Central nociceptin/orphanin FQ system elevates food consumption by both increasing energy intake and reducing aversive responsiveness

Abstract

Nociceptin/orphanin FQ (N/OFQ), the nociceptin opioid peptide (NOP) receptor ligand, increases feeding when injected centrally. Initial data suggest that N/OFQ blocks the development of a conditioned taste aversion (CTA). The current project further characterized the involvement of N/OFQ in the regulation of hunger vs. aversive responses in rats by employing behavioral, immunohistochemical, and real-time PCR methodology. We determined that the same low dose of the NOP antagonist [Nphe¹]N/OFQ(1-13)NH₂ delivered via the lateral ventricle diminishes both N/OFQ- and deprivation-induced feeding. This anorexigenic effect did not stem from aversive consequences, as the antagonist did not cause the development of a CTA. When [Nphe¹]N/OFQ(1-13)NH₂ was administered with LiCl, it moderately delayed extinction of the LiCl-induced CTA. Injection of LiCl + antagonist compared with LiCl alone generated an increase in c-Fos immunoreactivity in the central nucleus of the amygdala. The antagonist alone elevated Fos immunoreactivity in the paraventricular nucleus of the hypothalamus, nucleus of the solitary tract, and central nucleus of the amygdala. Hypothalamic NOP mRNA levels were decreased during energy intake restriction induced by aversion, as well as in non-CTA rats food-restricted to match CTA-reduced consumption. Brain stem NOP was upregulated only in aversion. Prepro-N/OFQ mRNA showed a trend toward upregulation in restricted rats (P = 0.068). We conclude that the N/OFQ system promotes feeding by affecting the need to replenish lacking calories and by reducing aversive responsiveness. It may belong to mechanisms that shift a balance between the drive to ingest energy and avoidance of potentially tainted food.

nociceptin/orphanin FQ (N/OFQ) is a 17-amino acid endogenous agonist of the opioid-like G protein-coupled receptor ORL1, currently referred to as the nociceptin opioid peptide (NOP) receptor (20, 32). N/OFQ and the NOP exhibit a high degree of structural homology to dynorphin and the κ-opioid receptor, respectively (3, 9). Regardless of this similarity, N/OFQ does not activate opioid receptors, nor does the NOP bind classical opioid receptor ligands (36). The N/OFQ system has been implicated in several physiological and behavioral functions, including regulation of water-electrolyte balance (16), pain perception (5), locomotion (10), sexual behavior (37), and memory and learning (35).

The high level of homology between N/OFQ and opioids prompted the following question: Does N/OFQ, similar to opioids (23), elicit hyperphagia? Pomonis et al. (29) reported that lateral ventricular (LV) administration of this peptide moderately increases chow intake; in subsequent studies, mild overeating was also observed following site-specific, but not peripheral, injections of N/OFQ (28, 38). Unlike classical opioids, N/OFQ primarily affects eating for energy, not for palatability (22, 28).

Aside from N/OFQ's involvement in the control of hunger responses, initial experiments implicated this peptide in another aspect of the regulation of consummatory behavior, taste aversion. A conditioned taste aversion (CTA) develops when exposure to solid or liquid ingestant of a characteristic flavor is followed by an unpleasant gastrointestinal sensation, most typically induced in laboratory settings by injection of a toxic agent, such as LiCl (12). As a result, the affected animals avoid a given tastant and reduce its intake, even if the flavor is perceived as palatable or the food provides essential calories. Olszewski et al. (25) showed that N/OFQ, administered via the LV, alleviates LiCl-induced CTA (25). They exposed animals to a palatable saccharin solution, and the peptide was infused 15 min before the LiCl injection. In the two-bottle test administered 2 days later, animals that had been treated with N/OFQ and LiCl consumed the same amount of saccharin as the rats that had not received the toxin (25). The mechanism underlying the link between the CTA and N/OFQ remains unclear. However, injection studies showed that centrally administered N/OFQ acts as the functional antagonist of corticotropin-releasing hormone (CRH) in CRH-driven hypophagia and stress (6, 8); CRH, depending on the behavioral and environmental context, promotes taste aversion (15). Additionally, N/OFQ suppresses LiCl-induced activity of the CTA mediating oxytocin (OT) neurons in the hypothalamic paraventricular nucleus (PVN) (25).

