Skip to main content
NCBI home page
Molecular Therapy logoLink to Molecular Therapy
. 2013 Jun 11;21(9):1738–1748. doi: 10.1038/mt.2013.117

Meganuclease-mediated Virus Self-cleavage Facilitates Tumor-specific Virus Replication

Engin Gürlevik 1, Peter Schache 1, Anneliese Goez 1, Arnold Kloos 1, Norman Woller 1, Nina Armbrecht 1, Michael P Manns 1, Stefan Kubicka 1,2,*, Florian Kühnel 1,*
PMCID: PMC3776629  PMID: 23752311

Abstract

Meganucleases can specifically cleave long DNA sequence motifs, a feature that makes them an ideal tool for gene engineering in living cells. In a proof-of-concept study, we investigated the use of the meganuclease I-Sce I for targeted virus self-disruption to generate high-specific oncolytic viruses. For this purpose, we provided oncolytic adenoviruses with a molecular circuit that selectively responds to p53 activation by expression of I-Sce I subsequently leading to self-disruption of the viral DNA via heterologous I-Sce I recognition sites within the virus genome. We observed that virus replication and cell lysis was effectively impaired in p53-normal cells, but not in p53-dysfunctional tumor cells. I-Sce I activity led to effective intracellular processing of viral DNA as confirmed by detection of specific cleavage products. Virus disruption did not interfere with E1A levels indicating that reduction of functional virus genomes was the predominant cause for conditional replication. Consequently, tumor-specific replication was further enhanced when E1A expression was additionally inhibited by targeted transcriptional repression. Finally, we demonstrated p53-dependent oncolysis by I-Sce I-expressing viruses in vitro and in vivo, and demonstrated effective inhibition of tumor growth. In summary, meganuclease-mediated virus cleavage represents a promising approach to provide oncolytic viruses with attractive safety profiles.

Introduction

Oncolytic viruses are a class of antineoplastic agents capable of overcoming the present limitations of conventional therapies in the treatment of solid cancers. Numerous virus species such as adenovirus, poxvirus, measles, herpes simplex virus, vesicular stomatitis virus, and reovirus have been adopted as oncolytic agents or genetically reengineered to achieve tumor-selective replication.1 The oncolytic poxvirus JX-549 has now successfully entered clinical development and showed promising results in clinical studies of hepatocellular carcinoma.2,3 Oncolytic viruses are also capable of eliciting significant tumor-directed immune responses mediated by both innate and adaptive immune cells.4 The contribution of either replication-mediated lysis or inflammation-induced antitumoral immune responses to over-all therapeutic response is a matter of current discussion.5 Adenoviruses are known to efficiently lyse tumor tissue associated with massive induction of local inflammation and can eradicate lymph node metastases by lymphogenic spreading.6,7 Different strategies have been pursued to restrict adenoviral replication to tumors such as control of E1A by tissue-specific promoters,8 or by mechanisms addressing pan-cancer alterations in telomerase, Rb/E2F or p53 pathways.9,10,11 However, a common disadvantage of these strategies is that the viral genome remains intact in nontarget cells. Consequently, leakiness of adenoviral replication remains an unsolved challenge mostly attributable to incomplete silencing of E1A.12,13 Close proximity of cryptic transactivating sequences may provide for low level “starter” expression of E1A sufficient to initiate the full feed-forward cascade of viral gene activation and replication. Also, multiple cell infection facilitates accumulation of E1A to the critical levels necessary for replication in nontarget cells as well. This scenario may frequently occur after intratumoral oncolytic virus injections in adjacent normal tissue or in the liver thus allowing for undesired viral replication and replication-mediated toxicity at these sites. Following treatment completion, oncolytic adenoviruses may persist in a latent state and might be reactivated under immunosuppressive conditions. Since high-grade selectivity of oncolytic adenoviruses is mandatory to optimize tumor-directed immune responses but to avoid dose-limiting toxicities,14 stringent regulatory concepts are required. Targeted self-disruption of oncolytic adenoviruses that is selectively activated in normal cells has not yet been investigated. We considered nuclease-mediated virus cleavage an interesting mechanism to achieve or to support tumor-selective virus replication.

Meganucleases or “homing endonucleases,” are natural enzymes that specifically recognize and cleave exceptionally large DNA sequences of 12–40 bp in size. These enzymes originate from bacteria or yeast and are involved in spreading of mobile gene elements.15 Since induction of DNA double strand breaks (DSBs) efficiently triggers homologous gene recombination in vivo, meganucleases as well as tailored nucleases have been established as versatile tools for targeted DSB induction and site-specific genome engineering in living cells.16,17,18 Furthermore, they have been intensively investigated as safer alternatives for retroviral gene transfer strategies in human genetic disorders and their application as antiviral agents has also attracted attention.19,20

As a novel strategy to stringently limit oncolytic adenovirus replication to tumors cells, we investigated the use of meganuclease-mediated virus clipping as part of a “self-cleavage” function that is selectively activated in normal cells. In a proof-of-principle study using the meganuclease I-Sce I, we show that p53-dependent expression of virus-encoded I-Sce I effectively cleaves I-Sce I-sensitive adenoviral DNA and attenuates viral replication in normal cells. This approach represents an attractive strategy to limit viral replication to cancer tissue and to improve the safety profile of oncolytic adenoviruses.

Results

The aim of our study was to show that meganucleases, as part of a self-restrictive mechanism, can be employed for tumor-selective virus replication. The reference meganuclease I-Sce I21 that has been extensively studied in targeted DNA recombination, DNA repair processes, and in genome engineering strategies was used for this study. Earlier studies also suggest that I-Sce I is highly specific and relatively well tolerated in human cells.22,23,24 To address our aim, we developed a concept for a self-cleavage-mechanism that can be used for any existing oncolytic DNA-virus (Figure 1). To realize a self-cleavage mechanism, the virus genome is provided with an expression unit for I-Sce I and is rendered sensitive to I-Sce-activity by heterologous introduction of I-Sce I recognition sequences. Following induction of I-Sce I expression by activation of the p53-responsive element, this genetic design should allow for site-specific cleavage and disruption of viral DNA. In this concept, activation of self-cleavage is restricted to normal cells since I-Sce I is selectively expressed in response to p53. Due to p53-dysfunction in tumor cells, lack of meganuclease expression should allow for efficient viral replication and oncolysis.

Figure 1.

Figure 1

Open in a new tab

Concept of specific meganuclease-mediated cleavage of oncolytic adenovirus genomes in nontumor cells. To realize effective cleavage and destruction of oncolytic adenovirus genomes in nontumor cells, recognition sites for the meganuclease I-Sce I are introduced into the virus genome. An additional expression unit provides the virus with a function to respond to intracellular activated p53 by expression of the meganuclease I-Sce I. The figure shows an adenovirus setup as used in this study. (a) In tumor cells harboring dysfunctional p53, the meganuclease is not expressed and viral replication can proceed normally. (b) In normal cells, viral cell entry activates p53 which drives expression of the meganuclease. Subsequent I-Sce I-mediated cleavage of the viral DNA leads to destruction of the adenoviral genome.

Virus generation and functional characterization

As an important prerequisite for our concept, we investigated whether wild-type adenovirus replication tolerates I-Sce I expression. For this purpose, cells that transiently expressed I-Sce I, or EGFP as control were additionally infected with adenovirus. After a single replication cycle, the cellular content of viral genomes and the production of infectious viral progeny were then investigated (Figure 2a,b). Sufficient I-Sce activity for intracellular DNA digestion was confirmed using reporter plasmids for detection of defined I-Sce-mediated DNA rearrangements (Supplementary Figure S1). Similar results in both p53-normal A549 and p53-dysfunctional Huh-7 cells suggested that p53 activity had no influence on adenoviral replication in this setting. Our data show that I-Sce I expression neither influenced infectious progeny nor intracellular content of virus DNA, indicating that I-Sce I does not affect adenoviral replication and particle assembly.

