Abstract
The largest chromosome in the river buffalo karyotype, BBU1, is a submetacentric chromosome with reported homology between BBU1q and bovine chromosome 1 and between BBU1p and BTA27. We present the first radiation hybrid map of this chromosome containing 69 cattle derived markers including 48 coding genes, 17 microsatellites and four ESTs distributed in two linkage groups spanning a total length of 1330.1 cR5000. The RH map was constructed based on analysis of a recently developed river buffalo-hamster whole genome radiation hybrid (BBURH5000) panel. The retention frequency of individual markers across the panel ranged from 17.8% to 52.2%. With few exceptions, the order of markers within linkage groups is identical to the order established for corresponding cattle RH maps. The BBU1 map provides a starting point for comparison of gene order rearrangements between river buffalo chromosome 1 and its bovine homologs.
Introduction
As livestock, the river buffalo (Bubalus bubalis) plays an important role in the livestock world economy by contributing high quality milk and meat for human consumption. Despite its economic importance, the river buffalo genome is not as intensively studied as other livestock species, such as domestic cattle. Thus, genome mapping of river buffalo remains important for identification of genes affecting economic traits.
The karyotypes of buffalo and domestic cattle appear very similar at the level of chromosome arms. While the cattle genome consists of 29 acrocentric autosomes and a pair, X/Y, of sexual chromosomes, the river buffalo genome has 5 biarmed and 19 acrocentric autosomes plus the X and Y chromosomes. According to previous studies and this latest map, all buffalo chromosomes arms have homology to single bovine acrocentric chromosomes. Buffalo (BBU) chromosome 1 appears to be a fusion of Bos Taurus (BTA) chromosome 1 and 27, BBU 2 equals BTA2 and 23, BBU3 equals BTA8 and 19, BBU4 equals BTA5 and 28, and BBU5 equals BTA16 and 29 at the cytogenetic level with state of the art banding (El Nahas, et al., 2001; Ianuzzi et al., 2003). All the other chromosomes have a one to one correspondence between the two species. Assignment of genes to these buffalo chromosomes to date is consistent with the cytogenetics prediction.
The late reports regarding the river buffalo genome mapping (Ianuzzi et al., 2003; Di Meo et al., 2006), describes a total of 302 loci (180 of type I and 122 of type II) physically assigned to its genome. Of the 302 loci, 256 were mapped by in situ hybridization (254 by FISH), 15 by both FISH and somatic cell hybrid analysis and 33 by using only somatic cell hybrid analysis. BBU1, the largest of the five biarmed chromosomes in the river buffalo genome, has only 13 genes and 10 microsatellites assigned by FISH or somatic cell panel mapping (Iannuzzi et al. 2003; Di Meo et al. 2006). In contrast, the third generation bovine RH map includes 67 markers and 175 markers assigned to BTA27 and to BTA1, respectively (Everts-van der Wind et al. 2005). BTA27 is known to contain economic trait loci (ETLs) influencing clinical mastitis (Goldammer et al. 2004), and both bovine chromosomes contain quantitative trait loci (QTLs) affecting milk yield, as well as milk fat and protein content (Polineni et al. 2006).
Taking advantage of buffalo-bovine homologies and the extensive resources now available as a result of the bovine genome sequencing project, the goal of this study was to construct the first radiation hybrid (RH) map of BBU1 by utilizing markers chosen from BTA1 and BTA27.
Materials and methods
Sixty-nine markers (including coding genes, ESTs and microsatellites) identified on BTA1 and BTA27 from the previous publications were typed on the RH panel as described elsewhere (Amaral et al. 2007). Most of these markers appeared on at least one of the genome-wide linkage and RH maps (Ihara et al. 2004; Everts-van der Wind et al. 2004; 2005); the original source for each marker is listed in Table 1.
Table1.