Ligands binding a receptor suspected to mitigate aversion serve as a useful tool in elucidating the role of this receptor in the food avoidance/aversion vs. energy-related (calories) aspect of consummatory behavior. NOP antagonists have not been used to further elucidate involvement of the NOP system in the regulation of aversion responses. In fact, very few studies have utilized NOP antagonists even to study the influence on feeding. The initial experiments employing the selective and competitive antagonist of the NOP receptor [Nphe¹]N/OFQ(1-13)NH₂ showed that NOP antagonism, via third ventricular injection of this compound, causes a decrease in N/OFQ- and deprivation-induced food intake (27). This hypophagic effect was profound, as, after 20 h of deprivation, ∼50% less chow was consumed by antagonist-treated rats than vehicle controls in hour 1 postinjection. Aversive properties of the compound were not tested in these initial experiments.

In the current project, the involvement of the N/OFQ system in the regulation of hunger vs. aversive responses was investigated. Aversive effects of the lowest hypophagic dose of the LV-injected NOP antagonist [Nphe¹]N/OFQ(1-13)NH₂ were studied by examination of the development of a CTA following the injection of the compound, as well as the extinction of the LiCl-induced CTA after coadministration of LiCl and [Nphe¹]N/OFQ(1-13)NH₂. We determined activity of feeding- and aversion-related brain circuitry in response to an injection of [Nphe¹]N/OFQ(1-13)NH₂ alone or in combination with LiCl by analyzing density of c-Fos-immunoreactive (IR) nuclei in specific central sites and by assessing the percentage of Fos-positive OT neurons in the PVN. Finally, we employed real-time PCR (rtPCR) to establish mRNA levels of the NOP and N/OFQ in the hypothalamus, brain stem, and amygdala of rats displaying a CTA along with a decrease in calorie consumption due to aversion vs. animals that did not display a CTA but whose energy intake was matched through pair-feeding.

MATERIALS AND METHODS

Animals

Adult male Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA) weighing ∼280 g at the beginning of the study were housed individually in wire-mesh cages in a temperature- (20–22°C) and humidity-controlled facility with 12:12-h light-dark cycle (lights on at 7 AM). Housing conditions (including ambient temperature, humidity, cage type, single housing, and light-dark cycle) were similar to those applied in previous studies of N/OFQ's involvement in feeding and CTA (25, 28, 29). Water and chow (Rodent Chow, Teklad, Indianapolis, IN) were available ad libitum unless indicated otherwise. The procedures, approved by the Minneapolis Veterans Affairs Medical Center Institutional Animal Care and Use Committee, are in compliance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals (NIH Publ. No. 80-23, revised 1996).

Surgeries

Rats requiring LV injections were stereotaxically equipped with a 21-gauge cannula (Plastics One, Roanoke, VA) positioned 1.5 mm lateral to the midline, 1.0 mm posterior to bregma, and 3.5 mm below the skull (26). Dental cement secured the cannula to two screws inserted in the skull. Ketamine (20 mg/kg im) and xylazine (10 mg/kg im) were used for anesthesia. Drugs were delivered via the injector protruding 0.5 mm below the cannula tip. Cannula placement was verified 7 days after the surgery and again 2 days following the completion of experiments by LV injections of 100 ng of angiotensin II (Sigma, St. Louis, MO): only data from rats that drank >5 ml water were included.

Central Injections

N/OFQ was purchased from Phoenix Pharmaceuticals (Belmont, CA). [Nphe¹]N/OFQ(1-13)NH₂ was synthesized at the Department of Experimental Medicine and Public Health, University of Camerino. Identification of the antagonist and confirmation of its antagonistic properties and its specificity at the NOP receptor have been previously described (4, 27). Injections were performed using Hamilton syringes (Hamilton, Reno, NV) in a volume of 5 μl, and the approximate infusion time was 10 s. Drugs were dissolved in saline.

Consumption: Effect of NOP Antagonism on Feeding and Aversion

Experiment 1: lowest effective dose of the NOP antagonist in deprivation-induced feeding.

Animals were food-deprived overnight. Chow was returned to the cages at 11 AM. At 5 min before refeeding, rats were injected, via the LV, with 0 (saline), 30, 100, and 300 nmol of [Nphe¹]N/OFQ(1-13)NH₂ (n = 6–7/group). Food intake was measured 1, 2, and 3 h postinjection and corrected for spillage. The timeline was chosen on the basis of the outcome of third ventricular injections of the antagonist showing that the anorexigenic effect did not extend beyond 4 h (27).

Experiment 2: lowest effective dose of the NOP antagonist in N/OFQ-induced feeding.

Ad libitum-fed rats were injected, via the LV, with 0 (saline), 30, or 100 nmol of [Nphe¹]N/OFQ(1-13)NH₂. After 5 min, N/OFQ (3 nmol) was administered via the LV [3 nmol N/OFQ produces maximum feeding response in a free-feeding paradigm (29)]. Rats double-injected with saline served as controls. All injections took place between 11:30 AM and 12:00 PM. Food intake was measured 1, 2, and 3 h postinjection.

Experiment 3: effect of NOP antagonism on CTA acquisition.