Figure 2.

Figure 2

Open in a new tab

Genetic setup and functional testing of I-Sce I-expressing oncolytic adenoviruses. (a) To control whether I-Sce-I compromise adenovirus replication, A549 and Huh-7 cells were cotransfected with plasmids coding for I-Sce I, or EGFP as control, and a plasmid for CD90.2-expression for subsequent cell sorting as described in the Methods section. Cells were additionally infected with human wt-Adenovirus serotype 5 at multiplicity of infection (MOI) of 5 to allow for complete infection. The I-Sce I/EGFP expressing subpopulation was isolated by CD90.2-MACS and relative amount of viral genomic DNA was determined by RT-qPCR against the hexon gene locus (EGFP = 1.0; mean + SD). (b) Viral titer in these cells was analyzed by Rapid Titer Assay (mean + SD). (c) Replication-competent, I-Sce I-sensitive adenoviruses were generated for p53-dependent expression of either I-Sce I, or EGFP as nonfunctional control as illustrated in the figure. A minimal version of the hTert promoter flanked by Gal4-binding sites (G) controls expression of the adenoviral E1A gene. In these viruses, the E1 region is flanked by inverted I-Sce I recognition sequences (S). In a second pair of viruses the I-Sce I (EGFP) expression is additionally linked to the p53-dependent expression of the targeted transcriptional repressor GAL4-KRAB (G4K) (d) To characterize the status of transcriptional p53 activity in the cell lines relevant for this study, cells were transfected with a prMinRGC-Luciferase reporter plasmid and pCMV-βgal. After 48 hours, cells were lysed, luceriferase activity was measured, and results were normalized by βgal-activity. (e) p53-positive A549 and HepG2 cells were infected at MOI of 1 with adenoviruses as indicated on top of the panel according to the virus numbering in part Figure 2C. p53-dysfunctional Huh-7 cells were infected at MOI 5 and used as control. Forty hours post infection whole cell extracts were prepared and expression of heterologous proteins was analyzed by western blot. A549 cells infected with Ad-Sce, Ad-EGFP, Ad-G4K-EGFP (from the top) served as exposition control for Huh-7.

Our concept should facilitate implementation on the basis of any oncolytic DNA-virus. For virus construction, a telomerase-dependent replicating adenovirus (hTert-Ad) was selected since telomerase-dependent replication is a well established mechanism for construction of oncolytic adenoviruses.9,25,26,27 A variant of hTert-Ad provided with a p53-dependent, I-Sce I-mediated self-cleavage function (Ad-Sce) and a corresponding control virus (Ad-EGFP) were generated (Figure 2c.) using the p53-responsive prMinRGC-promoter for control of I-Sce I expression as described previously.28 A central goal of our I-Sce I-dependent self-cleavage concept was to interfere with replication by disrupting virus genomes and reducing the load of functional virus. As an additional means to interfere with replication, we wanted to interfere with E1A expression by positioning the I-Sce I recognition sites at the termini of the E1 region. This should facilitate targeted excision of this replication-essential region and separation from the promoter in response to p53-dependent I-Sce I expression. Since it is known that very low amounts of E1A are sufficient to initiate replication, we considered a disadvantageous competition between I-Sce I-mediated DNA cleavage and accumulating virus genomes, which could efficiently antagonize p53 activity and supply with I-Sce I. In additional virus variants, we therefore wanted to actively suppress E1A to prevent replication onset and to limit viral loads to levels that can be successfully processed by I-Sce I. Using a p53-dependent repressor mechanism as previously described,28 we linked the meganuclease unit to the transcriptional repressor Gal4-KRAB (further referred to as G4K) via an IRES motif resulting in the oncolytic viruses Ad-G4K-Sce, and Ad-G4K-EGFP as control. To facilitate effective repression of E1A by G4K, the hTert promoter was flanked by Gal4-binding sites.

For subsequent studies, we used a panel of cell lines with different transcriptional p53 status. In these cell lines, the p53 activity was determined using a prMinRGC-luciferase reporter plasmid in transfection assays. An overview of these results is shown in Figure 2d. After infection of cells with different p53 status (p53-positive: A549 and HepG2, p53-dysfunctional: Huh-7) expression of heterologous proteins was investigated by western blot analyses. (Figure 2e). The results show that all heterologous proteins were expressed as expected. Differences in expression levels were observed between I-Sce I-expressing viruses and their respective controls. However, to facilitate western blot detection, samples were drawn at a later stage after infection and it has to be considered that protein levels might already reflect different replicative capacities.

I-Sce I efficiently cleaves I-Sce I-sensitive adenoviral DNA during replication

Next, we wanted to investigate the self-cleavage function by directly identifying enzymatic activity of I-Sce I after viral infection. We expected I-Sce I-mediated excision of the viral E1 region and considered the released fragment a substrate of the cellular DNA repair. Ligation of the fragment's open ends by DNA repair mechanisms could promote formation of a minicircle DNA as illustrated in Figure 3a. To prevent autonomous E1A expression from this minicircle DNA, the excisable fragment was designed to contain an additional polyA signal to interrupt transcriptional read-through from the E1B terminus after circularization. To investigate for these cleavage products, cells with different p53 status were infected with recombinant adenoviruses (Figure 3b). The proposed minicircle DNA was detected by amplification of an indicator DNA fragment reflecting the religation joint. After infection with an I-Sce I-expressing virus, p53-positive cells showed high levels of a 650 bp DNA fragment matching the predicted size. In contrast, cells lacking functional p53 produced none or only slight amounts of this fragment. The fragment was subjected to sequence analysis, which confirmed the presence of the E1 locus (Supplementary Figure S2). Furthermore, this analysis suggested that the open hemi sites had been predominantly processed and religated by nonhomologous end joining mechanisms thus leading to inactivation of the I-Sce I site. Our results demonstrate that I-Sce I is expressed in a p53-dependent manner and can efficiently and selectively cleave the adenoviral genome in infected cells.

Figure 3.

Figure 3

Open in a new tab

I-Sce I expression results in effective cleavage of adenoviral DNA. (a) The figure illustrates double I-Sce I-mediated virus cleavage and PCR-detection of fragments that indicate successful cleavage. After double I-Sce I-mediated cleavage, the E1 gene region is released from the viral backbone. Following religation by DNA damage repair mechanisms the resulting E1-minicircle DNA should be detectable by PCR. (b) Different cell lines were infected with viruses as indicated at an MOI of 0.5 and cellular DNA was harvested 24 hours later. The suggested minicircle DNA (cE1) was detected by PCR and visualized on an agarose gel. Uninfected cells served as control (K). (c) The figure illustrates the design of an additional PCR for identification of both uncleaved and cleaved/religated virus genomes. The results are shown in (d). (e) To detect E1-containing, but cleavage-resistent viruses, 293 cells and A549 cells were infected with adenoviruses at an MOI of 1. After a full replication cycle (48 h), cells were harvested, DNA was extracted and a PCR was performed to amplify a 540 bp fragment containing the distal I-Sce I recognition site (virus plasmid served as control). The resulting fragment was cleaved in vitro with I-Sce I, yielding 300 bp and 240 bp fragments, respectively. F is a prototypic fragment before digestion, M = 1kb marker.