Marker | Type | BBU1 linkage group |
BTA chr |
RF (%) |
Marker position distance cR |
Foward primer (5’-3’) | Reverse primer (3’-5’) | GenBank Acession | Reference/UNISTS ID | Tm (°C) |
---|---|---|---|---|---|---|---|---|---|---|
SH2D4A | gene | LG1 | 27 | 30.0 | placed | TGCTGAAACAGATCCTGTCG | GGACTCCTGTTTTTCCATCG | XM_582664 | new designed§ | 58 |
PLAT | gene | LG1 | 27 | 32.2 | 0.0 | AGACTTTGTCTGCCAGTGCC | CTCTCTGCCGTGCTCCAC | X85800 | 251598 | 65 |
HOOK3 | gene | LG1 | 27 | 30.0 | placed | CTAGGGCAGCAGATCAATGAC | CAGCACAGCCTAAAATGAGC | XM_602978 | new designed§ | 60 |
THAP1 | gene | LG1 | 27 | 28.8 | placed | AGAAGCTGAAGGAGGTGGTG | CACGCTGGGACTTCGACTAT | NM_001034648 | new designed§ | 58 |
ADAM2 | gene | LG1 | 27 | 28.8 | 20.5 | CTCTGCACTCCAGCACCATA | GGGCAATGGCATTTGTTAAT | NM_174228 | new designed§ | 58 |
BRF2 | gene | LG1 | 27 | 31.1 | 44.6 | TGAGCTCGTGGAAGACTCG | CGTCACTGAAGGTGGTCGTA | NM_001015582 | new designed§ | 58 |
CSSM036 | MS | LG1 | 27 | 34.4 | 52.4 | GGATAACTCAACCACACGTCTCTG | AAGAAGTACTGGTTGCCAATCGTG | U03827 | 250971 | 65 |
INRA134 | MS | LG1 | 27 | 34.4 | placed | CCAGGTGGGAATAATGTCTCC | TTGGGAGCCTGTGGTTTATC | X73125 | 250829 | 59 |
WRN | gene | LG1 | 27 | 35.5 | 90.8 | AACGCCATATATAGCAAGAC | GATCCAAAACAAAGCAAGAA | BE217410 | 279411 | 56 |
DCTN6 | gene | LG1 | 27 | 32.2 | 113.4 | CGTATGTGGGCAGAAATGTG | GCAGGCAGTCTCCACCATAG | NW_930571 | new designed§ | 58 |
NRG1 | gene | LG1 | 27 | 27.7 | 121.8 | ACGGAAAAAGCTTCATGACC | ACCAGCTGCACGTTCTCG | XM_592564 | new designed§ | 58 |
C8orf79 | EST | LG1 | 27 | 33.3 | 139.0 | TCTGAAAGTGAACAGCCAGGT | TGACGCCTATGGAGATGATG | AW632623 | new designed§ | 58 |
CNOT7 | gene | LG1 | 27 | 38.8 | 167.5 | CCACCCAGTTACAGCATTGA | GGAATATGTGACCAGACCAGAG | AW289341 | 278215 | 64 |
RM209 | MS | LG1 | 27 | 33.3 | 186.4 | GTAGAAGTTAGTGACTGTCATCC | CCTCAGAGCCCCATACATTTCC | U32921 | 250931 | 65 |
MTNR1A | gene | LG1 | 27 | 34.4 | placed | TTTCAACAGCTGCCTCAATG | GGAGAGGGTTTGCGTTTAAT | U73327 | 278796 | 61 |
SLC25A4 | gene | LG1 | 27 | 34.4 | 199.6 | CATTGATTGCGTGGTGAGAA | ATAATGATGCCCTGGACCGA | M24102 | Li and Womack, 1997 | 65 |
BM1856 | MS | LG1 | 27 | 38.8 | 215.2 | GGCCTCAAGTTTCATCCATG | CATCAGCATGAAGCAACCC | G18402 | 53060 | 65 |