Rats had access to water for 30 min (from 12:30 PM to 1:00 PM) per day, for 4 days. On day 5, rats were given novel 0.1% saccharin, instead of water. After 30 min of drinking, they were injected via the LV with saline or 100 nmol of [Nphe¹]N/OFQ(1-13)NH₂ (the lowest anorexigenic dose in experiments 1 and 2). Animals injected intraperitoneally with LiCl (isotonic, 3 meq/kg body wt) served as positive controls for a CTA (40). For the next 2 days, rats were presented only with water. On day 8, a two-bottle test was used to assess acquisition of a CTA to saccharin. Control groups that underwent unconditioned stimulation (treatment not paired with saccharin presentation) were included. Each group comprised six animals. The amount of ingested saccharin solution was expressed in milliliters and as a percentage of total fluid intake.

Experiment 4: effect of [Nphe¹]N/OFQ(1-13)NH₂ on extinction of LiCl-induced CTA.

CTA was induced as described in experiment 3; however, after 30 min of drinking saccharin, rats were injected via the LV with saline (n = 14) or 100 nmol of [Nphe¹]N/OFQ(1-13)NH₂ (n = 12). After 5 min, seven animals that had received saline and six that were treated with [Nphe¹]N/OFQ(1-13)NH₂ via the LV were injected intraperitoneally with LiCl (see above); the remaining rats received intraperitoneal saline. During the next 2 days, rats were presented only with water. On day 8, animals were given constant access to both water and saccharin. Intakes were measured every 24 h for 20 days to establish extinction of the LiCl-induced CTA. The amounts of ingested saccharin solution (expressed as a percentage of total fluid intake) were averaged over four 5-day periods: 1) days 1–5, 2) days 6–10, 3) days 11–15, and 4) days 16–20. Saccharin solution intakes of groups treated with LiCl alone or [Nphe¹]N/OFQ(1-13)NH₂ and LiCl were compared directly with saccharin solution intake of controls double-injected with saline.

Statistics.

In feeding experiments, comparisons were performed using one-way ANOVA followed by Fisher's post hoc test. In experiment 2, the stimulatory effect of N/OFQ on food intake was confirmed by comparison of data from the N/OFQ group with data from the saline group by a t-test; then data from groups treated with the N/OFQ-antagonist combination were compared with the N/OFQ-only group by one-way ANOVA followed by Fisher's test. For the analysis of CTA extinction, Dunnett's test was applied. P < 0.05 was considered significant.

Immunohistochemistry: Effect of the NOP Antagonist Alone or in Combination With LiCl on Neuronal Activity in Sites Involved in Feeding and Aversion

Perfusions.

Animals were anesthetized with pentobarbital sodium (Nembutal, 100 mg/kg body wt ip) and perfused through the aorta with 75 ml of saline followed by 500 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Brains were removed and postfixed overnight in the same fixative at 4°C. The perfusion schedule was based on data suggesting that maximum c-Fos IR can be observed ∼60–90 min after the onset of neuronal activation (41).

Sectioning and immunohistochemical staining.

A Vibratome was used to cut 40-μm-thick coronal sections through the paraventricular nucleus of the hypothalamus (PVN), central nucleus of the amygdala (CNA), nucleus of the solitary tract (NTS), and area postrema (AP); these sections were processed as free-floating sections for single (c-Fos) or double (c-Fos and OT; pertains only to PVN sections) immunohistochemical staining.

Sections were treated for 10 min in 3% H₂O₂ in 10% methanol [in Tris-buffered saline (TBS), pH 7.4] and incubated for 48 h at 4°C in goat anti-Fos antibody (1:1,000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA). Subsequently, sections were incubated for 1 h in rabbit anti-goat antibody (Vector Laboratories, Burlingame, CA). After 1 h of incubation in avidin-biotin complex (Vector Laboratories), peroxidase was visualized with 0.05% diaminobenzidine, 0.01 H₂O₂, and 0.3% nickel sulfate. The vehicle for incubations was 0.25% gelatin-0.5% Triton X-100 in TBS. Intermediate rinsing was done in TBS. PVN sections were further processed for visualization of OT. The procedure was similar to that described for Fos staining; however, rabbit anti-OT (1:15,000 dilution; Millipore, Temecula, CA) and goat anti-rabbit antibodies were used. Nickel sulfate was not added to diaminobenzidine to obtain brown staining. Sections were mounted on gelatin-coated slides, dehydrated in alcohols, soaked in xylene, and embedded in DPX (Fluka).

Staining analysis.

SINGLE C-FOS STAINING.

