Alterations of calcium channels and cell excitability in intracardiac ganglion neurons from type 2 diabetic rats

Abstract

Clinical study has demonstrated that patients with type 2 diabetes with attenuated arterial baroreflex have higher mortality rate compared with those without arterial baroreflex dysfunction. As a final pathway for the neural control of the cardiac function, functional changes of intracardiac ganglion (ICG) neurons might be involved in the attenuated arterial baroreflex in the type 2 diabetes mellitus (T2DM). Therefore, we measured the ICG neuron excitability and Ca²⁺ channels in the sham and T2DM rats. T2DM was induced by a combination of both high-fat diet and low-dose streptozotocin (STZ, 30 mg/kg ip) injection. After 12–14 wk of the above treatment, the T2DM rats presented hyperglycemia, hyperlipidemia, and insulin resistance but no hyperinsulinemia, which closely mimicked the clinical features of the patients with T2DM. Data from immunofluorescence staining showed that L, N, P/Q, and R types of Ca²⁺ channels were expressed in the ICG neurons, but only protein expression of N-type Ca²⁺ channels was decreased in the ICG neurons from T2DM rats. Using whole cell patch-clamp technique, we found that T2DM significantly reduced the Ca²⁺ currents and cell excitability in the ICG neurons. ω-Conotoxin GVIA (a specific N-type Ca²⁺ channel blocker, 1 μM) lowered the Ca²⁺ currents and cell excitability toward the same level in sham and T2DM rats. These results indicate that the decreased N-type Ca²⁺ channels contribute to the suppressed ICG neuron excitability in T2DM rats. From this study, we think high-fat diet/STZ injection-induced T2DM might be an appropriate animal model to test the cellular and molecular mechanisms of cardiovascular autonomic dysfunction.

diabetes mellitus, especially type 2 diabetes mellitus (T2DM), is a major health problem worldwide. According to data from the 2011 National Diabetes Fact Sheet, 25.8 million people in the United States (8.3% of the population) have diabetes and 1.9 million new cases of diabetes were diagnosed in 2010. Additionally, diabetes has become a leading cause of mortality (17, 18, 22, 31, 33); for example, in 2007, diabetes contributed to a total of 231,404 deaths in the United States. Cardiovascular autonomic dysfunction, such as the decreases of both heart rate variability and arterial baroreflex sensitivity, is a common complication of the patients with T2DM (7, 8, 15, 30, 40, 45, 46), which are generally associated with a high mortality of the diabetic patients (8, 40).

The arterial baroreflex is a homeostatic mechanism involved in the regulation of heart rate and blood pressure in response to the changes of arterial wall tension. The arterial baroreflex arc includes an afferent limb (baroreceptor neurons), a central neural component, and autonomic efferent component (such as intracardiac ganglia, ICG). The structural and functional alterations in every site of the arterial baroreflex arc are responsible for the T2DM-induced impairment of the arterial baroreflex sensitivity. Some previous studies have shown that parasympathetic cardiac neurons in the nucleus ambiguus in the brainstem extensively project to the ICG (1, 9, 10). More importantly, the arterial baroreflex control of the heart rate is almost totally abrogated when domoic acid lesion of the nucleus ambiguus stops the above projection to the ICG (11). The parasympathetic postganglionic neurons of the ICG are traditionally thought of as a simple relay station for transferring the signals from vagal preganglionic neurons in the brainstem. However, much evidence indicates that the ICG neurons may form a functional local circuit to integrate the various received signals for the arterial baroreflex control of the cardiac function (4). Therefore, investigating T2DM-induced cellular and molecular changes of the ICG neurons can provide the important information to understand the mechanisms concerned with the attenuated arterial baroreflex sensitivity in T2DM states.

In general, as a final common pathway for the neural control of the cardiac function, the ICG neurons can produce the electrical impulses (action potentials) to modulate the release of acetylcholine (a primary neurotransmitter involved in the vagal innervation of the heart) after receiving electrical and chemical inputs (55). Voltage-gated Ca²⁺ channels have been found to exist in the ICG neurons and to contribute to the rising phase of the action potentials (12, 19, 53, 54). In the present study, we compared the cell excitability and the protein expression and electrophysiological properties of the Ca²⁺ channels in the ICG neurons between sham and T2DM rats. We also measured whether T2DM decreased the ICG neuron excitability through altering the mRNA and protein expressions of the Ca²⁺ channels.

MATERIALS AND METHODS

Male Sprague-Dawley rats (200–220 g) were housed two per cage under controlled temperature and humidity and a 12-h:12-h dark/light cycle. Water and rat chow were provided ad libitum. Experiments were approved by the University of Nebraska Medical Center Institutional Animal Care and Use Committee and were carried out in accordance with the National Institutes of Health (NIH Publication No. 85–23, revised 1996) and the American Physiological Society's Guides for the Care and Use of Laboratory Animals.

