generally show disordered β-ribbon tips when not bound to operator DNA (58). In the latter, α1 and α2 contribute to creating a scaffold for correct positioning of helix α3. This is the recognition helix that penetrates the major groove of double-stranded DNA, as found in the DNA-binding domains (DBDs) of MecI and BlaI, for example (29–32).

FIGURE 3.

FIGURE 3.

Molecular structure of MecR2. A, ribbon-type plot of MecR2 in three orthogonal views depicting the NDD (cyan helices and blue strands), ISD (yellow helices and orange strands), and CDD (pink helices and magenta strands). The tentatively assigned potassium and phosphate ions (monomer A) are depicted as green and orange/red spheres, respectively. The flanking residues of the disordered regions within NDD and ISD are indicated by black and gray arrows, respectively. B, topology scheme of MecR2 showing the regular secondary structure elements of MecR2 with their labels and delimiting amino acid positions. A 2-fold axis relating the β-sheets of ISD and CDD is depicted in discontinuous trace. The position of the ligand-binding cleft is further indicated. C, cartoon depicting the topology of the main building elements of ISD and CDD, the five-stranded β-sheet, and its three flanking helices. Each structural element carries the labels as found in the two domains. The arrows hallmark insertion points of distinct secondary structure elements within each domain: encircled 1 for ISD and encircled 2 for CDD.

After strand β2, the polypeptide chain enters ISD (residues Leu71–Asn193 + Ser346–Ala376), which contains a central twisted five-stranded β-sheet (β3–β6 plus β9) that is parallel for all but one of its strands and shows connectivity −1, −1, +3x, +1x (Fig. 3, B and C). On its right, the sheet accommodates two helices (α4 and α5) and a short β-hairpin (β7β8), which is inserted between β6 and α5 and is folded back toward the sheet (Fig. 3, A and B); on its left, two perpendicular helices (α6 and α12) are found. In monomer A, segment Leu152–Glu158 within Lβ8α5 on the front surface of the molecule is disordered (Fig. 3, A and B). Inserted between the latter helices is the CDD (residues Leu194–Thr345), which starts with a five-stranded β-sheet (β10–β12 plus β15 and β16) that is equivalent to the one found in ISD, both in connectivity and in topology (Fig. 3, B and C). On its bottom side, this sheet is decorated with helices inserted between β12 and β15 (α7-α9) and between β15 and β16 (α10 and α11). In addition, a long β-ribbon (β13β14) is inserted between β12 and α7; it contributes to oligomerization (see below). The overall architecture of ISD and CDD is such that the two respective β-sheets trap helices α6 and α12 in between, so that a pseudo-2-fold axis is generated that matches one sheet plus its helix with the other sheet-helix pair (Fig. 3B). Thus, α6 could be formally assigned to either ISD or CDD. The interface between these two domains contributes to an apparent ligand-binding cleft (Figs. 3B and 4A). It is framed by Lβ6β7 and β7 at its top; β10, Lβ10β11, β11 plus Lβ12β13 and Lβ14α7 at its bottom; Lβ9α6 and α6 at its back; residue Tyr82 of Lβ3β4 on its right; and Arg200 of β10 and Glu177 of β9 on its left (Fig. 4A). The cleft accommodates two (potential) potassium cations and a (tentative) phosphate anion in monomer A; in monomer B only one cation-binding site is found, which is created by atoms Asn181 Oδ1, Ala210 O, and Ala226 O, all 2.6–2.9Å apart from the metal. A further three (monomer B) and four (monomer A) solvent molecules 3.0–3.6 Å apart from the metal complete the ligand sphere of this site. The rightmost potassium of monomer A is much more loosely bound, with just two protein atoms at <3.5 Å: Asn314 O and Ser203 Oγ. Finally, the phosphate anion of monomer A is bound by Asn178 Nδ2, His140 Nδ1, Glu179 Oϵ1, and a solvent molecule (Fig. 4A).

FIGURE 4.

FIGURE 4.

Ligand-binding cleft and quaternary structure of MecR2. A, detail of the apparent ligand-binding cleft of MecR2 monomer A in stereo. Selected residues, the phosphate anion, and the two potassium cations are labeled. B, MecR2 dimer made up of monomer A (right panel; similar orientation to Fig. 3A, left panel) and monomer B (left panel). The three domains are depicted in cyan/blue (NDD), salmon/orange (ISD), and purple/magenta (CDD). Potassium and phosphate ions are shown as green and orange/red spheres, respectively. The flanking residues of the flexible region within Lβ8α5 of ISD are indicated by black arrows. C, same as B showing the result of the analysis of interdomain flexibility based on the elastic network model.