The number of Fos-positive nuclei was counted bilaterally for each region [boundaries of the PVN, CNA, NTS, and AP defined according to the atlas of Paxinos and Watson (26)] on six sections per animal. Images provided by the camera attached to the Nikon Eclipse 400 microscope were analyzed using Scion Image. Densities of Fos-IR nuclei (per 1 mm²) were averaged.

DOUBLE STAINING FOR C-FOS AND OT.

In six PVN sections with neurons expressing OT per animal, the total number of OT neurons and the total number of Fos-IR nuclei colocalizing with OT were assessed. The percentage of Fos-positive OT cells was calculated for the PVN.

STATISTICS.

Single c-Fos staining results are presented as the number of Fos-positive nuclei per 1 mm² per section of a given region, whereas double-staining data are shown as the percentage of Fos-positive OT neurons. Comparisons were performed using one-way ANOVA followed by Fisher's post hoc test.

Gene Expression: N/OFQ and NOP mRNA in Aversion vs. Hunger

Twenty-four rats (282 ± 10 g body wt) were schedule-fed: standard chow (R36, Lactamin) was available from 9 AM to 11 AM. Consumption was monitored daily and body weight every other day. After 3 days of scheduled feeding, one intraperitoneal saline injection was administered daily for 3 days to allow animals to acclimatize to drug administration.

On day 7, animals received a novel R6-38 (Lantmannen) diet, instead of regular food. After the novel food exposure, they were injected with saline or 3 meq of LiCl. This protocol was repeated on days 9 and 11 to ensure CTA acquisition. Indeed, CTA developed, and the affected animals reduced intake of the novel diet (1.95 ± 0.5 vs. 12.8 ± 1.3 g in the LiCl- and saline-treated rats, respectively). On intermediate days, standard chow was offered to prevent rapid body weight loss in CTA rats. The novelty of the R6-38 diet is based on 1) its high, 40% concentration of fat vs. ∼9% in the regular chow and 2) the carbohydrate content being a combination of sucrose, maltodextrin, and starch vs. the grain-derived complex carbohydrates in the standard diet.

To distinguish the effect of aversion from that of food restriction accompanying the CTA, gene expression levels were studied in animals randomized into three groups: 1) schedule-fed controls, which were injected with saline immediately after consuming the novel diet, 2) CTA rats, which were schedule-fed and treated with LiCl after consuming the novel diet to induce CTA, and 3) schedule-fed rats pair-fed to the CTA group, which received only saline injections.

On day 13, groups were presented with the novel R6-38 diet, and no injections were given. After 90 min, the animals were decapitated. The hypothalamus, amygdala, and brain stem were dissected according to the boundaries defined in the standard brain atlas of Paxinos and Watson (26), immersed in RNAlater solution (Ambion), kept at room temperature for ∼3 h to allow the solution to infiltrate the tissue, and then stored at −80°C.

RNA extraction and cDNA synthesis.

RNA was extracted from the tissue, and cDNA was synthesized as described elsewhere (18). Briefly, samples were homogenized in TRIzol reagent (Invitrogen). RNA was extracted using chloroform, and isopropanol was used to precipitate the RNA. Samples were centrifuged, and the pellet was washed, air-dried, and dissolved in 1× DNase buffer. Samples were incubated at 37°C for 1.5 h with RNase-free DNase I (Roche). Absence of genomic DNA was confirmed by PCR. Total RNA concentration was measured with a spectrophotometer (model ND-1000, Nanodrop). For cDNA synthesis, 5-μg RNA samples were diluted with MilliQ water to 12 μl. RNA was reverse-transcribed in a final volume of 20 μl containing 1× Master Mix and 1 μl of murine leukemia virus reverse transcriptase. After 1 h of incubation at 37°C, samples were subjected to PCR for confirmation of cDNA synthesis.

rtPCR.

A total of 25 ng of a cDNA template from each sample was used per primer. Each rtPCR, with a total volume of 20 μl, contained 2 μl of 10× MgCl₂-free buffer, 0.2 μl of 20 mM dNTP, 1.6 μl of 50 mM MgCl₂, 0.05 μl of each primer (forward and reverse) at 100 pmol/μl, 1 μl of DMSO, 0.5 μl of Sybr Green (1:50,000 dilution), 0.08 μl of Taq polymerase (5 U/μl), and 9.52 μl of MilliQ water. rtPCRs were performed in duplicates, and negative controls were included on each plate. Amplification was performed as follows: denaturation at 95°C for 3 min, 50 cycles of denaturation at 95°C for 15 s, annealing for 15 s, and extension at 72°C for 30 s. Seven housekeeping genes were analyzed (Table 1). A MyiQ thermal cycler (Bio-Rad) was used.

Table 1.