Induction of T2DM.

Rats were randomly assigned to sham (n = 40) and T2DM rats (n = 37). In sham group, rats were fed a normal chow diet consisting of 13% fat, 53% carbohydrate, and 34% protein (Harlan Teklad sterilizable rodent diet; Harlan Teklad, Madison, WI). T2DM was induced by a combination of high-fat diet and streptozotocin (STZ) treatment (35, 43). In the T2DM group, rats were first fed a high-fat diet consisting of 42% fat, 42.7% carbohydrate, and 15.2% protein (Harlan Teklad adjusted fat diet, Harlan Teklad) for 4 wk. Then rats were intraperitoneally injected with STZ (30 mg/kg) and continued on the high-fat diet. Fasting blood glucose (TureTrack; Nipro Diagnostics, Fort Lauderdale, FL) and body weight in all rats were measured weekly. All experiments were taken at 12–14 wk after feeding either normal chow diet or high-fat diet. On the day of the terminal experiment, fasting blood glucose, plasma insulin, triglyceride, leptin, insulin sensitivity, and blood glucose tolerance were measured to identify T2DM. Additionally, blood pressure, heart rate, retroperitoneal fat pad, epididymal fat pad, and interscapular brown adipose tissue were also measured.

Measurement of plasma insulin, leptin, and triglyceride.

Blood samples for insulin, leptin, and triglyceride analyses were collected in tubes coated with EDTA and stored at −80°C until assayed. Plasma insulin and leptin levels were assessed using ELISA kits (ALPCO, Salem, NH), according to the manufacturer's instructions. Plasma triglyceride was measured by triglyceride spectrophotometric assay kit (BioVision, Mountain View, CA).

Measurement of insulin sensitivity.

Both blood glucose and insulin of the same rat were measured, and its insulin sensitivity index was calculated as Ln (fasting blood glucose × fasting plasma insulin level)⁻¹.

Measurement of blood glucose tolerance.

After an overnight fasting (12–16 h), the rats were intraperitoneally injected with 40% glucose (2g/kg body wt). Blood samples were collected from the tail vein at 0, 30, 60, 90, 120 min after glucose load for measurement of blood glucose.

Single-cell real-time RT-PCR for calcium channel mRNA.

Single-cell real-time RT-PCR was performed as described previously (26). Briefly, Sinoatrial ganglion neurons were isolated (see below) and loaded in a chamber with regular extracellular solution (in mM): 137 NaCl, 5.4 KCl, 1 MgCl₂, 2 CaCl₂, 10 HEPES, 10 glucose with pH 7.4. A patch-clamp pipette (1–3 MΩ resistance) was used to break the membrane of single neuronal cell. Under the suction condition, the content of the cell and pipette was moved in and expelled into a 0.2-ml PCR tube containing mRNA preserving reagents and then mixed with RT reaction buffer. RT was performed at 42°C for 30 min, and the cDNA was then stored at −80°C. The primers (Table 1) were based on the cDNA sequences of RPL19 (housekeeping gene) and Ca²⁺ channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3). PCR reaction was performed in a 50-μl volume containing 25 μl iQ Cyber Green Supermix (Bio-Rad, Hercules, CA), 40 nM (in the first round) or 300 nM (in the second round) of each primer. The cDNA was amplified by real-time quantitative PCR with the Bio-Rad iCycler iQ System. For quantification, Ca²⁺ channel genes were normalized to the expressed housekeeping gene RPL19. The data were analyzed by the 2^−ΔΔCt method.

Table 1.

Primer sequences

Gene Accession No.	Primer Name	Primer Sequence (5′-3′)
NM012517	Cav1.2-forward	GGCAATGCGACCATCTCTACC
	Cav1.2-backward	CCCCTGCTTCTTGGGTTTCC
	Cav1.2-internal	ACTGCTGCCGCTTCCGCTGTGT
NM017298	Cav1.3-forward	TGTTCGTGGATGATGATGATGATG
	Cav1.3-backward	CTGGTGCCTCTTGCATAGTTTG
	Cav1.3-internal	CGTGGTCCTCTTGCTGCTGCCGTT
NM012918	Cav2.1-forward	GGGAATAACTTCATCAACCTGAGC
	Cav2.1-backward	ATCAGCAGACAGACATAAGGTAGG
	Cav2.1-internal	TTCTCCGCCTCTTCCGTGCTGCC
NM147141	Cav2.2-forward	TCCTAGCCAGGTGTCCCATC
	Cav2.2-backward	CTTTTCCAGGGACCTCTGCTTC
	Cav2.2-internal	CCACCACCACCGCTGCCACCG
NM019294	Cav2.3-forward	GAGCGGAGTCTGGATGAAGG
	Cav2.3-backward	TCCTGAGTTCTCTCTTCTTCATGG
	Cav2.3-internal	TGGCTCCTTGCTCCTGTGGCTGCT
NM031103	RPL19-forward	CCCCAATGAAACCAACGAAA
	RPL19-backward	ATGGACAGTCACAGGCTTC
	RPL19-internal	TGCGAGCCTCAGCCTGGTCAGCC

Immunofluorescence staining for calcium channels.