ODZ3 | gene | LG1 | 27 | 33.3 | 233.8 | TGACCAACGTGACATTTCCA | TTGAACCATGGTGTAGAACGA | XM_865074 | new designed§ | 58 |
CARF | gene | LG1 | 27 | 27.7 | 257.5 | AGCACTGCCTCTCAGGTGAC | CGATCCACTTTGTTGTCTGG | XM_590926 | new designed§ | 58 |
DEFB1 | gene | LG1 | 27 | 30.0 | 285.4 | GGAAGACAGGAAGGCCTCTGG | CCTCACGTTTTCAGAACCAC | NW_001501821 | 251704 | 64 |
BM6526 | MS | LG1 | 27 | 37.7 | 317.3 | CATGCCAAACAATATCCAGC | TGAAGGTAGAGAGCAAGCAGC | G18454 | 28213 | 65 |
TGLA179 | MS | LG1 | 27 | 40.0 | placed | CTTTAATCAGCACACAGCTTCCCA | ATATGTGCTAGAAGTTTGGTCAACC | CM000203 | 251232 | 65 |
BMS1001 | MS | LG1 | 27 | 42.2 | 327.1 | GAGCCAATTCCTACAATTCTCTT | AGACATGGCTGAAATGACTGA | G18605 | 44386 | 65 |
DLGAP2 | gene | LG1 | 27 | 42.2 | 359.4 | CGGACCTCCATCCACTCC | CGTCCCTGCTGTCATAGTGG | XM_600714 | new designed§ | 58 |
CLN8 | gene | LG1 | 27 | 46.6 | 369.0 | CCCTTCATGTGTCCAATGC | ATCCAGGAGATGCAGGTGAA | XM_609353 | new designed§ | 58 |
IFNAR1 | gene | LG1 | 1 | 37.7 | 441.6 | TGAAGATAAGGCAATAATAC | TGAAGAGTTTTTCCAGATAA | BE217555 | 279374 | 54 |
AW267109 | EST | LG1 | 1 | 45.5 | 462.7 | ATGAAAGTCTTCTGTGCCATGC | TCAGTATTGCCACATGACATGC | AW267109 | 278038 | 60 |
IFNGR2 | gene | LG1 | 1 | 51.1 | 472.2 | AGACAAAGGCACAGCATTCCAC | GATTTCAAAGGGAGAGCTGGGT | AW289292 | 278555 | 60 |
BM6438 | MS | LG1 | 1 | 52.2 | placed | TTGAGCACAGACACAGACTGG | ACTGAATGCCTCCTTTGTGC | G18435 | 79562 | 63 |
ADAMTS1 | gene | LG1 | 1 | 45.5 | placed | CGACACAAGAGAGGAAAGATGG | CATCACTTTACCCGCTGCTATG | AW428596 | 277932 | 60 |
C21orf45 | EST | LG1 | 1 | 47.7 | placed | CCACCAAGGAAATCCAGCATAC | TATCCAAGTCACCTCCAGGTCA | AW463565 | 278143 | 60 |
KRTAP8 | gene | LG1 | 1 | 46.6 | 503.2 | TTGCTGAAATACCAGAGGCA | ATGACAAGAGTCATGAGCATGG | Harlizius et al, 1997 | 59 | |
TGLA49 | MS | LG1 | 1 | 50.0 | 520.3 | GGCAGGACTTCACTCTTTTTCA | AGAAAAGGAATAATGAGACAGATTA | CM000177 | 239049 | 56 |
SOD1 | gene | LG1 | 1 | 35.5 | 546.7 | GTTTGGCCTGTGGTGTAATTGGAA | GGCCAAAATACAGAGATGAATGAA | NM_174615 | Barendse et al, 1994 | 56 |
PRSS7 | gene | LG1 | 1 | 34.4 | 619.0 | CCAAGGTTCACAGAGTGGAT | GGCTTGTGACATGAGCTTAC | U09859 | 278971 | 65 |
RM095 | MS | LG1 | 1 | 41.1 | 637.5 | TCCATGGGGTCGCAAACAGTGG | ATCCCTCCATTTGTTGTGGAGTT | U32918 | 250928 | 58 |
STCH5 | gene | LG1 | 1 | 38.8 | 652.8 | TGATCTTCAGAACACGTCATAC | GTGAATGAATGTTTGGTGTCAG | AW267080 | 279153 | 56 |