Real-time PCR primers

Primer	Forward	Reverse	Temperature, °C
H3	attcgcaagctcccctttcag	Tggaagcgcaggtctgttttg	60
bACT	cactgccgcatcctcttcct	Aaccgctcattgccgatagtg	60
bTUB	cggaaggaggcggagagc	Agggtgcccatgccagagc	60
RPL19	tcgccaatgccaactctcgtc	Agcccgggaatggacagtcac	60
SDCA	gggagtgccgtggtgtcattg	Ttcgcccatagcccccagtag	60
CYCLO	gagcgttttgggtccaggaat	Aatgcccgcaagtcaaagaaa	60
GAPDH	acatgccgcctggagaaacct	Gcccaggatgccctttagtgg	60
N/OFQ	aagcggttcagtgagtttatg	Cacctggatgctcatggg	62
NOP	gagaccgtaccccaccacctg	Ccccgatgcacacagccaag	61.3

All primers were supplied by Thermo Scientific. N/OFQ, nociceptin/orphanin FQ.

Data analysis and relative expression calculation.

Analysis was performed as previously reported using MyiQ version 1.04 (Bio-Rad) (19). Primer efficiencies were calculated with LinRegPCR (31), and samples were corrected for differences in efficiencies. The GeNorm protocol (39) was used to calculate normalization factors based on housekeeping gene expression. Grubb's test was used to identify outliers. Differences in gene expression between groups were analyzed using ANOVA followed by Fisher's protected least significant difference test. Values were considered different when P < 0.05.

RESULTS

Administration of 100 and 300 nmol of [Nphe¹]N/OFQ(1-13)NH₂, via the LV, resulted in a ∼50% decrease in deprivation-induced food intake during hour 1 postinjection (P = 0.014 and P = 0.009, respectively). No difference in food intake was detected during hour 2 or 3 between the groups (Fig. 1).

Fig. 1.

Effect of the nociceptin opioid peptide (NOP) antagonist [Nphe¹]N/OFQ(1-13)NH₂ (Nphe) on food intake induced by overnight deprivation and on nociceptin/orphanin FQ (N/OFQ)-induced feeding. Drugs were dissolved in saline. Food consumption was measured 1, 2, and 3 h postinjection. Top: effect of [Nphe¹]N/OFQ(1-13)NH₂ on food intake induced by overnight deprivation. *Significant difference from saline control group (P < 0.05). Bottom: effect of [Nphe¹]N/OFQ(1-13)NH₂ on N/OFQ-induced feeding. δSignificantly different from saline/saline controls (P < 0.05). *Significantly different from N/OFQ group (P < 0.05).

Animals injected with 3 nmol of N/OFQ, via the LV, ate significantly more chow than saline-injected rats during hour 1 postinjection (P = 0.007). [Nphe¹]N/OFQ(1-13)NH₂ at 100 nmol decreased N/OFQ-induced food intake during hour 1 postinjection (P = 0.033). [Nphe¹]N/OFQ(1-13)NH₂ at 30 nmol had no effect on N/OFQ-induced food consumption (Fig. 1).

Administration of 100 nmol of [Nphe¹]N/OFQ(1-13)NH₂ following ingestion of 0.1% saccharin by rats did not affect their later preference for the saccharin solution compared with controls. Total fluid intake in a two-bottle test did not differ between groups (Table 2). Unconditioned stimulation did not produce taste aversion (data not shown).

Table 2.

Effect of [Nphe¹]N/OFQ(1-13)NH₂ on development of CTA

	Saccharin Intake
Treatment	ml	% of Total Fluid Intake	Total Fluid Intake, ml
Saline	18.6 ± 2.5	76.5 ± 10.3	24.3 ± 4.0
[Nphe1]N/OFQ(1-13)NH2	13.8 ± 3.0	62.8 ± 13.6	21.9 ± 3.7

Values are means ± SE. [Nphe¹]N/OFQ(1-13)NH₂ was administered incerebroventricularly at 100 nmol. CTA, conditioned taste aversion.

Intraperitoneally injected LiCl had a profound effect on acquisition of taste aversion. Similar to the experiment described above, [Nphe¹]N/OFQ(1-13)NH₂ alone, administered via the LV, did not induce a CTA (Table 3). Pretreatment with the NOP receptor antagonist did not affect the magnitude of the aversive response in LiCl-injected rats, as shown in a 30-min and a 24-h two-bottle test. However, extinction of LiCl-induced CTA in animals that had been injected with [Nphe¹]N/OFQ(1-13)NH₂ prior to intraperitoneal injection of LiCl was delayed. The delay in extinction of a CTA is significant compared with saline-injected, but not LiCl-injected, controls (Fig. 2).

Table 3.