Sinoatrial ganglion of the ICG in each rat was rapidly removed and postfixed in 4% paraformaldehyde in 0.1 M PBS for 12 h at 4°C, followed by soaking the ICG in 30% sucrose for 12 h at 4°C for cryostat protection. The ICG was cut into 10-μm-thick sections and then mounted on precoated glass slides. The ICG sections were incubated with 10% goat serum for 1 h followed by incubation with rabbit antibodies against calcium channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, or Ca_v2.3; Alomone Laboratories, Jerusalem, Israel) and mouse anti-PGP9.5 antibody (a neuronal maker; Abcam, Cambridge, MA) overnight at 4°C. The sections were then washed with PBS and incubated with fluorescence-conjugated secondary antibodies (Invitrogen, Carlsbad, CA) for 60 min at room temperature. After three washes with PBS, the sections were mounted on precleaned microscope slides. Slides were observed under a Leica fluorescent microscope with corresponding filters. Pictures were captured by a digital camera system. No staining was seen when PBS was used instead of the primary antibody in the above procedure.

Expression of Ca²⁺ channel subunits was quantified using Adobe Photoshop CS5 (Photoshop Extended). Cells were selected by the lasso tool. After a measurement scale was set (1 pixel = 1 pixel), the integrated density (optical density, OD) of the Ca²⁺ channel subunit image (red color) was automatically measured by clicking record measurements in the analysis menu. Similarly, the total pixels (area) of all cells labeled by PGP9.5 (with and without Ca²⁺ channel subunit image) were measured in each slice. The quantitative data were calculated by the integrated density of the Ca²⁺ channel subunit image/total pixels of all cells and presented as OD/pixel.

Isolation of intracardiac ganglion neurons.

ICG is divided into the sinoatrial ganglion at the junction of the right superior vena cava and right atrium and the atrioventricular ganglion at the junction of the inferior pulmonary veins and left atrium (39). In the present study, the sinoatrial ganglion of the ICG was removed from each rat and placed in ice-cold modified Tyrode's solution (mM): 140 NaCl, 5 KCl, 10 HEPES, 5 glucose. The ICG was minced into small pieces with microscissors and incubated for 30 min at 37°C in an enzymatic modified Tyrode's solution containing 0.1% collagenase and 0.1% trypsin. The tissues were then transferred to a modified Tyrode's solution containing 0.2% collagenase and 0.5% bovine serum albumin for a 30-min incubation at 37°C. The isolated cells were cultured at 37°C in a humidified atmosphere of 95% air-5% CO₂ for 4 to 8 h before the patch-clamp experiments.

Whole cell recording for calcium currents and action potentials.

Ca_v currents and action potential were recorded by the whole cell patch-clamp technique using Axopatch 200B patch-clamp amplifier (Axon Instruments, Foster City, CA).

In the voltage-clamp experiments, resistance of the patch pipette was 4–6 MΩ when filled with the following solution (in mM): 120 CsCl, 1 CaCl₂, 40 HEPES, 11 EGTA, 4 MgATP, 0.3 Tris-GTP, 14 creatine phosphate, and 0.1 leupeptin (pH 7.3, 305 mOsm/l). The extracellular solution consisted of (in mM): 140 tetraethylammonium (TEA)-Cl, 5 BaCl₂, 1 MgCl₂, 10 HEPES, 0.001 TTX, 2 4-aminopyridine (4-AP), and 10 glucose (pH 7.4; 310 mOsm/l). Series resistance of 5–13 MΩ was electronically compensated 30–80%. Junction potential was calculated to be +7.9 mV using pCLAMP 10.2 software, and all values of membrane potential given throughout were corrected using this value. Current traces were sampled at 10 kHz and filtered at 5 kHz. The holding potential was −80 mV and current-voltage (I-V) relationships were elicited by 5-mV step increments to potentials between −60 and 50 mV for 500 ms. Peak currents were measured for each test potential, and current density was calculated by dividing peak current by cell membrane capacitance (C_m).

To study steady-state inactivation, we used two-step pulse protocols from a holding potential of −80 mV. First, a 10-s prepulse was applied at various potentials ranging from −110 to +30 mV (10 mV step). Then the voltage was returned back to the holding potential of −80 mV for 5 ms, followed by a 100-ms test pulse to −5 mV. Inactivation curves were constructed from currents at the corresponding prepulse voltages and fit to the Boltzmann function: I/I_max = (1-S)/{1 + exp [(V - V_1/2)/K₁]} + S, where I is the peak current at each prepulse potential V; I_max is the maximum current recorded; V_1/2 is the prepulse potential, where I is the half of the maximum; K₁ is the slope factor at V_1/2. S is the noninactivating component.