We were further interested in the fate of the remnants of the adenoviral genome after cleavage. In general, DNA fragments with open ends are frequently neutralized by ligation and/or insertion into the host cell genome during a DNA damage response. Adenoviral episomes exist in a pseudocircular (“panhandle”) conformation with both termini noncovalently linked by the terminal proteins. This conformation could promote religation of the virus termini following release of the E1 region by I-Sce I. This question was investigated by a polymerase chain reaction (PCR) designed as illustrated in Figure 3c. Uncleaved virus genomes were expected to yield a 3.8 kb fragment, whereas after processing a 650 bp PCR product was expected. After infection of A549 cells with I-Sce I-expressing viruses, we could indeed detect the small fragment (Figure 3d) but not after infection with the EGFP control viruses. In the latter case, we only observed the PCR fragment characteristic for the intact viral genome. Interestingly, the intact genome signal was absent after I-Sce I-dependent virus cleavage. Together, these observations suggest that E1-excision is a frequent process. However, quantitative interpretation is difficult since fragments with different sizes are competitively amplified in this PCR. As a further control, infection of p53-dysfunctional cells did not result in the cleavage-specific fragment but yielded the large DNA fragment, indicating that virus genomes remained intact. As an alternative mechanism to I-Sce I-mediated excision of E1, one can imagine that I-Sce I can induce single cuts that are immediately being repaired before excision is complete. This process would yield E1-harboring viruses with inactivated I-Sce I sites that are replication-competent, but I-Sce I-insensitive. Using a PCR-based method, we analyzed cleavage of I-Sce I sites in E1-containing virus genomes after a complete cycle of viral cell infection (Figure 3e). The results show that 293 cells allow for virus production that does not contain detectable amounts of replication competent, but I-Sce I-insensitive progeny. Additionally, A549 cells were used to investigate the hypothesized DNA rearrangements under strong p53-positive conditions. Our results show that I-Sce I-insensitive progeny was detectable after replication in p53-active cells.

Meganuclease-mediated DNA-DSBs do not induce premature apoptosis

Our results described above suggest the contribution of cellular DNA repair mechanisms upon meganuclease-mediated generation of DNA DSBs. DSBs trigger a DNA damage response that induces cell cycle checkpoints and may finally induce cell death if the DNA damage is irreparable. An indicator for a DNA damage response is phosphorylation of the histone 2AX (γH2AX) by DNA-dependent protein kinases such as ATM.29,30,31 DNA fragmentation of I-Sce I-sensitive adenoviruses could eventually result in DNA damage-dependent apoptosis that could lead to acute toxicity, e.g. in the hepatic parenchyma as the preferred target tissue of systemic adenovirus particles. We therefore investigated a DNA damage response after infection with I-Sce I-expressing adenoviruses (Figure 4a). Figure 4a shows that a nonreplicative control adenoviral vector (Ad-GFP) was not capable of inducing γH2AX whereas wild-type adenovirus strongly induced γH2AX phosphorylation. These observations confirm previously reported results indicating that E1A-dependent adenoviral replication is a major trigger for a DNA damage response in adenoviral infected cells.32 The recombinant vectors Ad-Sce and Ad-EGFP induced equivalent levels of γH2AX that were both higher than the corresponding G4K-variants. Since levels for I-Sce I viruses did not significantly differ from EGFP-viruses in p53-positive A549 cells it can be excluded that DNA cleavage promotes H2AX phosphorylation. Consistently, in p53-mutated Huh-7 cells all four vectors induced similar levels of γH2AX.

Figure 4.

Figure 4

Open in a new tab

Efficient cleavage of oncolytic adenovirus genomes by I-Sce I does not promote DNA damage response-dependent apoptosis. (a) A549 and Huh-7 cells were infected with adenoviruses at MOI 1 in the presence of Doxorubicin (100 ng/ml). Whole cell extracts were prepared and levels of γH2AX were determined by western blot analysis. (b) Induction of apoptosis was tested 36 h post infection (at MOI of 5) by caspase-3 assays. Infection by VSV served as positive control (mean + SD). (c) p53-positive A549 cells were treated with Ad-Sce, or Ad-EGFP, or were left untreated. Tunicamycin was used as positive control. Thirty hours post infection, cells were detached, stained with propidiumiodide (PI) and annexin-V, and were analyzed by FACS.

Furthermore, we were interested whether meganuclease-expressing viruses were able to induce apoptosis in infected cells by analyzing the activation of the executioner caspase-3. As shown in Figure 4b, neither I-Sce I viruses nor the EGFP controls significantly induced caspase-3 when compared with vesicular stomatitis virus as positive control. We further performed flow cytometric analysis of PI/annexin V-stained cells following viral infection (Figure 4c). Ad-Sce infection of A549 cells led to a slightly increased amount of dead cells compared to untreated cells. Ad-EGFP showed a marked increase of both necrotic (PI-positive) and apoptotic (PI/annexin V-positive) cells as a characteristic feature of necrosis-like programmed cell death mediated by adenoviral replication.33 Our observations indicate that I-Sce I-induced virus fragmentation does not change the phenotype of cell death caused by viral replication.

I-Sce I-dependent self-cleavage facilitates and improves tumor-selective viral oncolysis

We investigated whether p53-dependent self-cleavage leads to selective oncolytic adenovirus replication by limiting viral replication in response to p53. To test this, A549 and Huh-7 cells were infected with adenoviruses and production of infectious progeny was determined (Figure 5a). Quantification of intracellular infectious particles in p53-positive A549 cells revealed that viral particle production of I-Sce I-harboring viruses was significantly inhibited compared to control viruses. These results suggest that p53-dependent activation of the meganuclease strongly affects virus replication since these differences were not detectable after infection of p53-dysfunctional Huh-7 cells. G4K-expression significantly reduced virus production in A549 cell, although a reduction was also observed in Huh-7 cells, an effect that can be due to the large DNA size of these viruses. To investigate this more in detail, we compared virus replication in A549 cells and in A549shp53 that stably express a shRNA against p53 (Figure 5b). The results clearly show that both I-Sce I-mediated and G4K-mediated effects on viral replication were significantly reduced in p53 knockdown cells.

Figure 5.

Figure 5

Open in a new tab

I-Sce I expression facilitates p53-dependent restriction of adenoviral replication and oncolysis in human cell lines. (a) A549 and Huh-7 cells were infected with indicated viruses (at MOI of 1) in the presence of Doxorubicin (100 ng/ml). Cells were harvested and lysed by repeated freeze–thaw-cycles to release viral particles. Infectious particles were titered by Rapid Titer Assay. (mean + SD). (b) A549 and A549shp53 were infected with indicated viruses at an MOI of 0.05 in the presence of Doxorubicin (100 ng/ml). At the time points indicated, cells were harvested, viral particles were released and titered by Rapid Titer Assay (mean + SD). (c) Cell lines reflecting different p53 activity were infected with adenoviruses and MOIs as indicated. After 7–10 days of infection, cells were fixed and stained with crystal violet.