ROBO2 | gene | LG1 | 1 | 27.7 | placed | GAATTGGCTGTCGATCTG | ACCTTTGTTCTGATCAGG | AW653888 | 279030 | 50 |
POU1F1 | gene | LG1 | 1 | 34.4 | 710.1 | GGCTGAAGAACTAAACCTGGAG | TAGGAGAGCCTATCTGCATTCG | X12657 | 278932 | 52 |
PROS1 | gene | LG1 | 1 | 30.0 | 730.1 | GTACAGGTGGATTTGGATGAAG | GAGAGCAACAGAGGTAAGAACA | X12891 | 278968 | 52 |
ESDN | gene | LG1 | 1 | 26.6 | 744.5 | ATTGGGCTAGACCGTGCATA | GGAACCAGCACAGTTAAAGG | AW314878 | 278348 | 65 |
DOC1 | gene | LG1 | 1 | 33.3 | 761.6 | TTCACCAAGACAAGTTGCAG | CCCTTCCTTATCCGGTTTAT | AW289233 | 278315 | 58 |
ALCAM | gene | LG1 | 1 | 28.8 | placed | CTGGAGAGCAGAACATGGGAAA | TATCCAGGCACTGATCCACTGA | X73801 | 277962 | 65 |
TGLA57 | MS | LG1 | 1 | 30.0 | 802.2 | GCTTTTTAATCCTCAGCTTGCTG | GCTTCCAAAACTTTACAATATGTAT | CM000177 | 250987 | 56 |
BBX | gene | LG1 | 1 | 34.4 | 812.9 | CCAGTGAAGCGCCCTTTAAT | ACCACATGGACTCACTAGCATC | AW428450 | 278098 | 65 |
LOC151584 | EST | LG1 | 1 | 30.0 | 823.6 | ACCAATGCTGCCTGCTAACT | ACTCCAGGCCTTGCATGAAT | AW352867 | 278663 | 65 |
TACTILE | gene | LG1 | 1 | 20.0 | 849.5 | TTGTAGACTGCACTGGTGGAAC | GGAGTCCATTGGAAGTGATCTG | AW289280 | 279172 | 65 |
BMS527 | MS | LG1 | 1 | 25.5 | 904.2 | TCAGTGAAAGCAAGAGAAATATCC | TCCATTCCCTTTGAATATCCC | G18871 | 65219 | 60 |
BM1312 | MS | LG1 | 1 | 30.0 | 921.8 | CCATGTGCTGCAACTCTGAC | GGAATGTTACTGAACCTCTCCG | G18434 | 30885 | 54 |
BMS4030 | MS | LG1 | 1 | 30.0 | 938.8 | TGTACCCAACACAGGAGCAC | TGACAGAGGGACCCATATCC | G19083 | 74568 | 65 |
CASR | gene | LG1 | 1 | 23.3 | 964.3 | CGGTGTGCTTCTGTGGTTAGGT | CAGGCTGTCTGCAAAGTTCAGG | S67307 | 278154 | 65 |
PDIR | gene | LG1 | 1 | 24.4 | 983.6 | AACTGTGGTTTGCGGAGAATAC | GAAAGTTGACCTGAGTGCAAAG | AW289373 | 278896 | 64 |
TRAD | gene | LG1 | 1 | 30.0 | 1004.7 | GCGAGGAAAGGATAAAATC | ACATTTTTCCAGTTCACC | AW353439 | 279211 | 62 |
APOD | gene | LG1 | 1 | 26.6 | 1025.4 | GAAGATCCCAGTGAGCTTTG | ATCAGCTCTCAGCTCCTTGT | AW357610 | 277980 | 51 |
PPP1R2 | gene | LG1 | 1 | 26.6 | 1025.4 | GCATCACTGCTGAATTTCAGAC | GTCAGTGTTCAGTTCTAGCCAA | AW315482 | 278944 | 64 |
BM6506 | MS | LG1 | 1 | 26.6 | 1057.4 | GCACGTGGTAAAGAGATGGC | AGCAACTTGAGCATGGCAC | G18455 | 47201 | 63 |
AHSG | gene | LG1 | 1 | 27.7 | 1065.9 | GTCCCAACTTCTCATCCTTCCA | GGCAAGAGCACCTTTCAAAGTC | X16577 | 277947 | 60 |