In the current-clamp experiments, action potential was elicited by a ramp current injection of 0–100 pA, and the current threshold-inducing action potential was measured at the beginning of the first action potential. Frequency of action potentials was measured in a 1-s current clamp. The patch-pipette solution was composed of (in mM): 105 K-aspartate, 20 KCl, 1 CaCl₂, 5 MgATP, 10 HEPES, 10 EGTA, and 25 glucose (pH 7.2; 320 mOsm/l). The bath solution was composed of (in mM): 140 NaCl, 5.4 KCl, 0.5 MgCl₂, 2.5 CaCl₂, 5.5 HEPES, 11 glucose, and 10 sucrose (pH 7.4; 330 mOsm/;). P-clamp 10.2 program (Axon Instruments) was used for data acquisition and analysis. All experiments were done at room temperature.

Compounds.

ω-Conotoxin GVIA (a specific N-type Ca²⁺ channel blocker, Alomone Laboratories) was used in the electrophysiological experiments. On the basis of previous study (21) and our preliminary data, the concentration of ω-conotoxin GVIA (1 μM) used in the present study is a saturating concentration for inhibiting N-type Ca²⁺ channel.

Data analysis.

All data are presented as means ± SE. SigmaStat 3.5 was used for data analysis. Statistical significance was determined by Student's unpaired t-test for hemodynamic and metabolic characteristics and expression of Ca²⁺ channel subunits. A two-way ANOVA with post hoc Bonferroni test was used in the electrophysiological parameters. Statistical significance was accepted when P < 0.05.

RESULTS

Induction of T2DM.

T2DM was induced by a combination of both high-fat diet and injection of low-dose STZ. After 12–14 wk of the above treatments (high-fat diet and STZ injection), fasting blood glucose, plasma triglyceride, leptin, and fat pads were higher than those in sham rats (Table 2). Blood glucose tolerance and insulin sensitivity index were significantly decreased in the T2DM rats, compared with that in sham rats (Fig. 1 and Table 2). However, there was no significant difference on body weight, blood pressure, heart rate, and fasting plasma insulin between sham and T2DM rats (Table 2).

Table 2.

Hemodynamic and metabolic characteristics of sham and type 2 diabetic rats

	Sham	Diabetes
Body weight, g	418 ± 7	449 ± 13
Mean blood pressure, mmHg	95.3 ± 3.1	101.6 ± 3.9
Heart rate, beat/min	347 ± 9	354 ± 12
Fasting blood glucose, mg/dl	96.9 ± 6.7	281.3 ± 9.7*
Fasting plasma insulin, mu/l	12.3 ± 1.2	11.4 ± 1.6
Insulin sensitivity index	−3.96 ± 0.07	−5.04 ± 0.28*
Plasma triglyceride, mmol/l	1.08 ± 0.28	3.37 ± 0.35*
Plasma leptin, ng/ml	352 ± 11	406 ± 13*
Retroperitoneal fat pad, g	5.17 ± 0.24	7.68 ± 0.39*
Epididymal fat pad, g	8.63 ± 0.38	9.84 ± 0.41*
Brown adipose tissues, g	1.16 ± 0.08	0.33 ± 0.06*

Data are means ± SE.

^*P < 0.05 vs. sham.

Fig. 1.

Plasma glucose during intraperitoneal glucose tolerance test in sham and high-fat diet/ streptozotocin (STZ) injection-induced type 2 diabetic rats. Data are means ± SE, n = 10 rats in each group. *P < 0.05 vs. sham rats.

The mRNA and protein expression of Ca²⁺ channel subunits in ICG from sham and T2DM rats.

Xu et al. (54) have reported that low-threshold Ca²⁺ channels (T-type Ca²⁺ channels) could not be detected in the rat ICG (54). Therefore, we examined the mRNA and protein expression of high-threshold Ca²⁺ channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3) in the ICG from sham and T2DM rats.

Single-cell real-time RT-PCR analysis of the Ca²⁺ channel subunits in the ICG is shown in Fig. 2. The mRNA of Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3 were expressed in the ICG neurons. However, only mRNA of Ca_v2.2 in the T2DM ICG neurons was lower than that in sham ICG neurons (Fig. 2).

Fig. 2.

Single-cell mRNA expression of L (Ca_v1.2 and Ca_v1.3), N (Ca_v2.2), P/Q (Ca_v2.1), and R (Ca_v2.3) type Ca²⁺ channels in the intracardiac ganglia (ICG) from sham and type 2 diabetic rats. Data are means ± SE, n = 10 cells in each group. *P < 0.05 vs. sham rats.