Effect of [Nphe¹]N/OFQ(1-13)NH₂ on magnitude of aversive response to LiCl in 30-min and 24-h CTA test

	Saccharin Intake, % of total fluid intake
Treatment	30 min	24 h
Saline	75.4 ± 12.8*	79.5 ± 13.2*
[Nphe1]N/OFQ(1-13)NH2 (100 nmol)	66.1.8 ± 3.0*	70.2 ± 16.4*
LiCl (3 meq)	12.9 ± 2.8†	15.8 ± 4.1†
[Nphe1]N/OFQ(1-13)NH2 (100 nmol) + LiCl (3 meq)	14.0 ± 4.2†	16.1 ± 3.7†

Values are means ± SE. Symbols (*,†) in a column that differ from each other indicate significant differences (P < 0.05).

Fig. 2.

Effect of [Nphe¹]N/OFQ(1-13)NH₂ on extinction of the LiCl-induced conditioned taste aversion (CTA). *Significantly different from saline (sal) controls (P < 0.05). x-Axis refers to days of measurement in the 2-bottle preference test.

Immunohistochemical studies revealed that injection of the NOP antagonist, via the LV, induced c-Fos IR in the PVN, CNA, and NTS but had no effect on the activity of AP neurons, whereas in animals treated with LiCl, higher levels of Fos IR were detected in all four of these neuroanatomical areas. [Nphe¹]N/OFQ(1-13)NH₂ augmented the stimulatory effect of LiCl on c-Fos IR in the CNA (Fig. 3). While LiCl caused a profound increase in the percentage of c-Fos-positive OT neurons in the PVN, activity of these cells was not affected by [Nphe¹]N/OFQ(1-13)NH₂ alone, nor did the NOP antagonist enhance the level of OT neuronal activity upon coadministration with LiCl (Fig. 4).

Fig. 3.

Top: effect of [Nphe¹]N/OFQ(1-13)NH₂ and LiCl on c-Fos immunoreactivity (IR) in central sites involved in feeding and aversion. ^a,b,cDifferent letters indicate significant differences between groups (P < 0.05). Bottom: photomicrographs depicting coronal sections encompassing areas of interest stained for c-Fos in animals treated with saline or LiCl. AP, area postrema; NTS, nucleus of the solitary tract; PVN, paraventricular nucleus of the hypothalamus; CNA, central nucleus of the amygdala. Scale bars, 0.3 mm (PVN, NTS, and CNA) and 0.2 mm (AP).

Fig. 4.

Effect of [Nphe¹]N/OFQ(1-13)NH₂ and LiCl on percentage of Fos-positive oxytocin (OT) neurons in the PVN (C). Photomicrographs depict representative PVN sections immunostained for c-Fos and OT in animals treated with saline (A) and LiCl (B). Open arrows, OT cells devoid of Fos; thin arrows, Fos-positive OT neurons. Scale bars, 0.2 mm (A and B) and 0.01 mm (C). D: effect of [Nphe¹]N/OFQ(1-13)NH₂ and LiCl on c-Fos-positive OT cells. *Significantly different from saline/saline controls (P < 0.05).

NOP mRNA levels in the hypothalamus were sensitive to energy restriction, regardless of the nature of the reduction in energy intake. In animals eating less food due to CTA or those that were pair-fed, NOP expression was significantly reduced in the group displaying aversion; in the pair-fed non-CTA rats, a strong trend was detected (P = 0.057). NOP expression was significantly upregulated in the brain stem of CTA animals, but not in other groups (Fig. 5). No changes were detected in the amygdala. rtPCR analysis of N/OFQ mRNA levels showed a strong trend toward upregulation (P = 0.068) in non-CTA food-restricted (pair-fed) rats (Fig. 6).

Fig. 5.

Expression of the NOP receptor gene in hypothalamus (HT), brain stem (BS), and amygdala (Amy) of rats displaying the CTA toward the presented diet (aversion), nonaversive animals pair-fed to the CTA rats (restriction), and unrestricted non-CTA controls (control). Animals had access to food during a predefined scheduled 2-h period. *P < 0.05.

Fig. 6.

Expression of the prepro-N/OFQ gene in hypothalamus, brain stem, and amygdala of rats displaying the CTA toward the presented diet, nonaversive animals pair-fed to the CTA rats, and unrestricted non-CTA controls. Animals had access to food during a predefined scheduled 2-h period.

DISCUSSION

Results gathered from experiments pertaining to the involvement of N/OFQ and its receptor in consummatory behavior have consistently shown that central N/OFQ promotes moderate overeating (for review see Refs. 24 and 30). The present report confirms the hyperphagic role of N/OFQ and expands the current view of the function of the N/OFQ system in consumption control by linking it not only with food intake, but also with aversive responsiveness.