TLOC1 | gene | LG1 | 1 | 20.0 | 1118.9 | CATAGCAGTTCTCCTGATCTGA | GTGATCTTTCTACAGCAGCTTC | AW289224 | 279200 | 65 |
IL12A | gene | LG2 | 1 | 22.2 | placed | AAAGTCAAGCTCTGCATCCT | GTTATGAGAGACCTCAGCATTC | U14416 | 278561 | 58 |
SR140 | gene | LG2 | 1 | 17.8 | 0.0 | TACTACTGCCAGCAGATCCA | CTGCATCTGTAGACCTGTTG | AW289396 | 279143 | 58 |
RNF7 | gene | LG2 | 1 | 24.4 | 39.6 | CCTGTTCCCTGGTCCAAACTTA | GGAGTTATTGAAGCGGTTCCGT | AW428600 | 279028 | 65 |
FOXL2 | gene | LG2 | 1 | 25.5 | 63.0 | TCCTCCGGACGACACACTACAA | GAAATGTGAAACCCGGCAGCAG | AW267121 | 278443 | 65 |
CSSM019 | MS | LG2 | 1 | 23.3 | placed | TTGTCAGCAACTTCTTGTATCTTT | TGTTTTAAGCCACCCAATTATTTG | U03794 | 251074 | 59 |
NCK1 | gene | LG2 | 1 | 25.5 | 75.6 | CGCTCTTCTCTTGCTTCTAA | TGCAGAAGTAACTAAGGTGG | AW425735 | 278818 | 58 |
MX1 | gene | LG2 | 1 | 20.0 | 109.2 | CCGTAGTCTCTGCTGTCTCTTA | GGAATGACCCTTCTACAGTGCT | U88329 | 278800 | 65 |
CRYAA | gene | LG2 | 1 | 27.7 | 134.1 | CCTAGAAAGTGGGGCATCCAT | GGTCACTCTGAGGTCTTTGCA | NM_174289 | Barendse et al, 1994 | 64 |
HLCS | gene | LG2 | 1 | 27.7 | 152.7 | TGAGCAGTGGCTGCGTTTAT | AACAGCTTCTCCTCCGTGAATC | AW354578 | 278525 | 61 |
CBR1 | gene | LG2 | 1 | 22.2 | 168.9 | CCCTGAACTGCAGCAGAAATTG | CCCGTTCTTTGTGTCTTCCA | AW461769 | 278157 | 61 |
BMS2263 | MS | LG2 | 1 | 23.3 | 211.2 | AACCCAGTCAACCAGCAAAG | CACCCCAGCCATCACTTC | G18934 | 2985 | 65 |
MS – Microsatellite
EST – Expressed Sequence Tag
New designed primers from known cattle ESTs.
Briefly, PCR reactions were performed in a MJ Research PTC-200 thermocycler with thermal gradient software. The markers were scored after amplification of DNA from the 90 radiation hybrid cell lines and control buffalo and hamster DNA. PCR mixtures included: 10mM Tri-HCl, 1.5 mM MgCl2, 50mM KCl, pH 8.3 (20°C), 10 mM dNTPs, 0.2 mM each primer, 0.5 unit of AmpliTaq Gold polymerase (Perkin Elmer Applied Biosystems, Foster City, CA) and 50ng DNA in a 10μl-volume. The PCR conditions were as follows: initial denaturation at 94°C for 10 min, followed by 35 cycles at 94°C for 30 sec (denaturation), 50 to 65°C for 30 sec (annealing - according with the primer pair), extension at 72°C for 30 sec and a final extension at 72°C for 7 minutes.