Oligomeric State of MecR2

MecR2 eluted as a dimer in calibrated size exclusion chromatography, and a dimer was also found to bind a MecI dimer in cross-linking experiments (see above). Consistent with this, the two molecules found in the crystal asymmetric unit give rise to a dimer with a large interaction surface (1,465 Å2; ∼8% of the total surface of a monomer) with complementarity (0.72) that is in the range reported for protein oligomers and protein/protein inhibitor interfaces (0.70–0.76) (56). This interaction includes 83 contacts (<4 Å), among them roughly symmetric hydrophobic contacts between nine residues of either monomer and 34 hydrogen bonds and polar interactions. Altogether, these findings point to biological relevance for the dimeric arrangement. Protein segments involved in dimerization are provided by each CDD: Lα6β10, Lβ11β12, the second half of α9 and Lα9β15, and β-ribbon β13β14. The two monomers are not completely equivalent, and this gives rise to an root mean square deviation value upon superposition of 0.97 Å for 353 Cα atoms deviating less than 3 Å out of 361 common residues. Analysis of interdomain flexibility based on the elastic network model revealed potential hinge motions at the two domain junctions of each monomer, which increase upon going from the CDDs to the NDDs (Fig. 4C).

Structural Similarities

Sequence similarity searches suggested that MecR2 groups with the ROK family of proteins (from repressors, open reading frames, and kinases), which includes transcriptional repressors and sugar kinases (59–61). One archetypal ROK protein is xylose transcriptional repressor (XylR), which regulates xylose utilization as a carbon source in bacteria (62–66). However, there is no structural data on XylR available. E. coli protein Mlc is the only functionally and structurally characterized ROK family protein with DNA repressor function (60, 67). Mlc is a dimeric/tetrameric transcriptional repressor that controls the utilization of glucose in E. coli (68). It shows overall fold similarity and quaternary arrangement with MecR2 and is likewise subdivided into three domains equivalent to NDD, ISD, and CDD. In addition, two unpublished structures corresponding to proteins of unknown function from Thermotoga maritima (PDB code 2HOE) and Vibrio cholerae (PDB 1Z05), deposited with the PDB by structural genomics consortia, also displayed high structural similarity scores with MecR2. These are the only three-domain ROK proteins structurally reported, which form part of a large group of mostly two-domain (ISD+CDD) ROK proteins, generally dimeric or tetrameric sugar kinases that bind and phosphorylate glucides (59–61, 69).

MecR2 Has a Nonfunctional Ligand-binding Cleft

As for MecR2, Mlc has a ligand-binding cleft that sits at the interface between ISD and CDD. It further has an adjacent regulatory zinc-binding site, which is required for repressor activity (60) and is provided by the segment topologically equivalent to the protruding β-ribbon β13β14 in MecR2. In contrast to the latter, however, this segment is folded back toward the body of the molecule in Mlc, in a fashion similar to that in ROK glucokinase from E. coli (70) and glucomannokinase from Arthrobacter sp. (71), where it contributes to shaping the floor of a sugar-binding cleft. This segment encompasses a widely conserved consensus sequence among ROK proteins, CXCGXXGCXE (60, 69), which contains three zinc-binding cysteine residues. A similar site is also found in Bacillus subtilis fructokinase YdhR (72), an undescribed putative glucokinase from Enterococcus faecalis (PDB code 2QM1), an undescribed putative regulatory protein from Salmonella typhimurium (PDB code 2AP1), and the aforementioned protein from V. cholerae, so that ROK family members containing this consensus sequence share a conserved metal-binding site. By contrast, MecR2 lacks these cysteine residues, and its chain trace is completely different in the corresponding region, giving rise to an extended β-ribbon that engages in dimerization (see above). This β-ribbon is similar in the aforementioned protein from T. maritima, although in this case the ribbon is four residues shorter than that in MecR2. Only the last glutamate of the consensus sequence is found in the latter two proteins—Glu248 in MecR2—and it contributes to the hypothetical ligand-binding cleft (see above).