Using Western blot, we found there was no detectable protein expression of Ca²⁺ channel subunits in the ICG from sham and T2DM rats though the ICG from four rats were pooled together for Western blot (data not shown). Therefore, the Western blot could not be used as an appropriate method to measure the protein expression of the Ca²⁺ channel subunits in the ICG because of the limitation of the tiny ICG tissue.

Immunofluorescence double-staining data showed that the Ca²⁺ channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3) were expressed in the rat ICG neurons (Fig. 3). Additionally, T2DM decreased the protein expression of Ca_v2.2 subunit (N-type Ca²⁺ channel) but not the protein expression of other Ca²⁺ channel subunits in the ICG neurons, compared with those in sham rats (Fig. 3).

Fig. 3.

Representative (A and B) and summary (C) data for protein expression of Ca²⁺ channel subtypes in the ICG neurons from sham and type 2 diabetic rats. PGP9.5, a neuron marker. Data are means ± SE, n = 100 cells from 4 rats in each group. *P < 0.05 vs. sham rats.

Ca²⁺ currents in the ICG neurons from sham and T2DM rats.

In the present study, Ba²⁺ was used as the charge carrier to record Ca²⁺ currents. Ca²⁺ currents in the ICG neurons were recorded by inhibiting Na⁺ currents with extracellular TTX, and K⁺ currents were recorded with extracellular TEA and 4-AP plus intracellular Cs⁺. Figure 4 illustrates original recordings of Ca²⁺ currents, I-V curves, and mean data in the ICG neurons from sham and T2DM rats. As illustrated in Fig. 4, the Ca²⁺ currents were significantly decreased in the ICG neurons from T2DM rats, compared with those from sham rats. After treatment of 1 μM ω-conotoxin GVIA (a specific N-type Ca²⁺ channel blocker), the Ca²⁺ currents in the ICG neurons were reduced to the same level in sham and T2DM rats (Fig. 4). Furthermore, the residual Ca²⁺ currents were totally inhibited by 0.1 mM Cd²⁺ (a common voltage-gated Ca²⁺ channel blocker, data not shown). These results indicate that T2DM only decreases the N-type Ca²⁺ currents in the ICG neurons, which is identical with the immunofluorescent finding for the protein expression of the Ca²⁺ channels (Fig. 3).

Fig. 4.

Original recording (A), current-voltage (I-V) curve (B), and mean data (C) of the Ca²⁺ currents before and after treatment of ω-conotoxin GVIA (1 μM) in the ICG neurons from sham and type 2 diabetic rats. Data are means ± SE, n = 10 cells in each group. *P < 0.05 vs. sham control; #P < 0.05 vs. diabetes control. Ca²⁺ current density in C measured in response to a test pulse at −5 mV from holding potential −80 mV.

Steady-state inactivation of the Ca²⁺ channels was evaluated with a two-pulse protocol (Fig. 5). Figure 5 illustrates the original traces and the mean inactivation curves obtained in 8 ICG neurons from sham and T2DM rats, respectively. The mean inactivation curve exhibited a threshold at about −90 mV and failed to reach full inactivation. There was no difference in the inactivation curves between sham and T2DM rats (sham: V_1/2 = −22.8 mV, K₁ =−8.3, S = 0.07; T2DM: V_1/2 = −21.0 mV, K₁ = −8.3, S = 0.07).

Fig. 5.

Representative (A) and summary (B) data for steady-state inactivation of Ca²⁺ currents in the ICG neurons from sham and type 2 diabetic rats. Data are means ± SE, n = 8 cells in each group.

Cell excitability in the ICG neurons from sham and T2DM rats.

To compare the cell excitability in the ICG neurons between sham and T2DM rats, we measured current threshold-inducing action potential using the ramp current clamp (Fig. 6). The current threshold-inducing action potential is 31.2 ± 0.8 pA in the sham ICG neurons. T2DM significantly increased the current threshold-inducing action potential in the ICG neurons (63.5 ± 3.0 pA; P < 0.05; Fig. 6), compared with those from sham rats. In addition, N-type Ca²⁺ channel blocker (1 μM ω-conotoxin GVIA) raised the current threshold-induced action potential to the same level in the ICG neurons from sham and T2DM rats.

Fig. 6.

Original recording (A) and mean data (B) of current threshold-inducing action potential before and after treatment of ω-conotoxin GVIA (1 μM) in the ICG neurons from sham and type 2 diabetic rats. Data are means ± SE, n = 9 cells in each group. *P < 0.05 vs. sham control; #P < 0.05 vs. diabetes control.

Another parameter of the cell excitability, frequency of action potentials was also measured under the current clamp (100 pA, 1 s). Frequency of action potentials was significantly decreased in the ICG neurons from T2DM rats, compared with that from sham rats (Fig. 7, A and B). ω-Conotoxin GVIA further reduced the frequency of action potentials to the same level in the sham and T2DM rats.