Involvement of N/OFQ in the regulation of feeding has been shown beyond reasonable doubt in injection studies. Generalized intraventricular and site-specific injections of NOP agonists stimulate chow intake in free-feeding rodents (28, 29, 38). As N/OFQ and its receptor resemble their opioid counterparts, it was initially hypothesized that they participate in the reward processes as well. Indeed, some studies showed sensitivity of NOP ligand-induced feeding to the opioid receptor antagonist naloxone (21, 29). However, it was later reported that, unlike opioids (14, 42), LV N/OFQ does not increase intake of preferred diets, nor does it increase intake of a palatable sucrose solution (22, 28). These findings were corroborated by the analysis of the feeding profile of the NOP knockout mice: although the lack of the NOP modified their diet preference, this effect was independent from reward (17). As a result, the interpretation of data on the blockade of N/OFQ-driven feeding by naloxone was changed, and the effect was attributed to the interplay between hunger and palatability, as the transient need for calories alters the perceived rewarding value of ingested food (44). Then the hypothesis was put forth that N/OFQ may be involved in food consumption the main goal of which is acquisition of calories.

Our data strongly support the notion that the central N/OFQ system regulates food intake. In hour 1 postinjection, the NOP antagonist reduced consumption of the standard laboratory chow by ∼40–50% in hungry animals that were stimulated to eat by overnight deprivation. The lowest effective dose of [Nphe¹]N/OFQ(1-13)NH₂ capable of reducing a consummatory response in food-restricted rats was found to be 100 nmol, which was lower than the dose established in the previous report utilizing third ventricular infusions (27). This was also the lowest dose of [Nphe¹]N/OFQ(1-13)NH₂ necessary to inhibit N/OFQ-stimulated feeding, which strengthens the argument that the hypophagic effect in the deprivation model was not the side effect of an excessive amount of the antagonist.

When an anorexigenic response to a compound is observed, a crucial question arises: Does this compound affect actual hunger/satiety mechanisms, or was hypophagia induced indirectly, most notably through sickness or malaise? In the current project, we found that although the NOP antagonist powerfully reduced a feeding response in the state of energy depletion, it did not support development of the CTA. It indicates that the antagonist of the NOP receptor works via circuitry that controls food intake, and this effect is independent from sickness that would be reflected by an aversive state.

Furthermore, rtPCR analysis revealed that a decrease in calorie consumption affects expression of both prepro-N/OFQ and its receptor. This expression sensitivity to energy depletion persists in some components of the central circuitry, regardless of the reason behind the reduced consumption. In rats consuming less food due to the CTA, as well as food-restricted animals, mRNA levels of the NOP in the hypothalamus were reduced, whereas prepro-N/OFQ expression was upregulated in the hypothalamus of food-restricted animals displaying no aversion. The hypothalamic NOP mRNA results follow a trend similar to the downregulation reported by Rodi et al. (33) for the PVN and lateral hypothalamus of food-deprived rats. It suggests that the N/OFQ tone at hypothalamic neurons encoding the NOP is higher when calories need to be replenished; therefore, receptor mRNA levels change in the opposite direction (although the source of N/OFQ acting at the hypothalamic NOP is unknown, and it can be intra- and/or extrahypothalamic). The current set of data seems particularly interesting, as it shows that even a less dramatic reduction in the amount of consumed food (i.e., decrease to 15–20% of the control amount) than that observed in a complete overnight deprivation model (when animals had no chow during the phase of most vigorous consummatory activity) produces a change in the NOP expression. Hence, the N/OFQ system appears to respond to relatively subtle alterations in food intake. Future studies should encompass analysis of N/OFQ protein levels in the brain as well to verify whether changes at the gene expression level are paralleled by the actual peptide expression. These analyses should not be limited, however, to regions studied here but, because of the complexity of N/OFQ circuitry, should include other areas that receive N/OFQ innervation, as protein level changes may occur in regions distant from regions where N/OFQ mRNA is present.

Although Rodi et al. (33) also reported downregulation of the NOP in the amygdala during food deprivation, we did not see such a relationship in our model. Unlike Rodi et al., who used only the CNA in their analysis, we dissected out the entire amygdala region, and the CNA is only a small part of it.

Regulation of food intake by N/OFQ is also supported by earlier studies that showed functional “interaction” between N/OFQ and central feeding-related peptides. Bewick et al. (1) showed that incubation of hypothalamic explants with N/OFQ stimulates release of orexigenic agouti-related protein and diminishes the release of satiety-inducing cocaine- and amphetamine-regulated transcript. Meal termination-associated activity of neurons expressing α-melanocyte-stimulating hormone can be decreased by LV administration of N/OFQ (2). Finally, injection studies showed that intracranial N/OFQ acts as a functional antagonist of CRH (6, 7).