Another ROK signature motif is found in several ROK proteins comprising the C-terminal residues EXGH, about 10 residues upstream of the previous consensus sequence (see Fig. 4 in Ref. 69). The histidine—missing in MecR2—is engaged in zinc binding in Mlc and the V. cholerae protein, whereas the glutamate—equivalent to Glu228 in MecR2—is engaged in sugar binding in E. coli glucokinase and Arthrobacter sp. glucomannokinase, together with the conserved residues at positions equivalent to Glu248, Asn178, and Glu179 in MecR2. The latter two residues are engaged in phosphate anion binding (see above). Although these residues are likewise conserved in Mlc, this protein does not bind glucose, i.e., its regulation does not depend on allosteric changes induced by sugar binding (73): inactivation is exerted through recruitment by the glucose transporter protein EIICBGlc of the phosphotransferase system (74–76). By contrast, XylR binds xylose, glucose, and glucose-6-phosphate in vitro (66), i.e., it is a three-domain transcriptional repressor with a functional regulatory sugar-binding cleft. Overall, these findings indicate that ROK proteins include members that bind sugars such as the sugar kinases and XylR but also some that do not such as Mlc. Accordingly, we set out to assess whether MecR2 has a functional sugar-binding ligand-binding site despite lacking the zinc-binding site, and three mutants affecting participating residues (MecR2-Asn178Glu179 → Ala-Ala, MecR2-Glu228 → Ala, and MecR2-Glu248 → Ala) were constructed and assayed for their functional roles in the mec locus. These studies revealed that the mutants showed antirepressor activity in cell-based assays that was indistinguishable from the wild-type protein (Fig. 1). We therefore conclude that ligand binding is not required for function in MecR2, i.e., that it has a nonfunctional ligand-binding cleft.

MecR2 Has Nonspecific DNA Binding Capacity

Three-domain ROK transcriptional repressors such as Mlc and XylR possess N-terminal DBDs that engage in DNA-operator binding and thus in the regulation of the transcription of the respective effector genes (60, 65). MecR2 NDD likewise conforms to the structural determinants of such a DBD (see above). The reported structures of Mlc, T. maritima, and V. cholerae are DNA-unbound, and they display the two recognition helices of a dimer in a relative spatial arrangement that is not adequate for binding to two successive turns of the major groove of dsDNA (60, 67). This is consistent with the finding that structural flexibility—which allows for major structural rearrangement—of Mlc was identified as essential for DNA binding activity and regulatory function (67).

We set out to assess the DNA binding capacity of MecR2 in an electrophoretic mobility shift assay in the presence of a 25-bp dsDNA encompassing the Z-dyad sequence of the bla promoter sequence (MR2-EMSA1 and 2 in Table 2), which had been used for structural and functional studies of MecI (29, 30). We found that MecR2 strongly bound and completely retarded this DNA at a protein:dsDNA ratio of 4:1 (Fig. 5, left panel). Similar effects were observed on another 25-bp dsDNA of scrambled sequence (see MR2-EMSA 3 and 4 in Table 2; Fig. 5, right panel). These results indicate strong but unspecific DNA binding in vitro. To assess the potential biological importance of this function, a deletion mutant was constructed, MecR2-ΔSer55–Lys62, in which seven residues of Lβ1β2 within the winged helix NDD had been deleted. This variant showed significantly diminished antirepressor activity when compared with the wild-type protein (Fig. 1). We conclude that MecR2 possesses a functional DBD that may be required for exerting oxacillin resistance.

FIGURE 5.

FIGURE 5.

Electrophoretic mobility shift assays with MecR2. Electrophoretic mobility shift assays with a 25-bp dsDNA encompassing the recognition sequence of MecI/BlaI within the blaZ promoter (left panel) and a 25-bp dsDNA with the same nucleotide composition but scrambled sequence (right panel). In each panel, the left lane depicts controls with DNA alone, and lanes 2–5 show the effect of increasing amounts of MecR2 protein (protein:dsDNA ratios of 0.5:1, 1:1, 2:1, and 4:1).

ISD May Be Relevant for Function

In the search for biologically relevant regions of the structure of MecR2, we noticed that the flexible segment contained within Lβ8α5 of ISD was located on the surface of one of the two monomers within the dimer (see above and Fig. 4B). We constructed a mutant in which an 11-residue stretch was replaced by 4 glycines (MecR2-Thr150–Ile160 → GGGG) to maintain the overall structure of the domain and assayed its cell-based activity (Fig. 1). Similarly to MecR2-ΔSer55–Lys62, this variant was not capable of restoring the oxacillin resistance phenotype in the presence of inducer.

To verify that this effect was not due to an unfolded protein variant, MecR2-Thr150–Ile160 → GGGG was recombinantly overexpressed under the same conditions as wild-type MecR2. Both proteins evinced comparable elution profiles in calibrated size exclusion chromatography, which revealed that both proteins were well folded and dimeric (Fig. 2C). In addition, circular dichroism experiments showed indistinguishable spectra for both protein variants, which likewise correspond to properly folded proteins (Fig. 2D). Accordingly, the phenotype observed for the mutant is actually due to the missing ISD fragment, and we conclude that this region may be implicated in biological activity.