Fig. 7.

Frequency of action potentials before and after treatment of ω-conotoxin GVIA (1 μM) in the ICG neurons from sham and type 2 diabetic rats (A–C). Data are means ± SE, n = 9 cells in each group. *P < 0.05 vs. sham control; #P < 0.05 vs. diabetic control.

Additionally, T2DM also slowed down the maximum rate of depolarization of action potentials and lengthened action potential duration at 90% repolarization in the ICG neurons (Table 3). However, there was no difference on resting membrane potential and overshot of action potentials in the ICG neurons between sham and T2DM rats (Table 3).

Table 3.

Diabetes-induced electrophysiological alterations on action potentials in rat intracardiac ganglion neurons

	RMP, mV	Vmax, mV/ms	Overshoot, mV	APD90, ms
Sham
Control	−60.3 ± 1.9	143.8 ± 8.2	77.4 ± 3.5	54.2 ± 4.2
ω-Conotoxin GVIA (1 μM)	−61.0 ± 2.2	93.6 ± 10.2*	76.7 ± 3.4	83.5 ± 3.3*
Diabetes
Control	−61.3 ± 1.7	115.4 ± 7.5*	74.7 ± 3.1	74.3 ± 3.7*
ω-Conotoxin GVIA (1 μM)	−62.2 ± 1.9	86.6 ± 10.3†	74.3 ± 3.4	89.0 ± 4.8

Data are means ± SE. RMP, resting membrane potential; V_max, the maximum rate of depolarization of action potentials; APD₉₀, action potential duration at 90% repolarization.

^*P < 0.05 vs. sham control;

^†P < 0.05 vs. diabetes control.

In other experiments, we also measured the frequency of action potentials in response to the different clamp currents (0–100 pA, 1 s) in sham and T2DM ICG neurons (Fig. 7C). T2DM reduced the frequency of action potentials in the ICG neurons at 40–100 pA clamp currents by comparison with sham ICG neurons, which further confirms the attenuated cell excitability in the T2DM ICG neurons. At all levels of the clamp currents, ω-conotoxin GVIA (1 μM) reduced the frequency of action potentials to the same level in the sham and T2DM rats (Fig. 7C).

DISCUSSION

In the present study, we found that 1) combination of both high-fat diet and injection of low-dose STZ induced the frank T2DM in rats, which was characterized by insulin resistance (lowered insulin sensitivity index and blood glucose tolerance) and hyperglycemia (Table 2 and Fig. 1); 2) T2DM significantly lowered the mRNA and protein expression of the N-type Ca²⁺ channels and reduced the N-type Ca²⁺ current density and cell excitability in the ICG neurons (Figs. 2–7). These findings indicate that T2DM-diminished N-type Ca²⁺ channel activation is involved in the attenuated ICG neuron excitability in T2DM conditions.

T2DM animal model.

T2DM is a complex, heterogeneous, and multigenic disease, whose etiology and development are determined by genetic, nutritional, and environmental factors. It is absolutely imperative for us to prevent the new cases and to cure the existing cases of T2DM because of increasing prevalence and high mortality of T2DM (17, 18, 22, 31, 33). As we know, clinical T2DM is characterized by a progressive increase of the insulin resistance and a followed inadequate compensatory insulin secretion from pancreatic β-cells and hyperglycemia (13, 24, 25, 38). Usually, the patients under prediabetic state of T2DM have insulin resistance and compensatory hyperinsulinemia because the β-cells normally should compensate insulin resistance by releasing more insulin to keep the normal blood glucose (27, 50). Gradually, the patients have progressed into the frank T2DM with the impaired glucose tolerance and hyperglycemia when the β-cell function is no longer able to confront with the insulin resistance (25, 38). To understand the pathogenesis and complications of patients with T2DM and to find new therapies, it is therefore very necessary to establish and develop appropriate experimental T2DM models for mimicking the natural history and clinical characteristics of human T2DM.