Next, we investigated whether I-Sce I-dependent self-cleavage facilitates p53-selective oncolysis. Since complex genetic manipulation of oncolytic vectors generally affects virus replication and oncolytic properties, we also compared our viruses with the wild-type adenovirus and Onyx-015, an E1B55k-deleted adenovirus mutant that has already been tested in clinical trials.34 Also, Ad-p53sensor, a previously described virus that is regulated by p53-dependent, G4K-mediated repression of E1A was included in this experiment.28 The oncolysis assays showed that Ad-Sce and Ad-EGFP demonstrated equivalent oncolytic efficacy in p53-dysfunctional cells including A549 after p53 knockdown (Figure 5c). Similar results were seen with the G4K-expressing virus pair, although both viruses revealed reduced oncolysis potency when compared to G4K-nonexpressing viruses. Ad-Sce and Ad-EGFP showed at least equivalent oncolysis compared to Onyx-015 but were less effective when compared to wt-Ad5 and Ad-p53sensor. This observation might be attributable to the weaker E1A expression by the hTert promoter compared to the E1A wild-type promoter, or the CMV-promoter (Ad-p53sensor), respectively. Consistent with our hypothesis, both I-Sce I-expressing vectors were significantly less oncolytic than their respective controls (approximately 2 logs) in p53-positive cells, demonstrating that I-Sce-mediated self-cleavage effectively restricted viral replication and oncolysis. Also, G4K-mediated inhibition of E1A lead to a further inhibition of cell lysis in p53-positive cells though it must be considered that oncolytic activity, at least to some extent, was also reduced in p53-dysfunctional cells when compared to G4K-free viruses. Most likely, this observation suggests a constitutive loss due to the large size of the double-controlled viruses. Despite this aspect, combination of I-Sce I-mediated self-cleavage and G4K-mediated repression of E1A significantly reduced lysis of p53-positive cells. Even very high multiplicity of infection (MOI) was not sufficient to lyse the used p53-positive cells (A549 and HepG2). Although a constitutive reduction of some oncolytic potency in target tumor cells has to be considered, the extremely low cell lysis mediated by Ad-G4K-Sce in p53-normal cell lines confirms the beneficial cooperation between E1A repression and I-Sce I-mediated virus self-cleavage.

Since neoplastic cells may not reflect p53 activity in normal primary human cells, we tested the selectivity of viral replication in primary human fibroblast cells. First, we analyzed cleavage-specific breakdown products of viral DNA (Figure 6a). We observed that viral DNA was efficiently cleaved as demonstrated by the significant increase of minicircle DNAs following infection with I-Sce I-expressing viruses. Also, a faint minicircle signal was detectable with meganuclease-free viruses at late time points possibly mediated by recombination events between the homologous, inverted I-Sce I recognition sites. In parallel, we detected increased amounts of hexon-specific fragments indicating the successful induction of virus replication in fibroblasts (Figure 6b). Determination of viral particle production (Figure 6c) demonstrated that I-Sce I significantly inhibited production of infectious viral progeny in human fibroblasts. Since this effect was more prominent when comparing the G4K-expressing viruses, these results further underline that I-Sce I-mediated virus cleavage is improved by additional repression of E1A. We further investigated viral infection in an isogenic experiment using IMR-90 fibroblast after transient p53 knockdown by p53-siRNA. The results demonstrate that both I-Sce-mediated and G4K-mediated effects on viral replication were significantly diminished after p53 knockdown when compared to the control-transfected cells. The observation that differences between I-Sce I-expressing viruses and EGFP controls were not completely resolved is most likely due to the incomplete knockdown of p53 and consistent with observations in A549 cells (Figure 5).

Figure 6.

Figure 6

Open in a new tab

Amplification of I-Sce I-regulated oncolytic adenoviruses is effectively and specifically inhibited in primary human fibroblasts. Primary human IMR-90 fibroblasts were infected with adenovirus at MOI of 0.1. Cells were harvested at time points as indicated and RT-qPCR analysis was performed to investigate specific DNA sequences as noted on top of the diagrams (mean + SD). (a) Detection of the circularized E1 gene region. (b) Detection of the adenoviral hexon gene locus. (c) At different time points as indicated, cells were lysed and the released virus progeny was titered by Rapid Titer Assay. (d) Before adenoviral infection, IMR-90 fibroblasts were transfected twice with siRNA against p53, or with a control siRNA as described in the methods section. Intracellular virus titer was determined.

I-Sce I-mediated cleavage has negligible effects on E1A levels

Using I-Sce I-mediated virus cleavage, our goal was not only to allow for p53-dependent reduction of viral DNA templates in normal cells. By flanking the E1 gene region with I-Sce I cleavage sites we also tried to interfere with expression of E1A. This specific design of our viruses should allow for I-Sce I-mediated extraction of the E1 region and separation of the E1A coding sequence from the hTert promoter. Therefore, we analyzed E1A levels in infected cell lines (Figure 7a). Consistent with our expectations no differences in E1A levels were detectable after infection of p53-dysfunctional cells with Ad-Sce, Ad-EGFP or both bicistronic viruses. In contrast to our expectations, differences in E1A protein levels between I-Sce I viruses and their EGFP-expressing counterparts were also not detectable in p53-positive cell lines. The results demonstrate that virus disruption and extraction of the E1 locus did not affect E1A protein levels. As a positive control, G4K-expression effectively suppressed E1A confirming our previously described results.28 Consistent with the western blot analyses, E1A-mRNA levels (Figure 7b) revealed a complete transcriptional inhibition of E1A by G4K. When the G4K-free viruses were compared a slight decrease of E1A-mRNA after infection with Ad-I-Sce was observable, which was obviously not sufficient to influence protein levels. Unexpectedly, E1A-mRNA levels in G4K-expressing viruses were elevated to some extent compared to the G4K-free control viruses suggesting a cell line specific effect or additional factors that control E1A transcription in the course of infection. Together, the results showed that targeted E1-excision by I-Sce I was not sufficient to interfere with E1A expression. The results clearly demonstrate that the p53-dependent, I-Sce I-mediated attenuation of viral replication we observed in our experiments is only attributable to the reduction of functional virus genomes as origin of replication and virus assembly. Furthermore, the data suggest that the exact location of the cleavage site is less relevant.

Figure 7.

Figure 7

Open in a new tab

p53-dependent, I-Sce-mediated self-cleavage of oncolytic adenovirus has limited influence on E1A levels. (a) Cell lines with different p53 status were infected with adenoviruses as described before. After 24 hours of infection, cells were lysed and investigated by western blot analyses. (b) A549 and Huh-7 cells were infected with adenoviruses at an MOI of 0.5. Complete mRNA was harvested at indicated time points. RT-qPCR was performed to determine the relative levels of viral E1A-mRNA (Ad-Sce = 1.0; mean + SD).

I-Sce I-expressing oncolytic viruses inhibit tumor growth in vivo in a p53-dependent manner

Finally, we investigated the oncolytic properties of I-Sce I-expressing adenoviruses in vivo in a nude mouse model with subcutaneously grown Huh-7 xenografts. Tumors were treated with Ad-Sce and Ad-G4K-Sce or treated with an injection of medium as control. The growth monitoring demonstrated that both viruses were capable of inhibiting tumor growth. As expected from the oncolysis results in vitro, Ad-Sce appeared to be more efficient compared to Ad-G4K-Sce (Figure 8a), although the observed differences were not statistically significant. To investigate p53-dependency of I-Sce mediated virus cleavage in an in vivo model, A549 tumors and A549shp53 tumors were subcutaneously grown on nude mice and subsequently infected by Ad-Sce or Ad-EGFP as control, respectively (Figure 8b). Tumor size measurements revealed that the growth of Ad-Sce-infected A459 tumors was not as effectively inhibited compared to tumors that have been treated with the EGFP-expressing viruses. Since equivalent measurements in p53 knockdown tumors did not show significant differences in tumor growth control by these viruses, we demonstrated the p53-dependency of I-Sce I-mediated virus cleavage in vivo.

Figure 8.