Functional Implications of MecR2

The similarity of MecR2 with ROK family bacterial sugar kinases and transcriptional repressors, both in the overall monomeric structures and in the general dimeric quaternary arrangements, have evolutionary and functional implications. Accordingly, XylR would represent the first step in evolution from an ancient two-domain ROK sugar-binding kinase—putatively evolved from a common ancestral hexokinase (69, 77)—refurbished to produce a three-domain DNA-binding transcriptional repressor through N-terminal fusion with a winged helix-turn-helix DBD. XylR still binds and is allosterically regulated by sugar. Mlc would represent the next step—as already anticipated in (60)—to a three-domain DNA-binding transcriptional repressor that does not bind sugar and is not regulated by binding to an inducer or by proteolytic cleavage but through sequestration by a glucose transporter, i.e., through a protein-protein interaction (67, 76). Finally, MecR2 would represent a last step in the evolutionary process, in which a three-domain ligand-independent Mlc-like repressor would have kept an unspecific DNA binding ability putatively required for biological function as an antirepressor. In addition, the dimeric protein would have developed a region within its ISD that potentially would likewise be required for antibiotic resistance. This antirepressor activity would entail binding and sequestering away from its cognate promoter a dimeric transcriptional repressor, MecI. Finally, MecI sequestering would suppress its repressor activity of the mec locus by promoting its proteolytic cleavage, presumably by native proteinases, and enhancing the signal transduction mediated by the cognate integral membrane sensor-transducer, MecR1. This, in turn, would trigger the methicillin resistance response.

Acknowledgments

We are grateful to the High-Throughput Crystallography Platform at Barcelona Science Park for assistance during crystallization experiments and to Raquel García-Castellanos for important contributions to the project. We acknowledge the help provided by European Synchrotron Radiation Facility synchrotron local contacts.

*

This work was supported in part by the European Union through Grant FP7-HEALTH-F3-2009-223101 (AntiPathoGN), Grant FP7-HEALTH-2010-261460 (Gums & Joints), Grant FP7-PEOPLE-2011-290246 (RAPID), and Grant FP7-HEALTH-2012-306029-2 (TRIGGER). This work was also supported by Grants BFU2012-32862, BIO2009-10334, and CSD2006-00015 from Spanish Ministries; Grant 2009SGR1036 from the National Government of Catalonia; Grant 100372 from Fundació La Marató de TV3; and Grants POCTI/BIA-MIC/60320/2004, PTDC/BIA-MIC/64071/2006, and SNF200020/125020/1 from Portuguese agencies. Funding provided by the European Synchrotron Radiation Facility partially covered for the cost of data collection.

The atomic coordinates and structure factors (code 4IJA) have been deposited in the Protein Data Bank (http://wwpdb.org/).

5
The abbreviations used are:
MRSA
methicillin-resistant S. aureus
BLA
β-lactam antibiotic
BlaZ
β-lactamase
CDD
C-terminal dimerization domain
DBD
DNA-binding domain
IPTG
isopropyl-β-d-1-thiogalactopyranoside
ISD
intermediate scaffold domain
NDD
N-terminal DNA-binding domain
PDB
Protein Data Bank
TEV
tobacco etch virus
Tricine
N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine.