The PCR products were electrophoresed through 2% agarose gels in 1.0X TBE buffer containing ethidium bromide, and photographed under UV light. PCR products were scored as 1 for present, 0 for absent, or 2 for ambiguous amplification. All primer sets were typed twice with the RH panel DNA and scored independently, in order to increase the accuracy of the results. Primer pairs that showed ambiguous results were typed a third time.
The BBU1 RH map construction was performed by using the software rh_tsp_map, version 3.0 (Schäffer et al. 2007) and CONCORDE (Applegate et al. 1998) linked to QSopt (http://www2.isye.gatech.edu/~wcook/qsopt/). We used the maximum likelihood criterion and our framework maps are called “MLE-consensus” maps because the markers are chosen so that the optimal order is the same for three variants of the MLE criterion that differ in the treatment of uncertain (coded as 2) entries in the RH vectors (Agarwala et al. 2000). The software distribution of rh_tsp_map tutorial (ftp://ftp.ncbi.nih.gov/pub/agarwala/rhmapping/rh_tsp_map.tar.gz) includes a tutorial describing the steps that can be used to construct a map for markers typed on a single or multiple panels. For the construction of the BBU1 map, we followed all the steps from “Preparing files” through “Placing additional markers” for making a map, but we did not proceed further to assign cR positions to the placed markers because this is a coarse map. Considering the number of markers, linkage groups were made using a pairwise LOD score threshold of 5.5.
Results and Discussion
The newly constructed BBU1 RH map (Figure 1) contained markers distributed within two linkage groups. Linkage group 1 (LG1; spanning 1118.9 cR) included a total of 58 markers (39 coding genes, 15 microsatellites and four ESTs) spanning the entire short arm and extending across much of the long arm, with 47 markers placed as framework and 11 markers placed in bins. The second linkage group (LG2; spanning 211.2 cR) included 11 markers (nine coding genes and two microsatellites) covering the remaining portion of the BBU1 long arm with 9 framework markers and two placed in bins.
Of the 69 markers typed on the BBURH5000 panel, APOD and PPP1R2 had the same RH vector and were placed at the same position. Retention frequencies (RF) for all mapped markers ranged from 17.8% (SR140) to 52.2% (BM6438). Additional information about mapped markers, including their RF and cR position on the map is compiled in Table 1.
Because no other river buffalo linkage maps are currently available, we compared the mapped order of the markers from this new BBU1 RH map to the current bovine genome assembly (build 3.1) of chromosomes BTA1 and BTA27. The markers SLC25A4, PLAT, BM6526, DEFB1, KRTAP8, SOD1, AHSG from LG1 and the markers NCK1 and CRYAA from LG2 were also compared to their positions previously assigned by FISH (Iannuzzi et al. 2003), serving as anchor markers for the BBU1 RH map. As indicated on Figure 1, eleven inversions on the gene order were observed, including one disagreement with the order of FISH assigned markers and one inversion not supported by the map in (Everts-van der Wind et al. 2005).
This first RH map from BBU1, including 48 coding genes and 4 ESTs, is the starting point for the construction of a high resolution comparative map for this river buffalo chromosome. With our data we were able to generate a large linkage group (LG1) including markers from both bovine homologs (BTA27 and BTA1) spanning most of BBU1. The number of observed disagreements in the gene order positions among our RH map and the bovine sequence and the river buffalo cytogenetic assignment may contribute to improved maps for buffalo as well as maps for other members of the Bovidae family.