Figure 8

Open in a new tab

Treatment with meganuclease-expressing oncolytic adenoviruses inhibits tumor growth in a p53-dependent manner in murine models of human tumor xenografts. (a) 1 × 107 Huh-7 cells were implanted into the flanks of nude mice to induce growth of tumor xenografts. Once tumors were palpable they were treated with 1 × 109 ifu of oncolytic adenovirus as indicated by intratumoral injection followed by a second injection after one week. Tumor size was monitored (n = 6 per group, ± SD). (b) 1 × 107 A549 (upper panel) or A549shp53 (lower panel) were implanted into the flanks of nude mice. Once tumors had injectable size, mice received an intravenous injection of doxorubicin (17.5 µg/20 g mouse) followed by intravenous administration of 1 × 108 ifu of oncolytic adenovirus as indicated. Tumor size was monitored (n = 6 per group, ± SD). NS, not significant.

In summary, our study demonstrates that meganuclease-mediated virus self-cleavage is an attractive method for the development of highly tumor-selective oncolytic viruses.

Discussion

Rare-cutting nucleases are excellent tools for targeted genome engineering in living cells and have been used for somatic gene correction to cure inborn diseases.35 Interestingly, the first nuclease-based strategy that actually entered clinical trials was developed to induce resistance to HIV infection in CD4+ cells.20,36 These studies demonstrated that tailored nucleases can be useful in antiviral therapeutic strategies. Consistently, tailored nucleases have been designed to cleave specific viral DNA sequences as an interesting strategy to eliminate viral pathogens, such as hepatitis B virus or herpes simplex virus.37,38 Using I-Sce I as a model meganuclease, our proof-of-principle study shows that nuclease-mediated virus self-cleavage can also be a promising means to achieve or to enhance tumor-selective virus replication for generation of oncolytic adenoviruses.

In our study, we have designed (telomerase-selective) oncolytic adenovirus harboring I-Sce I recognition sites together with a p53-responsive cassette for I-Sce I expression. Using this genetic element for targeted virus clipping, we were able to establish a “self-restrictive” function that is selectively activated in cells with normal p53 function. Our results show that I-Sce I expression and cleavage activity was dependent on the p53 status of the target cells. p53-dependent activation of I-Sce I led to effective virus self-cleavage (as detected by specific products of virus fragmentation), attenuated viral replication and cell lysis in p53-normal cells, including primary human fibroblasts. Interestingly, we found that extraction of the E1 locus by I-Sce I did not result in reduced E1A levels indicating that virus processing and disruption by I-Sce I was sufficient to interfere with viral replication. To generate highly selective variants, the I-Sce I-approach can be therefore ideally combined with mechanisms that directly suppress E1A. In our study, such viruses even spared p53-positive cells from lysis at relatively high infectious doses while lytic potential in tumor cells was only moderately reduced. The corresponding viruses thus showed an excellent selectivity profile when compared to previously described, p53-selective oncolytic viruses. However, it became apparent that complex viruses such as Ad-G4K-Sce had constitutively reduced lytic and replicative potency. This observation is most likely attributable to the complexity of genetic modifications or the large genome length which is critical for correct packaging of the virus and production of virus progeny.39 Therefore, genome structure and length should be carefully optimized in future studies to restore full replicative potency. Nevertheless, in our initial therapeutic simulations in murine xenograft models of human tumors we demonstrated that both I-Sce I-expressing viruses were able to inhibit tumor growth. We were also interested in the fate of viral DNA fragments that are produced upon I-Sce I-mediated virus cleavage. We observed that intramolecular religation by cellular DNA repair led not only to circularization of the excised E1-fragment but also, following release of the E1 region, to frequent religation of the adenovirus termini, a process that results in E1A-deleted and thus replication-deficient progeny. Although more detailed quantitative investigation is required, our data suggest that complete excision of the E1-fragment appeared to be a frequent event. This finding might be explained by the pseudocircular conformation of adenoviruses which allows for complete digestion of the viral genome before DNA repair takes place. Alternatively, if I-Sce I-induced DNA double strand breaks are immediately repaired, replication-competent, but I-Sce I resistant viruses harboring inactivated I-Sce I sites can be generated. We found evidence that those derivatives occur under strong p53-positive conditions. Prolonged quantitative monitoring is therefore required to determine the enrichment of noncleavable viruses in viral progeny to clarify the suitability of this approach for clinical applications. However, we found that I-Sce I-expressing viruses can be safely produced in 293 producer cells. Most important, the occurrence of cleavage resistant variants is a strong argument to use I-Sce-mediated self-cleavage in combination with E1A repression since the repressor function remains intact even when viruses are not longer sensitive to I-Sce I meditated cleavage.

The generation of intracellular fragments of virus DNA raises fundamental questions about a DNA damage response and immediate toxicity after infection of nontarget tissue. We found a strong correlation of DNA damage response with adenoviral replication but no correlation with I-Sce I-dependent DNA cleavage. Consequently, we observed no signs of aberrant cell death induction that could be attributed to I-Sce I-mediated DNA fragmentation. An open question is the role of the off-target activity of I-Sce I, which could provide acceptor sites where viral DNA fragments could be inserted into the genome of host cells. This is particularly critical when those fragments harbor potent transforming genes such as E1A and E1B55k. However, off-target activity of I-Sce I and associated genotoxicity seems to be relatively low in human cells. However, I-Sce I has already been used for insertional transgenesis in complex genomes such as from xenopus or arabidopsis thaliana40,41,42 although it has to be considered that these organisms actually contain natural I-Sce I sites in their genome. A potential transforming effect resulting from integration of an E1-fragment into the host cell's genome after I-Sce I-mediated virus fragmentation appears unlikely since E1-dependent gene activity would inevitably induce virus replication and final cell lysis.

As an important advantage, the I-Sce I-mediated self-cleavage concept circumvents the elaborate development of tailored nucleases for natural virus sites. Finally, the I-Sce I-mediated self-cleavage concept can be easily translated to other DNA viruses that have been successfully established as oncolytic agents such as herpes simplex or vaccinia virus.

In summary, we have shown that highly specific meganucleases represent an innovative and highly versatile method to generate oncolytic viruses with high-selectivity replication profiles.

Materials and Methods

Cell lines and culturing. A549, HepG2, H1299, Hep3B, 293, and primary human IMR-90-fibroblasts were obtained from ATCC (Rockville, MD). Huh-7 cells were obtained from JCRB (Osaka, Japan). HCT116 cells were kindly provided by B. Vogelstein (Baltimore, MD). A549shp53 cells were generated by lentiviral transduction of A549 cells using the lentiviral vector pLKO.1-shRp53 (Addgene no. 19119, kindly provided by RA Weinberg, Cambridge, MA; ref. 43). All cells were maintained in DMEM + Glutamax (Life Technologies, Paisley, UK) supplemented with 10% heat-inactivated FCS (Life Technologies), 100 units/ml penicillin and 100 mg/ml Streptomycin (Seromed) at 37°C in 5% CO2.

Plasmids and genetic construction. The I-Sce I expression plasmid pRK5.LHA was kindly provided by Tony Cathomen (Freiburg, Germany). Shuttle plasmids for the generation of recombinant adenovirus were constructed on the basis of the plasmid pHM3. pHM3-E1 was constructed by insertion of an E1A/E1B cassette coding for ΔN22-E1A. A minimal hTERT promoter as previously described was used for transcriptional control of E1A.14 At the 5' terminus of the promoter, a distal cluster of 15 × GAL4-binding sites was inserted to allow for targeted, GAL4-KRAB-mediated repression of E1A. Downstream of the promoter fragment an I-Sce I recognition site (TAGGGATAACAGGGTAAT) and five additional GAL4-binding sites were introduced. At the 3'-terminus of the E1B region (position 3539 according to the Ad5 genome) a 73 bp linker was inserted comprising a polyadenylation signal (AATAAA), an Nhe I cleavage site, and an inverted I-Sce I-recognition site (TAATGGGACAATAGGGAT). Further downstream, a p53-dependent expression cassette for I-Sce I or EGFP was inserted. The p53-responsive promoter prMinRGC and a corresponding prMinRGC-Luciferase reporter plasmid have been described previously.28 In additional virus constructs, the transcriptional repressor Gal4-KRAB was linked to I-Sce I or EGFP via an IRES motif. More details regarding the cloning procedures can be provided upon request. The resulting shuttle vectors Ad-Sce, Ad-EGFP, Ad-G4K-Sce, and Ad-G4K-EGFP were used for recombinant virus generation.