REFERENCES

  • 1. Rammelkamp C. H., Maxon T. (1942) Resistance of Staphylococcus aureus to action of penicillin. Proc. Soc. Exp. Biol. Med. 51, 386–389 [Google Scholar]
  • 2. DeLeo F. R., Otto M., Kreiswirth B. N., Chambers H. F. (2010) Community-associated methicillin-resistant Staphylococcus aureus. Lancet 375, 1557–1568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Johnson A. P. (2011) Methicillin-resistant Staphylococcus aureus. The European landscape. J. Antimicrob. Chemother. 66, (Suppl 4) iv43–iv48 [DOI] [PubMed] [Google Scholar]
  • 4. Lowy F. D. (2003) Antimicrobial resistance. The example of Staphylococcus aureus. J. Clin. Invest. 111, 1265–1273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Storrs M. J., Courvalin P., Foster T. J. (1988) Genetic analysis of gentamicin resistance in methicillin- and gentamicin-resistant strains of Staphylococcus aureus isolated in Dublin hospitals. Antimicrob. Agents Chemother. 32, 1174–1181 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Hiramatsu K. (2001) Vancomycin-resistant Staphylococcus aureus. A new model of antibiotic resistance. Lancet Infect. Dis. 1, 147–155 [DOI] [PubMed] [Google Scholar]
  • 7. Pérez-Vázquez M., Vindel A., Marcos C., Oteo J., Cuevas O., Trincado P., Bautista V., Grundmann H., Campos J. (2009) Spread of invasive Spanish Staphylococcus aureus spa-type t067 associated with a high prevalence of the aminoglycoside-modifying enzyme gene ant(4′)-Ia and the efflux pump genes msrA/msrB. J. Antimicrob. Chemother. 63, 21–31 [DOI] [PubMed] [Google Scholar]
  • 8. Llarrull L. I., Testero S. A., Fisher J. F., Mobashery S. (2010) The future of the β-lactams. Curr. Opin. Microbiol. 13, 551–557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Hiramatsu K., Cui L., Kuroda M., Ito T. (2001) The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol. 9, 486–493 [DOI] [PubMed] [Google Scholar]
  • 10. Mallorquí-Fernández G., Marrero A., García-Piquè S., García-Castellanos R., Gomis-Rüth F. X. (2004) Staphylococcal methicillin resistance. Fine focus on folds and functions. FEMS Microbiol. Lett. 235, 1–8 [DOI] [PubMed] [Google Scholar]
  • 11. Ito T., Katayama Y., Hiramatsu K. (1999) Cloning and nucleotide sequence determination of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob. Agents Chemother. 43, 1449–1458 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Weller T. M. (1999) The distribution of mecA, mecR1 and mecI and sequence analysis of mecI and the mec promoter region in staphylococci expressing resistance to methicillin. J. Antimicrob. Chemother. 43, 15–22 [DOI] [PubMed] [Google Scholar]
  • 13. Hiramatsu K., Asada K., Suzuki E., Okonogi K., Yokota T. (1992) Molecular cloning and nucleotide sequence determination of the regulator region of mecA gene in methicillin-resistant Staphylococcus aureus (MRSA). FEBS Lett. 298, 133–136 [DOI] [PubMed] [Google Scholar]
  • 14. Geronimus L. H., Cohen S. (1957) Induction of staphylococcal penicillinase. J. Bacteriol. 73, 28–34 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Clarke S. R., Dyke K. G. (2001) Studies of the operator region of the Staphylococcus aureus β-lactamase operon. J. Antimicrob. Chemother. 47, 377–389 [DOI] [PubMed] [Google Scholar]
  • 16. Livermore D. M. (1995) β-Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev. 8, 557–584 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Archer G. L., Bosilevac J. M. (2001) Signalling antibiotic resistance in Staphylococci. Science 291, 1915–1916 [DOI] [PubMed] [Google Scholar]
  • 18. Kerff F., Charlier P., Colombo M.-L., Sauvage E., Brans A., Frère J.-M., Joris B., Fonzé E. (2003) Crystal structure of the sensor domain of the BlaR penicillin receptor from Bacillus licheniformis. Biochemistry 42, 12835–12843 [DOI] [PubMed] [Google Scholar]
  • 19. Marrero A., Mallorquí-Fernández G., Guevara T., García-Castellanos R., Gomis-Rüth F. X. (2006) Unbound and acylated structures of the MecR1 extracellular antibiotic-sensor domain provide insights into the signal-transduction system that triggers methicillin resistance. J. Mol. Biol. 361, 506–521 [DOI] [PubMed] [Google Scholar]
  • 20. Duval V., Swinnen M., Lepage S., Brans A., Granier B., Franssen C., Frère J.-M., Joris B. (2003) The kinetic properties of the carboxy terminal domain of the Bacillus licheniformis 749/I BlaR penicillin-receptor shed a new light on the derepression of β-lactamase synthesis. Mol. Microbiol. 48, 1553–1564 [DOI] [PubMed] [Google Scholar]