Acknowledgments
This work was funded by grants from FAPESP-Brazil (02/10150-5) to MEJA and NSF-USA (OISE-0405743) to JEW. This research was supported in part by the Intramural Research Program of the NIH, NLM.
References
- Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA. A fast and scalable radiation hybrid map construction and integration strategy. Genome Res. 2000;10:350–364. doi: 10.1101/gr.10.3.350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amaral MEJ, Owens KE, Elliott JS, Fickey C, Agarwala R, Schäffer AA, Womack JE. Construction of a river buffalo (Bubalus bubalis) whole-genome radiation hybrid panel and preliminary RH mapping of chromosomes 3 and 10. Anim Genet. doi: 10.1111/j.1365-2052.2007.01587.x. accepted for publication. [DOI] [PubMed] [Google Scholar]
- Applegate D, Bixby R, Chvátal V, Cook W. The traveling salesman problem: A computational study. Princeton university press; Princeton: 2006. [Google Scholar]
- Barendse W, Armitage SM, Kossarek LM, Shalom A, Kirkpatrick BW, Ryan AM, Clayton D, Li L, Neibergs HL, Zhang N, Grosse WM, Weiss J, Creighton P, McCarthy F, Ron M, Teale AJ, Fries R, McGraw RA, Moore SS, Georges M, Soller M, Womack JE, Hetzel DJS. A genetic linkage map of the bovine genome. Nature Genet. 1994;6:227–235. doi: 10.1038/ng0394-227. [DOI] [PubMed] [Google Scholar]
- Di Meo GP, Gallagher D, Perucatti A, Wu X, Incarnato D, Mohammadi G, Taylor JF, Iannuzzi L. Mapping of 11 genes by FISH to BTA2, BBU2q, OAR2q and CHI2, and comparison with HSA2q. Animal Genetics. 2006;37:299–300. doi: 10.1111/j.1365-2052.2006.01444.x. [DOI] [PubMed] [Google Scholar]
- Dorroch U, Goldammer T, Brunner RM, Kata SR, Kühn C, Womack JE, Schwerin M. Isolation and characterization of hepatic and intestinal expressed sequence tags potentially involved in trait differentiation between cows of different metabolic type. Mamm Genome. 2001;12:528–537. doi: 10.1007/s003350020031. [DOI] [PubMed] [Google Scholar]
- Drögemüller C, Wöhlke A, Leeb T, Distl O. A 4 Mb high resolution BAC contig on bovine chromosome 1q12 and comparative analysis with human chromosome 21q22. Comp Func Genomics. 2005;6:194–203. doi: 10.1002/cfg.476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- El Nahas SM, Oraby HA, de Hondt HA, Medhat AM, Zahran MM, Mahfouz ER, Karim AM. Synteny mapping in river buffalo. Mamm Genome. 1996;7:831–834. doi: 10.1007/s003359900245. [DOI] [PubMed] [Google Scholar]
- Everts-van der Wind A, Kata SR, Band MR, Rebeiz M, Larkin DM, Everts RE, Green CA, Liu L, Natarajan S, Goldammer T, Lee JH, McKay S, Womack JE, Lewin HA. A 1463 gene cattle-human comparative map with anchor points defined by human genome sequence coordinates. Genome Res. 2004;14:1424–1437. doi: 10.1101/gr.2554404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Everts-van der Wind A, Larkin DM, Green CA, Elliott JS, Olmstead CA, Chiu R, Schein JE, Marra MA, Womack JE, Lewin HA. A high-resolution whole-genome cattle-human comparative map reveals details of mammalian chromosome evolution. Proc Natl Acad Sci USA. 2005;102:18526–18531. doi: 10.1073/pnas.0509285102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goldammer T, Kata SR, Brunner RM, Kühn C, Weikard R, Womack JE, Schwerin M. High-resolution comparative mapping between human chromosomes 4 and 8 and bovine chromosome 27 provides genes and segments serving as positional candidates for udder health in cattle. Genomics. 2004;84:696–706. doi: 10.1016/j.ygeno.2003.12.003. [DOI] [PubMed] [Google Scholar]