Recombinant adenovirus generation and preparation. Recombinant adenoviruses were constructed according to the method described by Mizuguchi and Kay.44 The adenoviral vectors Ad-Sce, Ad-EGFP, Ad-G4K-I-Sce, and Ad-G4K-EGFP were generated by ligating PI-Sce I/I-Ceu I fragments of shuttle vectors described above into pAdHM4. For the production of infectious particles the resulting plasmids were Pac I-digested and transfected into 293 cells. Transfected cells were incubated until a cytopathic effect became visible. Infectious particles were further amplified in 293 cells and then purified using Adpack20-Kit (Vivascience, Göttingen, Germany). Virus preparations were titered using the Rapid-Titer-Kit (Takara/Clontech, Mountain View, CA). To verify that virus preparations did not contain significant amounts of E1-deleted, replication-incompetent virus progeny, infectious titers were determined on both 293 cells (indicating both replication-competent and incompetent, E1-deleted viruses) and H1299 cells, which only indicate replication-competent viruses.

Investigation of adenoviral replication in the presence of I-Sce I. To generate a CD90.2 expression construct, the human CD4 gene in pMACS4.1 plasmid (Miltenyi Biotech, Bergisch Gladbach, Germany) was replaced by a murine CD90.2 orf (EcoRI, Hind III) resulting in the plasmid NW1333. A549 and Huh-7 cells were cotransfected with NW1333 and plasmids for expression of either EGFP or I-Sce I under control of a CMV-promoter. After overnight culture, transfected cells were superinfected with wild-type Adenovirus 5 at MOI 5 to achieve complete infection of the culture. After 24 hours, CD90.2 positive cells were separated by MACS using CD90.2 microbeads (Miltenyi Biotech) according to the manufacturer's protocol. After magnetic separation, cells were resuspended in fresh medium and cultured for additional 20 hours. To analyze viral amplification, cells were scraped in medium, viral progeny was released by three freeze/thaw cycles and infectious particles were determined by Rapid-Titer-Kit according to the manufacturer's protocol (Takara/Clontech).

Transfection and infection of IMR-90-fibroblasts. Transient knockdown of p53 in IMR-90 fibroblasts was performed by double transfection of the cells with siRNA using HiPerfect transfection reagent according to the manufacturer's protocol (Qiagen, Hilden, Germany). siRNAs Hs_TP53_9 and a negative control siRNA were also purchased from Qiagen. Six hours after last transfection, 5 × 105 IMR-90-fibroblasts were infected with viral particles at MOI 0.1. After an incubation period as indicated in the figure legends, total DNA was isolated using the QIAmp-DNA-Mini Kit (Qiagen) and subjected to quantitative PCR (qPCRTM Mastermix Plus; Eurogentec, Cologne, Germany) to determine the viral DNA-content. qPCR was performed with 100 ng of DNA using adenoviral hexon-specific primer probes as described before45 or the E1A-reverse primer CGAGGAGGCGGTTTCGCAGATT and E1B-forward primer CTAAGATATTGCTTGAGCCCGAGAGC for minicircle detection. As internal controls, the 18S-Genomic-Control-Kit (Eurogentec) was applied. To analyze viral amplification, cells were scraped in medium, viral progeny was released by three freeze/thaw cycles and infectious particles were determined by Rapid-Titer-Kit according to the manufacturer's protocol (Takara/Clontech).

Western blot analysis. Cell extracts for western blot analysis were prepared by lysing cells with a buffer containing 25 mM Tris-phosphate, 2 mM EDTA, 2 mM DTT, 10% glycerol, and 1% Triton X-100. 10–50 µg of proteins were separated by 10–15% SDS-PAGE and transferred to PVDF western blot membranes (0.45 µm Immobilon-P, Millipore, 0.2 µm Immun-Blot, Biorad). Equal loading was confirmed by actin blots. Specific proteins were detected using the following primary antibodies: HA-tag (A190-108A, Bethyl), EGFP (632375, BD Living Colors), Gal4-DNA-binding domain (sc-577, Santa Cruz), E1A (sc-430, Santa Cruz), Actin (sc-1615, Santa Cruz), and phospho-γH2AX (A300-081A, Bethyl). Horseradish-peroxidase-conjugated antibodies (AQ127P, Chemicon; 7074, Cell Signaling; sc-2056, Santa Cruz) were used as secondary antibodies. The Western-Lightning™ chemiluminescent-reagent Plus (Perkin-Elmer, Waltham, MA) was used for visualization.

Analyses of viral DNA religation products. For characterization of viral DNA products resulting from meganuclease cleavage, infected cell layers were washed with phosphate-buffered saline and harvested by lysis in a buffer containing 50 mM Tris-HCl (pH 8.0), 100 mM EDTA, 100 mM NaCl, 1% SDS, and proteinase K. DNA was precipitated using isopropanol, washed with 70% ethanol and resuspended in TE 8.0 buffer. Concentration and purity were determined by photometric measurement. Specific primer pairs were used for analytic PCR: E1A-reverse: CGAGGAGGCGGTTTCGCAGATT, E1B-forward–CTAAGATATTGCTTGAGCCCGAGAGC, hTert-forward: CTTCCTTTCCGCGGCCCCGC, prMin-reverse: AGCTTCGTCTCCAGGCGATCTGACG, the primers GAPDH_fw–ACAGTC CATGCCATCACTGCCACC, and GAPDH_rev–TGAGCTTGACAAAGTGGTCGTTGAGGG were used for loading control.

Real-time qPCR. Total RNA was isolated using peqGOLD-RNAPureTM (PeqLab, Erlangen, Germany), digested with DNase, and further purified using the RNeasy-Mini-Kit (Qiagen). 100 ng RNA was subjected to reverse transcription using random hexamer primer and TaqManTM Reverse Transcription Reagents (Applied Biosystems, Foster City, CA). cDNA was then used for quantification using SYBR-Green PCR Master Mix (Applied Biosystems) and 30 cycles with 15 seconds at 95°C and 60 seconds at 60°C after an initial step for 10 minutes at 95°C. The fluorescence signal was acquired at 60°C. Amplicon signals were normalized by GAPDH as internal control. Primer sequences for adenovirus and mouse genes were described previously.14

Oncolysis assays. Cells were seeded at a density of 1 × 105 into each well of a 24-well plate and cultured over night. Cells were then treated with 30 ng/ml Doxorubicin for 8 hours, subsequently infected with adenoviruses (MOI of 50, 5, 0.5, 0.05, 0.005, and 0.0005) and incubated for 8–11 days. A subsequent crystal violet staining allowed for visualizing the lytic destruction of the cell layers. Briefly, cells were fixed carefully with 10% formalin in phosphate-buffered saline for 10 minutes and then rinsed with water. Cells were stained with 0.1% crystal violet in 10% ethanol for 30 minutes. The plates were washed with water and air dried.