Aside from the regulation of ingestion of a sufficient number of calories with food, the N/OFQ system appears to be involved in another mechanism controlling consummatory behavior, namely, aversive responsiveness. This is a crucial component of the consumption process, as it provides a proper balance between the need to acquire essential energy and the need to avoid foods that can potentially jeopardize homeostasis, e.g., due to the presence of toxins or high concentration of salt. In the current project, we found that while [Nphe¹]N/OFQ(1-13)NH₂ did not induce a CTA by itself or did not enhance the initial aversive response in LiCl-treated rats, it caused a moderate delay in extinction of the CTA generated by LiCl. These results are corroborated by our previous findings regarding N/OFQ's ability to decrease LiCl-driven taste aversion (25).

In search of mechanisms responsible for the delay of CTA extinction, we hypothesized that the AP-NTS-PVN pathway may be involved. Our previous report showed that the antiaversive action of N/OFQ is associated with a decreased activity of the brain stem-hypothalamus pathway, including a diminished activation of PVN OT neurons (25). However, in the present experiment, [Nphe¹]N/OFQ(1-13)NH₂ administered alone did not affect the percentage of Fos-IR OT neurons in the PVN, nor did it further elevate the percentage of OT neurons upon coadministration with LiCl. Although the level of OT neuronal activation in the LiCl-treated group was higher in the current study than in the aforementioned one, it paralleled a higher baseline observed in controls here that displayed ∼20% more Fos-positive OT cells. While antagonism of the NOP receptor led to a higher level of neuronal activity in the PVN and NTS, the LiCl-generated Fos IR was not further enhanced by [Nphe¹]N/OFQ(1-13)NH₂. These results suggest that [Nphe¹]N/OFQ(1-13)NH₂ may affect feeding through the brain stem-hypothalamus pathway; however, the immediate neuronal response to the mild antiextinction action of the NOP antagonist takes place elsewhere. In fact, the analysis of c-Fos IR in the CNA revealed that the density of Fos-positive nuclear profiles increases following the LiCl-only injection, but the magnitude of this increase is greater when the blockade of the NOP occurs. This is in concert with previous studies showing that LiCl elevates c-Fos IR in the CNA (43), and the c-Fos response depends on the strength of the aversive stimulus (11). Additionally, the level of c-Fos IR in the amygdala is memory-dependent following the induction of a CTA (43). It should be emphasized that activation of the NOP impairs both learning and memory, also via the amygdala circuits (13, 34); hence, antagonism of this receptor may enhance CTA extinction and CTA-associated c-Fos expression in the CNA. Further experiments are needed to characterize the peptidergic content of the affected cells, as well as confirm changes in neuronal activation with methods other than assessment of immediate-early gene expression.

The rtPCR experiment revealed that the NOP mRNA levels are lower in the hypothalamus and brain stem of CTA-displaying rats. This finding suggests that the NOP-expressing neurons are part of the classical brain stem-hypothalamus pathway involved in the development and maintenance of aversive responses. However, only the brain stem neurons show a change in NOP expression specific to the CTA, but not to food restriction: a similar decrease in hypothalamic NOP mRNA was detected in aversive, as well as restricted, non-CTA rats. Although one cannot exclude the possibility that the hypothalamic NOP mRNA-expressing cells participate in food (thus, energy) intake control and aversive mechanisms [this functional overlap has been shown in regard to, e.g., OT and CRH neurons (15, 23, 25)], the brain stem NOP-synthesizing neurons should be considered particularly important in shaping aversive responses.

In summary, we show that the N/OFQ system stimulates consummatory behavior via a dual mechanism: it enhances energy intake and reduces aversive responsiveness. Presumably, N/OFQ shifts the balance between the need to ingest energy and the need to avoid foods that can rapidly threaten homeostasis through toxicity or osmolality.

Perspectives and Significance

The involvement of N/OFQ and its receptor in the regulation of aversion and calorie intake offers an interesting insight into the central mechanisms that mitigate food avoidance, possibly, to enable the animal to eradicate accidental negative associations with various diets or flavors and to attempt to ingest a wider array of tastants available in the environment. The unique combination of these qualities allows the N/OFQ system to be considered as a potential target in the pharmacological modification of emesis as well as avoidance of foods that leads to an overall decrease in energy intake, such as in anorexia nervosa.

GRANTS

This research was supported by National Institute of Drug Abuse Grant R01 DA-021280, the National Institute of Diabetes and Digestive and Kidney Diseases Grant P30 DK-50456, the Swedish Research Council (VR), the Swedish Brain Research Foundation, Svenska Lakaresallskapet, the Ahlens Foundation, and the Novo Nordisk Foundation.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.