  • 21. Birck C., Cha J. Y., Cross J., Schulze-Briese C., Meroueh S. O., Schlegel H. B., Mobashery S., Samama J.-P. (2004) X-ray crystal structure of the acylated β-lactam sensor domain of BlaR1 from Staphylococcus aureus and the mechanism of receptor activation for signal transduction. J. Am. Chem. Soc. 126, 13945–13947 [DOI] [PubMed] [Google Scholar]
  • 22. Cha J., Vakulenko S. B., Mobashery S. (2007) Characterization of the β-lactam antibiotic sensor domain of the MecR1 signal sensor/transducer protein from methicillin-resistant. Staphylococcus aureus. Biochemistry 46, 7822–7831 [DOI] [PubMed] [Google Scholar]
  • 23. Hanique S., Colombo M.-L., Goormaghtigh E., Soumillion P., Frère J. M., Joris B. (2004) Evidence of an intra molecular interaction between the two domains of the BlaR1 penicillin receptor during the signal transduction. J. Biol. Chem. 279, 14264–14272 [DOI] [PubMed] [Google Scholar]
  • 24. Zhang H. Z., Hackbarth C. J., Chansky K. M., Chambers H. F. (2001) A proteolytic transmembrane signaling pathway and resistance to β-lactams in staphylococci. Science 291, 1962–1965 [DOI] [PubMed] [Google Scholar]
  • 25. Berzigotti S., Benlafya K., Sépulchre J., Amoroso A., Joris B. (2012) Bacillus licheniformis BlaR1 L3 loop is a zinc metalloprotease activated by self-proteolysis. PLoS One 7, e36400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Llarrull L. I., Mobashery S. (2012) Dissection of events in the resistance to β-lactam antibiotics mediated by the protein BlaR1 from Staphylococcus aureus. Biochemistry 51, 4642–4649 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Llarrull L. I., Toth M., Champion M. M., Mobashery S. (2011) Activation of BlaR1 protein of methicillin-resistant Staphylococcus aureus, its proteolytic processing, and recovery from induction of resistance. J. Biol. Chem. 286, 38148–38158 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Amoroso A., Boudet J., Berzigotti S., Duval V., Teller N., Mengin-Lecreulx D., Luxen A., Simorre J. P., Joris B. (2012) A peptidoglycan fragment triggers β-lactam resistance in Bacillus licheniformis. PLoS Pathog. 8, e1002571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. García-Castellanos R., Mallorquí-Fernández G., Marrero A., Potempa J., Coll M., Gomis-Rüth F. X. (2004) On the transcriptional regulation of methicillin resistance. MecI repressor in complex with its operator. J. Biol. Chem. 279, 17888–17896 [DOI] [PubMed] [Google Scholar]
  • 30. García-Castellanos R., Marrero A., Mallorquí-Fernández G., Potempa J., Coll M., Gomis-Ruth F. X. (2003) Three-dimensional structure of MecI. Molecular basis for transcriptional regulation of staphylococcal methicillin resistance. J. Biol. Chem. 278, 39897–39905 [DOI] [PubMed] [Google Scholar]
  • 31. Safo M. K., Ko T. P., Musayev F. N., Zhao Q., Wang A. H., Archer G. L. (2006) Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec. Acta Crystallogr. Sect. F. Struct. Biol. Cryst. Commun. 62, 320–324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Safo M. K., Zhao Q., Ko T. P., Musayev F. N., Robinson H., Scarsdale N., Wang A. H., Archer G. L. (2005) Crystal structures of the BlaI repressor from Staphylococcus aureus and its complex with DNA. Insights into transcriptional regulation of the bla and mec operons. J. Bacteriol. 187, 1833–1844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Oliveira D. C., de Lencastre H. (2011) Methicillin-resistance in Staphylococcus aureus is not affected by the overexpression in trans of the mecA gene repressor. A surprising observation. PLoS One 6, e23287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Arêde P., Milheiriço C., de Lencastre H., Oliveira D. C. (2012) The anti-repressor MecR2 promotes the proteolysis of the mecA repressor and enables optimal expression of β-lactam resistance in MRSA. PLoS Pathog. 8, e1002816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Cohen S., Sweeney H. M. (1968) Constitutive penicillinase formation in Staphylococcus aureus owing to a mutation unlinked to the penicillinase plasmid. J. Bacteriol. 95, 1368–1374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Lewis R. A., Dyke K. G. (2000) MecI represses synthesis from the β-lactamase operon of Staphylococcus aureus. J. Antimicrob. Chemother. 45, 139–144 [DOI] [PubMed] [Google Scholar]
  • 37. Filée P., Benlafya K., Delmarcelle M., Moutzourelis G., Frère J. M., Brans A., Joris B. (2002) The fate of the BlaI repressor during the induction of the Bacillus licheniformis BlaP β-lactamase. Mol. Microbiol. 44, 685–694 [DOI] [PubMed] [Google Scholar]
  • 38. Hartman B. J., Tomasz A. (1986) Expression of methicillin resistance in heterogeneous strains of Staphylococcus aureus. Antimicrob. Agents Chemother. 29, 85–92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Ho S. N., Hunt H. D., Horton R. M., Pullen J. K., Pease L. R. (1989) Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59 [DOI] [PubMed] [Google Scholar]