Detection of apoptosis. Induction of apoptosis was analyzed by Caspase-3 Activity Assay (Clontech). Briefly, cells were lysed in the assay buffer provided by the manufacturer, centrifuged, and the supernatant was retained as cellular extract. Caspase-3 substrate (Ac-DEVD-AFC) with or without the caspase inhibitor Ac-DEVD-CHO was added. Caspase-3 activity was measured in a fluorometer after 20 minutes and 80 minutes and fluorescence results were normalized against protein concentration.

Apoptotic cells were also identified and quantitated by Annexin-V/propidiumiodide staining. Ad-infected cells were harvested after 32 hours and stained with the Annexin V-APC Apoptosis Detection Kit (eBioscience, San Diego, CA) following the manufacturer's protocol. Stained cells were analyzed by FACS.

Animal experiments. All animal experimentation was performed according to the instructions for animal care and experimentation by the local authorities (TierSchG). Tumors were established by subcutaneous injection of 1 × 107 cells into the flanks of nude mice. Subcutaneous tumor nodules were grown to a size of ~200mm3 (Huh-7 tumors) before first virus application. For adenoviral infection, subcutaneous tumors were injected with 1 × 109 ifu of oncolytic virus or with vehicle only (100 µl serum-free medium). The injection was repeated after 7 days. In case of A549-derived tumors, mice received a single injection of 1 × 108 ifu in a volume of 30 µl when tumors had a size of about 100mm3. Six hours before injection mice were treated with 17.5 µg doxorubicin to activate p53. Tumor growth was monitored and the size was determined using a digital caliper. Tumor volume was determined using the equation: V (tumor) = (length × width2) / 2.

Statistics. Results of two treatment groups were compared for statistical significance by unpaired, two-tailed t-test using GraphPad Prism V3.02 software. P < 0.05 was considered statistically significant.

SUPPLEMENTARY MATERIAL Figure S1. I-Sce I expression in transfected cells leads to I-Sce I-mediated, targeted DNA cleavage as demonstrated by defined DNA rearrangments. Figure S2. Sequence analysis of the E1-minicircle PCR fragment, recovered from agarose gel.

Acknowledgments

This work was supported by the Deutsche Forschungsgemeinschaft [SFB-TRR77], Foundation of the German Economy [Stipend for P. Schache], Mildred Scheel-Foundation [Deutsche Krebshilfe, 109554], and the Wilhelm Sander-Foundation [2011.042.1]. All authors declare that there are no conflicts to disclose.

Supplementary Material

Supplementary Information
Click here for additional data file. (161KB, pdf)