There are many animal T2DM models to be used for the T2DM studies (42). First, some genetic animal models (such as Zucker fatty rat, ob/ob mouse, and db/db mouse) can develop the spontaneous T2DM diabetes (42), which are extensively used for many studies. However, highly inbred, homogeneous, and mostly monogenic inheritance in these models are not the same as the large clinical heterogeneity in patients with T2DM (42, 43). Additionally, the genetic factor affects the development of T2DM in these animal models at a greater extent than in patients with T2DM (29, 42, 43). Furthermore, patients with frank T2DM do not present the obvious hyperinsulinemia seen in these animal models (29, 34). Second, STZ injection-induced diabetes model exhibits the pancreatic β-cell damage and insulin deficiency, rather than the insulin resistance, which are more like human type 1 diabetes than T2DM (36, 43, 51). Third, high-fat diet-/nutrition-induced animal model develops obesity, hyperinsulinemia, and insulin resistance but not frank hyperglycemia (41, 43, 44). In the present study, therefore, we selected and modified a T2DM rat model induced by a combination of both high-fat diet and injection of low-dose STZ (23, 32, 35, 37, 43, 56, 57). In this rat T2DM model, high-fat diet might initiate the insulin resistance (14, 47), which is one of the key characteristics of patients with T2DM; low-dose STZ has been thought to induce a mild impairment of insulin release, one feature of the late stage of the human T2DM (35, 43). Our present study showed that cotreatment of high-fat diet and low-dose STZ (30 mg/kg ip) induced hyperglycemia, hyperlipidemia, and insulin resistance (lowered insulin sensitivity index and blood glucose tolerance) but not hyperinsulinemia, which closely mimicked the pathogenesis and clinical characteristics of patients with T2DM. Our pilot experiments (data not shown) and some previous studies (32, 35, 43) have found that high-fat diet alone induces hyperlipidemia, hyperinsulinemia, insulin resistance but not hyperglycemia, and low-dose STZ alone induced mild hyperglycemia and hypoinsulinemia but not hyperlipidemia and insulin resistance. More importantly, our present study also found that the ICG neuron excitability was lowered in T2DM rats (Figs. 6 and 7). Acting as a final common pathway of the arterial baroreflex arc, the ICG neurons play an important role in the autonomic neural control of the cardiac function (3, 20). Therefore, rat T2DM induced by high-fat diet/STZ is an appropriate animal model to explore the cellular and molecular mechanisms associated with the attenuated baroreflex function.

Cell excitability and Ca²⁺ channels in the ICG neurons from T2DM rats.

Growing evidence has shown that abnormal arterial baroreflex is a common complication in T2DM state (8, 40), which might increase the mortality of patients with T2DM (8). The arterial baroreflex arc consists of arterial baroreceptor afferent limb, central neural component, and autonomic efferent component (such as intracardiac ganglia), which normally maintains heart rate and blood pressure through acting on both the sympathetic and parasympathetic efferents of the autonomic nervous system (16, 28). Although the potential mechanisms about abnormal arterial baroreflex in T2DM are still unclear, Freccero et al. (15) have found that the parasympathetic nerve function may be more impaired in patients with T2DM (15). In the present study, we found that the cell excitability of the ICG neurons was significantly decreased in the T2DM rats (Figs. 6 and 7 and Table 3). The ICG neurons are postganglionic neurons mediating parasympathetic nerve innervation of the heart, which receive and integrate neural and humoral signals to influence heart rate (2). Therefore, our present results indicate that reduced ICG neuron excitability might be involved in the abnormal arterial baroreflex in the T2DM state. However, we do realize the limitation of the isolated ICG neurons, which include 1) the isolated primary cells losing their natural environment and 2) the dissociation of the cell bodies from the ICG severing the axonal fibers. Care should be taken when extrapolating the data obtained here to the in vivo experiments. Further key studies are needed to clarify whether reduced ICG neuron excitability contributes to the arterial baroreflex dysfunction in the T2DM (such as comparing the arterial baroreflex function in sham and T2DM rats before and after transfecting N-type Ca²⁺ channel gene and shRNA into the ICG neurons).

In the current clamp, we found that the current threshold-inducing action potential was about 30 pA, and 100% of the cells produced repetitive action potentials under the depolarizing current injection (100 pA, 1 s) in the sham ICG neurons (Figs. 6 and 7). In contrast to our study, Xu and Adams (53) reported that repetitive action potentials could be elicited in only 15% of the ICG neurons (53). One possibility for this discrepancy is that their study employed newborn rats and a low current injection (40 pA) for the production of action potential. To compare the ICG neuron excitability of sham and T2DM rats, we used adult rats and a high current injection (100 pA) to elicit action potential because T2DM could not be induced in newborn animals, and the current threshold-inducing action potential was about 60 pA in the ICG neurons from T2DM rats.