- Goldammer T, Brunner RM, Weikard R, Kuehn C, Wimmers K. Generation of an improved cytogenetic and comparative map of Bos Taurus chromosome BTA27. Chromosome Res. 2007 doi: 10.1007/s10577-006-1113-y. http://www.springerlink.com/content/r0213020426m50j5/ [DOI] [PubMed]
- Harlizius B, Tammen I, Eichler K, Eggen A, Hetzel DJS. New markers on bovine chromosome 1 are closely linked to the polled gene in Simmental and Pinzgauer cattle. Mamm Genome. 1997;8:255–257. doi: 10.1007/s003359900404. [DOI] [PubMed] [Google Scholar]
- Iannuzzi L, Di Meo GP, Perucatti A, Schibler L, Incarnato D, Gallagher D, Eggen A, Ferretti L, Cribiu EP, Womack J. The river buffalo (Bubalus bubalis, 2n = 50) cytogenetic map: assignment of 64 loci by fluorescence in situ hybridization and R-banding. Cytogenet Genome Res. 2003;102:65–75. doi: 10.1159/000075727. [DOI] [PubMed] [Google Scholar]
- Ihara N, Takasuga A, Mizoshita K, Takeda H, Sugimoto M, Mizoguchi Y, Hirano T, Itoh T, Watanabe T, Reed KM, Snelling WM, Kappes SM, Beattie CW, Bennett GL, Sugimoto Y. A comprehensive genetic map of the cattle genome based on 3802 microsatellites. Genome Res. 2004;14:1987–1998. doi: 10.1101/gr.2741704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kappes SM, Keele JW, Stone RT, McGraw RA, Sonstegard TS, Smith TP, Lopez-Corrales NL, Beattie CW. A second-generation linkage map of the bovine genome. Genome Res. 1997;7:235–249. doi: 10.1101/gr.7.3.235. [DOI] [PubMed] [Google Scholar]
- Kossarek LM, Grosse WM, Finlay O, Barendse W, Hetzel DJ, McGraw RA. Rapid communication: bovine dinucleotide repeat polymorphism RM209. J Anim Sci. 1994;72:528. doi: 10.2527/1994.722528x. [DOI] [PubMed] [Google Scholar]
- Li L, Womack JE. Somatic cell mapping of the adenine nucleotide translocator gene family in cattle. Mamm Genome. 1997;8:773–774. doi: 10.1007/s003359900564. [DOI] [PubMed] [Google Scholar]
- Polineni P, Aragonda P, Xavier SR, Furuta R, Adelson DL. The bovine QTL viewer: a web accessible database of bovine Quantitative Trait Loci. BMC Bioinformatics. 2006;7:283. doi: 10.1186/1471-2105-7-283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schäffer AA, Rice ES, Cook W, Agarwala R. rh_tsp_map 3.0: End-to-end radiation hybrid mapping with improved speed and quality control. Bioinformatics. doi: 10.1093/bioinformatics/btm077. to appear. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sonstegard TS, Garrett WM, Ashwell MS, Bennett GL, Kappes SM, Van Tassell CP. Comparative map alignment of BTA27 and HSA4 and 8 to identify conserved segments of genome containing fat deposition QTL. Mamm Genome. 2000;11:682–688. doi: 10.1007/s003350010130. [DOI] [PubMed] [Google Scholar]
- Wunderlich KR, Abbey CA, Clayton DR, Song Y, Schein JE, Georges M, Coppieters W, Adelson DL, Taylor JF, Davis SL, Gill CA. A 2.5-Mb contig constructed from Angus, Longhorn and horned Hereford DNA spanning the polled interval on bovine chromosome 1. Anim Genet. 2006;37:592–594. doi: 10.1111/j.1365-2052.2006.01538.x. [DOI] [PubMed] [Google Scholar]