  • 40. Senanayake S. D., Brian D. A. (1995) Precise large deletions by the PCR-based overlap extension method. Mol. Biotechnol. 4, 13–15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Kraemer G. R., Iandolo J. J. (1990) High-frequency transformation of Staphylococcus aureus by electroporation. Curr. Microbiol. 21, 373–376 [Google Scholar]
  • 42. Oshida T., Tomasz A. (1992) Isolation and characterization of a Tn551-autolysis mutant of Staphylococcus aureus. J. Bacteriol. 174, 4952–4959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Kabsch W. (2001) Chapter 25.2.9. XDS in International Tables for Crystallography. Volume F. Crystallography of Biological Macromolecules (Rossmann M. G., Arnold E., eds) 1st Ed., pp 730–734, Kluwer Academic Publishers, Dordrecht, The Netherlands [Google Scholar]
  • 44. Evans P. (2006) Scaling and assessment of data quality. Acta Crystallogr. D Biol. Crystallogr. 62, 72–82 [DOI] [PubMed] [Google Scholar]
  • 45. Collaborative Computational Project, Number 4 (1994) The CCP4 suite. Programs for protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 50, 760–763 [DOI] [PubMed] [Google Scholar]
  • 46. Sheldrick G. M. (2010) Experimental phasing with SHELXC/D/E. Combining chain tracing with density modification. Acta Crystallogr. D Biol. Crystallogr. 66, 479–485 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Rodríguez D. D., Grosse C., Himmel S., González C., de Ilarduya I. M., Becker S., Sheldrick G. M., Usón I. (2009) Crystallographic ab initio protein structure solution below atomic resolution. Nat. Methods 6, 651–653 [DOI] [PubMed] [Google Scholar]
  • 48. Carranza C., Inisan A.-G., Mouthuy-Knoops E., Cambillau C., Roussel A. (1999) Turbo-Frodo. in AFMB Activity Report 1996–1999, pp. 89–90, CNRS-UPR 9039, Marseille [Google Scholar]
  • 49. Blanc E., Roversi P., Vonrhein C., Flensburg C., Lea S. M., Bricogne G. (2004) Refinement of severely incomplete structures with maximum likelihood in BUSTER-TNT. Acta Crystallogr. D Biol. Crystallogr. 60, 2210–2221 [DOI] [PubMed] [Google Scholar]
  • 50. Evans S. V. (1993) SETOR. Hardware lighted three-dimensional solid model representations of macromolecules. J. Mol. Graphics 11, 134–138 [DOI] [PubMed] [Google Scholar]
  • 51. Pettersen E. F., Goddard T. D., Huang C. C., Couch G. S., Greenblatt D. M., Meng E. C., Ferrin T. E. (2004) UCSF Chimera. A visualization system for exploratory research and analysis. J. Comput. Chem. 25, 1605–1612 [DOI] [PubMed] [Google Scholar]
  • 52. Holm L., Kaariainen S., Wilton C., Plewczynski D. (2006) Using Dali for structural comparison of proteins. Curr. Protoc. Bioinformatics, Chapter 5, Unit 5.5 [DOI] [PubMed] [Google Scholar]
  • 53. Davis I. W., Leaver-Fay A., Chen V. B., Block J. N., Kapral G. J., Wang X., Murray L. W., Arendall W. B., 3rd, Snoeyink J., Richardson J. S., Richardson D. C. (2007) MolProbity. All-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res. 35, W375–W383 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Vriend G. (1990) What if. A molecular modelling and drug design program. J. Mol. Graph. 8, 52–56 [DOI] [PubMed] [Google Scholar]
  • 55. Brünger A. T., Adams P. D., Clore G. M., DeLano W. L., Gros P., Grosse-Kunstleve R. W., Jiang J.-S., Kuszewski J., Nilges M., Pannu N. S., Read R. J., Rice L. M., Simonson T., Warren G. L. (1998) Crystallography & NMR System. A new software suite for macromolecular structure determination. Acta Crystallogr. D Biol. Crystallogr. 54, 905–921 [DOI] [PubMed] [Google Scholar]
  • 56. Lawrence M. C., Colman P. M. (1993) Shape complementarity at protein/protein interfaces. J. Mol. Biol. 234, 946–950 [DOI] [PubMed] [Google Scholar]
  • 57. Emekli U., Schneidman-Duhovny D., Wolfson H. J., Nussinov R., Haliloglu T. (2008) HingeProt. Automated prediction of hinges in protein structures. Proteins 70, 1219–1227 [DOI] [PubMed] [Google Scholar]
  • 58. Gajiwala K. S., Burley S. K. (2000) Winged helix proteins. Curr. Opin. Struct. Biol. 10, 110–116 [DOI] [PubMed] [Google Scholar]
  • 59. Titgemeyer F., Reizer J., Reizer A., Saier M. H., Jr. (1994) Evolutionary relationships between sugar kinases and transcriptional repressors in bacteria. Microbiology 140, 2349–2354 [DOI] [PubMed] [Google Scholar]
  • 60. Schiefner A., Gerber K., Seitz S., Welte W., Diederichs K., Boos W. (2005) The crystal structure of Mlc, a global regulator of sugar metabolism in Escherichia coli. J. Biol. Chem. 280, 29073–29079 [DOI] [PubMed] [Google Scholar]