References

  1. Russell SJ, Peng KW. Viruses as anticancer drugs. Trends Pharmacol Sci. 2007;28:326–333. doi: 10.1016/j.tips.2007.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Breitbach CJ, Burke J, Jonker D, Stephenson J, Haas AR, Chow LQ, et al. Intravenous delivery of a multi-mechanistic cancer-targeted oncolytic poxvirus in humans. Nature. 2011;477:99–102. doi: 10.1038/nature10358. [DOI] [PubMed] [Google Scholar]
  3. Park BH, Hwang T, Liu TC, Sze DY, Kim JS, Kwon HC, et al. Use of a targeted oncolytic poxvirus, JX-594, in patients with refractory primary or metastatic liver cancer: a phase I trial. Lancet Oncol. 2008;9:533–542. doi: 10.1016/S1470-2045(08)70107-4. [DOI] [PubMed] [Google Scholar]
  4. Diaz RM, Galivo F, Kottke T, Wongthida P, Qiao J, Thompson J, et al. Oncolytic immunovirotherapy for melanoma using vesicular stomatitis virus. Cancer Res. 2007;67:2840–2848. doi: 10.1158/0008-5472.CAN-06-3974. [DOI] [PubMed] [Google Scholar]
  5. Prestwich RJ, Errington F, Diaz RM, Pandha HS, Harrington KJ, Melcher AA, et al. The case of oncolytic viruses versus the immune system: waiting on the judgment of Solomon. Hum Gene Ther. 2009;20:1119–1132. doi: 10.1089/hum.2009.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Kishimoto H, Kojima T, Watanabe Y, Kagawa S, Fujiwara T, Uno F, et al. In vivo imaging of lymph node metastasis with telomerase-specific replication-selective adenovirus. Nat Med. 2006;12:1213–1219. doi: 10.1038/nm1404. [DOI] [PubMed] [Google Scholar]
  7. Qiao J, Kottke T, Willmon C, Galivo F, Wongthida P, Diaz RM, et al. Purging metastases in lymphoid organs using a combination of antigen-nonspecific adoptive T cell therapy, oncolytic virotherapy and immunotherapy. Nat Med. 2008;14:37–44. doi: 10.1038/nm1681. [DOI] [PubMed] [Google Scholar]
  8. Hallenbeck PL, Chang YN, Hay C, Golightly D, Stewart D, Lin J, et al. A novel tumor-specific replication-restricted adenoviral vector for gene therapy of hepatocellular carcinoma. Hum Gene Ther. 1999;10:1721–1733. doi: 10.1089/10430349950017725. [DOI] [PubMed] [Google Scholar]
  9. Wirth T, Zender L, Schulte B, Mundt B, Plentz R, Rudolph KL, et al. A telomerase-dependent conditionally replicating adenovirus for selective treatment of cancer. Cancer Res. 2003;63:3181–3188. [PubMed] [Google Scholar]
  10. Ramachandra M, Rahman A, Zou A, Vaillancourt M, Howe JA, Antelman D, et al. Re-engineering adenovirus regulatory pathways to enhance oncolytic specificity and efficacy. Nat Biotechnol. 2001;19:1035–1041. doi: 10.1038/nbt1101-1035. [DOI] [PubMed] [Google Scholar]
  11. Gürlevik E, Woller N, Schache P, Malek NP, Wirth TC, Zender L, et al. p53-dependent antiviral RNA-interference facilitates tumor-selective viral replication. Nucleic Acids Res. 2009;37:e84. doi: 10.1093/nar/gkp374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bilsland AE, Merron A, Vassaux G, Keith WN. Modulation of telomerase promoter tumor selectivity in the context of oncolytic adenoviruses. Cancer Res. 2007;67:1299–1307. doi: 10.1158/0008-5472.CAN-06-3000. [DOI] [PubMed] [Google Scholar]
  13. Hurtado Picó A, Wang X, Sipo I, Siemetzki U, Eberle J, Poller W, et al. Viral and nonviral factors causing nonspecific replication of tumor- and tissue-specific promoter-dependent oncolytic adenoviruses. Mol Ther. 2005;11:563–577. doi: 10.1016/j.ymthe.2004.10.021. [DOI] [PubMed] [Google Scholar]
  14. Gürlevik E, Woller N, Strüver N, Schache P, Kloos A, Manns MP, et al. Selectivity of oncolytic viral replication prevents antiviral immune response and toxicity, but does not improve antitumoral immunity. Mol Ther. 2010;18:1972–1982. doi: 10.1038/mt.2010.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Belfort M, Roberts RJ. Homing endonucleases: keeping the house in order. Nucleic Acids Res. 1997;25:3379–3388. doi: 10.1093/nar/25.17.3379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Silva G, Poirot L, Galetto R, Smith J, Montoya G, Duchateau P, et al. Meganucleases and other tools for targeted genome engineering: perspectives and challenges for gene therapy. Curr Gene Ther. 2011;11:11–27. doi: 10.2174/156652311794520111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Porteus MH, Carroll D. Gene targeting using zinc finger nucleases. Nat Biotechnol. 2005;23:967–973. doi: 10.1038/nbt1125. [DOI] [PubMed] [Google Scholar]
  18. Mussolino C, Cathomen T. TALE nucleases: tailored genome engineering made easy. Curr Opin Biotechnol. 2012;23:644–650. doi: 10.1016/j.copbio.2012.01.013. [DOI] [PubMed] [Google Scholar]
  19. Muñoz IG, Prieto J, Subramanian S, Coloma J, Redondo P, Villate M, et al. Molecular basis of engineered meganuclease targeting of the endogenous human RAG1 locus. Nucleic Acids Res. 2011;39:729–743. doi: 10.1093/nar/gkq801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Perez EE, Wang J, Miller JC, Jouvenot Y, Kim KA, Liu O, et al. Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat Biotechnol. 2008;26:808–816. doi: 10.1038/nbt1410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Monteilhet C, Perrin A, Thierry A, Colleaux L, Dujon B. Purification and characterization of the in vitro activity of I-Sce I, a novel and highly specific endonuclease encoded by a group I intron. Nucleic Acids Res. 1990;18:1407–1413. doi: 10.1093/nar/18.6.1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Anglana M, Bacchetti S. Construction of a recombinant adenovirus for efficient delivery of the I-SceI yeast endonuclease to human cells and its application in the in vivo cleavage of chromosomes to expose new potential telomeres. Nucleic Acids Res. 1999;27:4276–4281. doi: 10.1093/nar/27.21.4276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Cohen-Tannoudji M, Robine S, Choulika A, Pinto D, El Marjou F, Babinet C, et al. I-SceI-induced gene replacement at a natural locus in embryonic stem cells. Mol Cell Biol. 1998;18:1444–1448. doi: 10.1128/mcb.18.3.1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gao G, Zhou X, Alvira MR, Tran P, Marsh J, Lynd K, et al. High throughput creation of recombinant adenovirus vectors by direct cloning, green-white selection and I-Sce I-mediated rescue of circular adenovirus plasmids in 293 cells. Gene Ther. 2003;10:1926–1930. doi: 10.1038/sj.gt.3302088. [DOI] [PubMed] [Google Scholar]
  25. Lanson NA, Jr, Friedlander PL, Schwarzenberger P, Kolls JK, Wang G. Replication of an adenoviral vector controlled by the human telomerase reverse transcriptase promoter causes tumor-selective tumor lysis. Cancer Res. 2003;63:7936–7941. [PubMed] [Google Scholar]
  26. Huang TG, Savontaus MJ, Shinozaki K, Sauter BV, Woo SL. Telomerase-dependent oncolytic adenovirus for cancer treatment. Gene Ther. 2003;10:1241–1247. doi: 10.1038/sj.gt.3301987. [DOI] [PubMed] [Google Scholar]
  27. Kawashima T, Kagawa S, Kobayashi N, Shirakiya Y, Umeoka T, Teraishi F, et al. Telomerase-specific replication-selective virotherapy for human cancer. Clin Cancer Res. 2004;10 1 Pt 1:285–292. doi: 10.1158/1078-0432.ccr-1075-3. [DOI] [PubMed] [Google Scholar]
  28. Kühnel F, Gürlevik E, Wirth TC, Strüver N, Malek NP, Müller-Schilling M, et al. Targeting of p53-transcriptional dysfunction by conditionally replicating adenovirus is not limited by p53-homologues. Mol Ther. 2010;18:936–946. doi: 10.1038/mt.2009.298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Falck J, Coates J, Jackson SP. Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature. 2005;434:605–611. doi: 10.1038/nature03442. [DOI] [PubMed] [Google Scholar]
  30. Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM. A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol. 2000;10:886–895. doi: 10.1016/s0960-9822(00)00610-2. [DOI] [PubMed] [Google Scholar]
  31. Fernandez-Capetillo O, Chen HT, Celeste A, Ward I, Romanienko PJ, Morales JC, et al. DNA damage-induced G2-M checkpoint activation by histone H2AX and 53BP1. Nat Cell Biol. 2002;4:993–997. doi: 10.1038/ncb884. [DOI] [PubMed] [Google Scholar]
  32. Cuconati A, Mukherjee C, Perez D, White E. DNA damage response and MCL-1 destruction initiate apoptosis in adenovirus-infected cells. Genes Dev. 2003;17:2922–2932. doi: 10.1101/gad.1156903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Abou El Hassan MA, van der Meulen-Muileman I, Abbas S, Kruyt FA. Conditionally replicating adenoviruses kill tumor cells via a basic apoptotic machinery-independent mechanism that resembles necrosis-like programmed cell death. J Virol. 2004;78 22:12243–12251. doi: 10.1128/JVI.78.22.12243-12251.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Heise C, Sampson-Johannes A, Williams A, McCormick F, Von Hoff DD, Kirn DH. ONYX-015, an E1B gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat Med. 1997;3:639–645. doi: 10.1038/nm0697-639. [DOI] [PubMed] [Google Scholar]
  35. Urnov FD, Miller JC, Lee YL, Beausejour CM, Rock JM, Augustus S, et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature. 2005;435:646–651. doi: 10.1038/nature03556. [DOI] [PubMed] [Google Scholar]
  36. Holt N, Wang J, Kim K, Friedman G, Wang X, Taupin V, et al. Human hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted to CCR5 control HIV-1 in vivo. Nat Biotechnol. 2010;28:839–847. doi: 10.1038/nbt.1663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Cradick TJ, Keck K, Bradshaw S, Jamieson AC, McCaffrey AP. Zinc-finger nucleases as a novel therapeutic strategy for targeting hepatitis B virus DNAs. Mol Ther. 2010;18:947–954. doi: 10.1038/mt.2010.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Grosse S, Huot N, Mahiet C, Arnould S, Barradeau S, Clerre DL, et al. Meganuclease-mediated Inhibition of HSV1 Infection in Cultured Cells. Mol Ther. 2011;19:694–702. doi: 10.1038/mt.2010.302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Bett AJ, Prevec L, Graham FL. Packaging capacity and stability of human adenovirus type 5 vectors. J Virol. 1993;67:5911–5921. doi: 10.1128/jvi.67.10.5911-5921.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ogino H, McConnell WB, Grainger RM. High-throughput transgenesis in Xenopus using I-SceI meganuclease. Nat Protoc. 2006;1:1703–1710. doi: 10.1038/nprot.2006.208. [DOI] [PubMed] [Google Scholar]
  41. Pan FC, Chen Y, Loeber J, Henningfeld K, Pieler T. I-SceI meganuclease-mediated transgenesis in Xenopus. Dev Dyn. 2006;235:247–252. doi: 10.1002/dvdy.20608. [DOI] [PubMed] [Google Scholar]
  42. Kirik A, Salomon S, Puchta H. Species-specific double-strand break repair and genome evolution in plants. EMBO J. 2000;19:5562–5566. doi: 10.1093/emboj/19.20.5562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Godar S, Ince TA, Bell GW, Feldser D, Donaher JL, Bergh J, et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell. 2008;134:62–73. doi: 10.1016/j.cell.2008.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Mizuguchi H, Kay MA. Efficient construction of a recombinant adenovirus vector by an improved in vitro ligation method. Hum Gene Ther. 1998;9:2577–2583. doi: 10.1089/hum.1998.9.17-2577. [DOI] [PubMed] [Google Scholar]
  45. Zhang YA, Nemunaitis J, Samuel SK, Chen P, Shen Y, Tong AW. Antitumor activity of an oncolytic adenovirus-delivered oncogene small interfering RNA. Cancer Res. 2006;66:9736–9743. doi: 10.1158/0008-5472.CAN-06-1617. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
Click here for additional data file. (161KB, pdf)

Articles from Molecular Therapy are provided here courtesy of The American Society of Gene & Cell Therapy

RESOURCES