Voltage-gated Ca²⁺ channels are involved in the neuronal excitability and neurotransmission in the central and peripheral nervous systems (54). Until now, five subtypes (T, L, N, P/Q, and R) of the Ca²⁺ channels have been functionally characterized in the central and peripheral neurons (48, 49). A pore-forming α1-subunit contained in all Ca²⁺ channels determines the biophysical and pharmacological properties of the Ca²⁺ channels (5). There are three major families of α1-subunits: 1) Ca_v1 (Ca_v1.1, Ca_v1.2, and Ca_v1.3) family encodes L-type of the Ca²⁺ channels; 2) Ca_v2 family encodes P/Q (Ca_v2.1), N (Ca_v2.2), and R (Ca_v2.3) types of the Ca²⁺ channels; 3) Ca_v3 family encodes T-type of the Ca²⁺ channels (5, 6). Using electrophysiological technique, one research group found absence of the T-type Ca²⁺ current in the rat ICG neurons (54). Therefore, we measured the mRNA and protein expressions of other four types of the Ca²⁺ channels in the ICG neurons from sham and T2DM rats. Although Ca²⁺ channel subunits (Ca_v1.2, Ca_v1.3, Ca_v2.1, Ca_v2.2, and Ca_v2.3) could not be detected by Western blot because of the tiny ICG tissues, single-cell real-time RT-PCR and immunofluorescence data showed the mRNA and protein expressions of these Ca²⁺ channel subunits in the ICG neurons. More importantly, T2DM decreased the mRNA and protein expressions of N-type Ca²⁺ channels but did not affect other types of Ca²⁺ channels in the ICG neurons, compared with sham rats (Figs. 2 and 3). The results of the Ca²⁺ current recording also showed that T2DM significantly reduced the Ca²⁺ currents in the ICG neurons (Fig. 4). In addition, on the basis of the fact that ω-conotoxin GVIA (a specific N-type Ca²⁺ channel blocker) decreased the Ca²⁺ currents toward the same level in the sham and T2DM rats, we can logically assume that T2DM only induces a decline of the N-type Ca²⁺ currents in the ICG neurons, which further confirms the single-cell real-time RT-PCR and immunofluorescence results (Figs. 2 and 3).

Xu and Adams (53) have demonstrated that Ca²⁺ channels influence the cell excitability in the ICG neurons because they found CdCl₂ (a common voltage-gated Ca²⁺ channel blocker) reversibly abolished action potential (53). In the present study, T2DM reduced the ICG neuron excitability (increasing current threshold-inducing action potential and decreasing frequency of action potentials). N-type Ca²⁺ channel blocker induced the same alterations of the current threshold and frequency of action potentials in the ICG neurons from sham and T2DM rats (Figs. 6 and 7). These results strongly suggest that the decreased N-type Ca²⁺ currents mediate the suppression of the ICG neuron excitability in T2DM rats.

Although transient outward and inwardly rectifying K⁺ channels are not detectable in isolated ICG neurons, delayed outward K⁺ channels including both Ca²⁺-dependent and delayed rectifier K⁺ channels are found in isolated ICG neurons, which also determine the cell excitability via affecting the repolarization phase of the action potential (53). In our present study, T2DM altered the APD₉₀ in the isolated ICG neurons (Table 3). On the basis of these results, it is possible that K⁺ channels are also altered in T2DM ICG neurons. Therefore, it should be evidenced by further study.

Although the present study showed that T2DM decreased the N-type Ca²⁺ channel activation and cell excitability in the ICG neurons, we do not know what can mediate the alterations of the Ca²⁺ channels induced by T2DM. Multifactors (such as genetic, nutritional, and environmental factors) determine the etiology and development of T2DM, which induces hyperglycemia, hyperlipidemia, and insulin resistance. An electrophysiological study has shown that reactive oxygen species (ROS) can decrease the cell excitability of rat ICG neurons (52). It is possible that one or multifactors (hyperglycemia, hyperlipidemia, and insulin resistance) induce the ROS overproduction and the latter is involved in the T2DM-induced changes of Ca²⁺ channels and cell excitability in the ICG neurons. However, the further studies used with multifaceted technical approaches (from whole-animal to cellular-molecular levels) are needed because 1) we do not know whether T2DM induces overproduction of the ROS in the ICG neurons and 2) the above study (52) only investigated ROS-induced acute influence on the cell electrophysiological properties but not the chronic modulation on the mRNA and protein expressions of ion channels.

In conclusion, we have shown that the mRNA and protein expressions and current density of the N-type Ca²⁺ channels are decreased in the high-fat diet/STZ injection-induced T2DM rats. This reduced N-type Ca²⁺ channel is involved in the attenuated ICG neuron excitability in T2DM rats by slowing the maximum rate of depolarization of action potentials and prolonging the action potential duration. In the meanwhile, our study also suggests that high-fat diet/STZ injection-induced rat T2DM might be an appropriate animal model for mimicking clinical characteristics of the patients with T2DM and discovering the mechanisms of the arterial baroreflex dysfunction.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

Author contributions: J.L., H.T., H.Z., and L.Z. performed experiments; J.L., H.T., H.Z., L.Z., and Y.-L.L. analyzed data; J.L., H.T., H.Z., T.P.T., R.L.M., and Y.-L.L. interpreted results of experiments; J.L., H.T., H.Z., and Y.-L.L. prepared figures; J.L., H.T., and Y.-L.L. drafted manuscript; J.L., H.T., H.Z., L.Z., T.P.T., R.L.M., and Y.-L.L. approved final version of manuscript; T.P.T., R.L.M., and Y.-L.L. edited and revised manuscript; Y.-L.L. conception and design of research.