  • 61. Kawai S., Mukai T., Mori S., Mikami B., Murata K. (2005) Hypothesis. Structures, evolution, and ancestor of glucose kinases in the hexokinase family. J. Biosci. Bioeng. 99, 320–330 [DOI] [PubMed] [Google Scholar]
  • 62. Shamanna D. K., Sanderson K. E. (1979) Uptake and catabolism of d-xylose in Salmonella typhimurium LT2. J. Bacteriol. 139, 64–70 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Schellenberg G. D., Sarthy A., Larson A. E., Backer M. P., Crabb J. W., Lidstrom M., Hall B. D., Furlong C. E. (1984) Xylose isomerase from Escherichia coli. Characterization of the protein and the structural gene. J. Biol. Chem. 259, 6826–6832 [PubMed] [Google Scholar]
  • 64. Gärtner D., Geissendörfer M., Hillen W. (1988) Expression of the Bacillus subtilis xyl-operon is repressed at the level of transcription and is induced by xylose. J. Bacteriol. 170, 3102–3109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Sizemore C., Buchner E., Rygus T., Witke C., Götz F., Hillen W. (1991) Organization, promoter analysis and transcriptional regulation of the Staphylococcus xylosus xylose utilization operon. Mol. Gen. Genet. 227, 377–384 [DOI] [PubMed] [Google Scholar]
  • 66. Dahl M. K., Schmiedel D., Hillen W. (1995) Glucose and glucose-6-phosphate interaction with Xyl repressor proteins from Bacillus spp. may contribute to regulation of xylose utilization. J. Bacteriol. 177, 5467–5472 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Nam T. W., Jung H. I., An Y. J., Park Y. H., Lee S. H., Seok Y. J., Cha S. S. (2008) Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc inactivation by membrane sequestration. Proc. Natl. Acad. Sci. U.S.A. 105, 3751–3756 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Plumbridge J. (2002) Regulation of gene expression in the PTS in Escherichia coli. The role and interactions of Mlc. Curr. Opin. Microbiol. 5, 187–193 [DOI] [PubMed] [Google Scholar]
  • 69. Hansen T., Reichstein B., Schmid R., Schönheit P. (2002) The first archaeal ATP-dependent glucokinase, from the hyperthermophilic crenarchaeon Aeropyrum pernix, represents a monomeric, extremely thermophilic ROK glucokinase with broad hexose specificity. J. Bacteriol. 184, 5955–5965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Lunin V. V., Li Y., Schrag J. D., Iannuzzi P., Cygler M., Matte A. (2004) Crystal structures of Escherichia coli ATP-dependent glucokinase and its complex with glucose. J. Bacteriol. 186, 6915–6927 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Mukai T., Kawai S., Mori S., Mikami B., Murata K. (2004) Crystal structure of bacterial inorganic polyphosphate/ATP-glucomannokinase. Insights into kinase evolution. J. Biol. Chem. 279, 50591–55600 [DOI] [PubMed] [Google Scholar]
  • 72. Nocek B. P., Gillner D. M., Fan Y., Holz R. C., Joachimiak A. (2010) Structural basis for catalysis by the mono- and dimetalated forms of the dapE-encoded N-succinyl-l,l-diaminopimelic acid desuccinylase. J. Mol. Biol. 397, 617–626 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73. Richarme G., Kepes A. (1983) Study of binding protein-ligand interaction by ammonium sulfate-assisted adsorption on cellulose esters filters. Biochim. Biophys. Acta 742, 16–24 [DOI] [PubMed] [Google Scholar]
  • 74. Lee S. J., Boos W., Bouché J. P., Plumbridge J. (2000) Signal transduction between a membrane-bound transporter, PtsG, and a soluble transcription factor, Mlc, of Escherichia coli. EMBO J. 19, 5353–5361 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75. Tanaka Y., Kimata K., Aiba H. (2000) A novel regulatory role of glucose transporter of Escherichia coli. Membrane sequestration of a global repressor Mlc. EMBO J. 19, 5344–5352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76. Nam T. W., Cho S. H., Shin D., Kim J. H., Jeong J. Y., Lee J. H., Roe J. H., Peterkofsky A., Kang S. O., Ryu S., Seok Y. J. (2001) The Escherichia coli glucose transporter enzyme IICB(Glc) recruits the global repressor Mlc. EMBO J. 20, 491–498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77. Cárdenas M. L., Cornish-Bowden A., Ureta T. (1998) Evolution and regulatory role of the hexokinases. Biochim. Biophys. Acta 1401, 242–264 [DOI] [PubMed] [Google Scholar]
  • 78. Kapust R. B., Waugh D. S. (1999) Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused. Protein Sci. 8, 1668–1674 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. de Diego I., Veillard F. T., Guevara T., Potempa B., Sztukowska M., Potempa J., Gomis-Rüth F. X. (2013) Porphyromonas gingivalis virulence factor gingipain RgpB shows a unique zymogenic mechanism for cysteine peptidases. J. Biol. Chem. 288, 14287–14296 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES