Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2013 Jun 17;591(Pt 18):4621–4635. doi: 10.1113/jphysiol.2013.251421

Physical activity is associated with retained muscle metabolism in human myotubes challenged with palmitate

C J Green 1, T Bunprajun 1, B K Pedersen 1, C Scheele 1
PMCID: PMC3784203  PMID: 23774280

Abstract

The aim of this study was to investigate whether physical activity is associated with preserved muscle metabolism in human myotubes challenged with saturated fatty acids. Human muscle satellite cells were isolated from sedentary or active individuals and differentiated into myocytes in culture. Metabolic differences were then investigated in the basal state or after chronic palmitate treatment. At basal, myocytes from sedentary individuals exhibited higher CD36 and HSP70 protein expression as well as elevated phosphorylation of c-Jun NH2-terminal kinase (JNK) and insulin receptor substrate 1 (IRS1) serine307 compared to myocytes from active individuals. Despite equal lipid accumulation following palmitate treatment, myocytes from sedentary individuals exhibited delayed acetyl coenzyme A carboxylase phosphorylation compared to the active group. Myocytes from sedentary individuals had significantly higher basal glucose uptake and palmitate promoted insulin resistance in sedentary myocytes. Importantly, myocytes from active individuals were partially protected from palmitate-induced insulin resistance. Palmitate treatment enhanced IRS1 serine307 phosphorylation in myocytes from sedentary individuals and correlated positively to JNK phosphorylation. In conclusion, muscle satellite cells retain metabolic differences associated with physical activity. Physical activity partially protects myocytes from fatty acid-induced insulin resistance and inactivity is associated with dysregulation of metabolism in satellite cells challenged with palmitate. Although the benefits of physical activity on whole body physiology have been well investigated, this paper presents novel findings that both diet and exercise impact satellite cells directly. Given the fact that satellite cells are important for muscle maintenance, a dysregulated function could have profound effects on health. Therefore the effects of lifestyle on satellite cells needs to be delineated.

Key points

  • It is known that saturated fatty acids play a role in the progression of insulin resistance in skeletal muscle while physical activity promotes insulin sensitivity.

  • The effect of diet and exercise on muscle satellite/stem cells is not well defined: we found that differentiated human muscle satellite cells exhibit metabolic differences. These differences were associated with physical activity level and may reflect a memory of the in vivo environment.

  • Differentiated muscle satellite cells from physically active individuals have a higher tolerance to saturated fatty acids reflected by a partial protection from fatty acid-induced insulin resistance.

  • Physical activity and diet have significant effects on the physiological function of differentiated human muscle satellite cells. As these cells exhibit some phenotypes associated with in vivo adaptations and are involved in muscle maintenance, dysregulatory function could have profound effects on health.

Introduction

The prevalence of type 2 diabetes has increased significantly over the last decade and has been largely attributed to an increasingly sedentary lifestyle (Kolb & Mandrup-Poulsen, 2010; Thyfault & Booth, 2011). It has been well documented that physical inactivity increases the risk of type 2 diabetes (Tuomilehto et al. 2001), cardiovascular disease (Nocon et al. 2008), and some cancers (Monninkhof et al. 2007; Wolin et al. 2009) Additionally, a lifetime of physical inactivity has been shown to interact with secondary ageing: ageing associated with disease or environmental factors (Holloszy, 2000). Loss of insulin sensitivity in skeletal muscle is the initial step in the development of type 2 diabetes and this has been shown to be sensitive to physical activity level (Soman et al. 1979). Skeletal muscle is the main target of insulin resistance and it is therefore important to understand the molecular mechanisms involved in inactivity-induced insulin resistance. Seven days of bed rest has been shown to induce insulin resistance in young males and was accompanied by reduced glucose transporter 4 (GLUT4) and Akt protein levels and decreased insulin sensitivity at the level of Akt phosphorylation (Biensøet al. 2012). We and others have shown that muscle satellite cells retain a ‘memory’ of their environment (Gaster et al. 2001, 2002; Bouzakri et al. 2003; Green et al. 2011b; Scheele et al. 2012; Broholm et al. 2012). Muscle satellite cells act as stem cells and have been shown to be important for muscle regeneration following injury (Robson et al. 2011; Alfaro et al. 2011; Sambasivan et al. 2011). However, the effects of physical inactivity/activity have not been investigated in this model system. In order to address this we isolated satellite cells from lifelong sedentary males or extremely active males and measured the effects of physical activity level on the metabolism of these cells.

In addition to activity level, poor diet and obesity have also been shown to promote chronic diseases such as cardiac disease and type 2 diabetes. More specifically, sustained over-supply of saturated non-esterified ‘free-fatty acids’ leads to skeletal muscle lipotoxicity and have been suggested to promote skeletal muscle insulin resistance (Green et al. 2011a). Therefore, type 2 diabetes is known as a ‘lifestyle’ disease and has been associated with metabolic inflexibility: a reduced capacity to increase fatty acid oxidation upon increased fatty acid availability and to switch between fuel sources following a meal (Kelley et al. 2002; Galgani et al. 2008). The concept of metabolic inflexibility was first proposed by Kelley et al. (2002) and there is much evidence in the literature to suggest that physical inactivity is a primary cause of metabolic inflexibility (Stein & Wade, 2005; Stettler et al. 2005). The hypothesised mechanism by which inactivity promotes metabolic inflexibility is unclear. Additionally many studies have been carried out in bed rest studies (Biensøet al. 2012; Friedrichsen et al. 2012; Brocca et al. 2012) and therefore do not reflect the normal living or low levels of ambulatory activity seen in sedentary people. In order to investigate the effects of physical inactivity on muscle metabolism we used human muscle satellite cells from the same individuals as described above and chronically treated them with the saturated fatty acid palmitate and measured the effects of this on markers of fat metabolism and insulin sensitivity.

Methods

Subjects

This study was performed in accordance with the Declaration of Helsinki and approved by the Ethical Committee of Copenhagen and Frederiksberg Communities, Denmark (H-4-2010-111). Skeletal muscle biopsies from the vastus lateralis were obtained by the percutaneous needle biopsy method from 10 men. The active group was defined as those who ran 50 km per week or had completed ten marathons (2 within the last year) and the sedentary group those who have led an inactive lifestyle for the past 10 years, and performed no more than one hour of exercise per week for the past 5 years. The groups were matched for body mass index (BMI) and age; clinical characteristics can be found in Table 1. All subjects were healthy, non-smokers and did not take any heart medication. All volunteers gave their written informed consent before participation.

Table 1.

Clinical characteristics of subjects from whom muscle precursor cells were isolated

Sedentary (n= 5) Active (n= 5)
Age (years) 51.2 ± 3.7 49.8 ± 3.2
BMI (kg m−2) 24.76 ± 0.97 24.32 ± 0.68
Inline graphic (l min−1) 3.37 ± 0.22*** 4.57 ± 0.32
Inline graphic (ml kg−1 min−1) 39.21 ± 2.63*** 56.43 ± 3.01
Fasting glucose (mmol l−1) 5.08 ± 0.07* 4.86 ± 0.14
OGTT 2 h glucose (mmol l−1) 6.44 ± 0.66 5.64 ± 0.88
Fasting insulin (μU ml−1) 40.8 ± 11.9 29 ± 9.4
Open in a new tab

Values are means ± SEM. BMI, body mass index; OGTT, oral glucose tolerance test; Inline graphic, maximal oxygen uptake. Asterisks indicate a significant difference from Active group (*P < 0.05, ***P < 0.0005).

Materials

Ham's nutrient mixture (F10), Dulbecco's modified Eagle's medium (DMEM, low and high glucose), fetal bovine serum (FBS), horse serum (HS), fungizone antimycotic (FZ) and penicillin/streptomycin (P/S) were all from Invitrogen (Taastrup, Denmark). Human insulin (Actrapid) was purchased from Novo Nordisk (Bagsværd, Denmark). Complete (mini) protein phosphatase inhibitor tablets were purchased from Boehringer-Roche Diagnostics (Copenhagen, Denmark) and protein protease inhibitor I and II and streptavidin-HRP were from Sigma-Aldrich (Brøndby, Denmark). 2-Deoxy-d-[3H]glucose was from Perkin Elmer Life Sciences (Copenhagen, Denmark). Oil Red O was from Sigma-Aldrich (Brøndby, Denmark). Phospho-Akt (Ser473), anti-β-tubulin, phospho-ACC (Ser79), phospho-SAPK/JNK (Thr183/Tyr185), phospho-IRS1 (Ser307), anti-GPX1 and anti-Akt antibodies were from Cell Signaling Technology (Boston, MA, USA). Anti-CD36 was from R&D Systems (Minneapolis, MN, USA) and anti-HSP70 from Enzo Life technologies (Aarhus, Denmark), anti-myosin heavy chain was from Iowa Hybridoma Bank (Iowa city, IA, USA). NFκB-P65 DNA binding activity ELISA kit came from Active Motif (Carlsbad, CA, USA). The ELISA kit for IL6 was purchased from Mesoscale Discovery (Gaithersburg, MD, USA).

Human muscle satellite cell isolation, proliferation and differentiation, and treatment

Muscle satellite cells were isolated from vastus lateralis muscle biopsies as previously described (Green et al. 2011b) and stored in liquid nitrogen until required. Cell cultures were expanded and then seeded on matrigel-coated plates for differentiation. Confluent cells were incubated with DMEM containing 1 g l−1 glucose, 10% FBS and 1% P/S, in order to allow cells to align. After 48 h the medium was changed to DMEM containing 1 g l−1 glucose, 2% HS and 1% P/S, in order to initiate differentiation. After 48 h the medium was changed to DMEM containing 1 g l−1 glucose, 2% HS, 1% P/S and 0.5% human serum albumin either conjugated to 300 μm palmitate or the equivalent volume of 100% ethanol. Media were refreshed every 24 h for the following 5 days of differentiation. All cells were differentiated for 7 days, with palmitate treatments being given for the penultimate 1, 2, 3 or 5 days of the differentiation protocol (see Supplemental Fig. 1, available online only). For insulin stimulations cells were serum starved in DMEM containing 1 g l−1 glucose only before experiments. For all experiments cells were used at day 7 of differentiation at passages 4–6. All cell groups were used on the same day of differentiation and at the same passage number for each experimental data set.

Cell lysis

Cells were rinsed once in ice-cold phosphate-buffered saline (PBS) and lysed in 20 mm Tris, pH 7.5, 150 mm NaCl, 1 mm EGTA, 1 mm EDTA, 0.1% Triton X-100, protease inhibitor (one tablet/10 ml) and 1% phosphatase inhibitor cocktail. Whole cell lysates were centrifuged (12,000 g at 4°C for 10 min), and supernatants removed for storage at −80°C until required.

Immunoblotting

Protein concentrations were determined using the Bradford reagent (Bradford, 1976). Twenty micrograms of whole cell lysates were subjected to SDS-PAGE using Biorad 4–15% precast gels and wet transfer. Polyvinylidene difluoride (PVDF) membranes were probed with primary antibodies raised against the protein of interest as indicated in the figure legends. Detection of primary antibodies was performed using appropriate peroxidase-conjugated IgG and protein signals visualised using FEMTO-enhanced chemiluminescence and a Biorad Chemidoc XRS imager. Quantification of immunoblots was done using Image J (NIH, Bethesda, MD, USA: http://rsb.info.nih.gov/ij).

Oil Red O staining

Myocytes were washed twice in PBS and fixed using Glyo-Fixx (Thermo Scientific, Soeborg, Denmark) for 1 h. Myocytes were then washed in 60% isopropanol and left to dry. Staining was carried out by adding 1 ml of 6 mm Oil Red O (Sigma-Aldrich) for 1 h at room temperature. Myocytes were then washed with distilled water and photos taken under light microscope. Lipid stain was quantified by precipitation in 100% isopropanol and measuring the absorbance at 500 nm.

NFκB-P65 DNA binding activity

Measurement of NFκB-P65 DNA binding activity was carried out on 10 μg whole cell lysate using the Active Motif ELISA kit according to manufacturer's instructions.

Measurement of cytokines in cell culture media

Levels of interleukin-6 (IL6) were measured 24 h post changing of cell culture media (100 μl) using a Meso Scale Discovery proinflammatory ELISA kit according to manufacturer's instructions.

Glucose uptake

Myocytes were serum starved in DMEM containing 1 g l−1 glucose for 2 h prior to assaying glucose uptake and incubated with reagents for times and at concentrations indicated in the figure legends. Cells were washed twice with Hepes-buffered saline (140 mm NaCl, 20 mm Hepes, 5 mm KCl, 2.5 mm MgSO4 and 1 mm CaCl2, pH 7.4). Glucose uptake was assayed by incubation with 10 μm 2-deoxy-d-[3H]glucose (1 μCi ml−1) for 10 min. Non-specific tracer binding was determined by quantifying cell-associated radioactivity in the presence of 10 μm cytochalasin B. The medium was aspirated before washing adherent cells twice with 0.9% ice-cold NaCl. Cells were subsequently lysed in 50 mm NaOH and radioactivity was quantified using a Perkin Elmer Tri-Carb 2810TR scintillation counter. Protein concentration was determined using the Bradford reagent.

RNA isolation and quantitative real-time PCR (qPCR)

Total RNA was isolated from cells using TRIzol according to manufacturer's instructions. Reverse transcription and cDNA synthesis was performed as previously described (Broholm et al. 2012). Primers were synthesised by DNA technology (Risskov, Denmark). Prior optimisation was conducted for each oligo set, determining the optimal concentration of primers and probe as well as verifying the efficiency of the amplification. Primer sequences can be found in Table 2. The primers were mixed with cDNA and SYBR Green PCR Master Mix (Applied Biosystems) in a total reaction volume of 10 μl. Detection of mRNA expression was performed in triplicate using a Viia7 sequence detector (Applied Biosystems). To adjust for variations in the cDNA synthesis each gene was normalised to 18S ribosomal RNA using the comparative (ΔΔCT) method and expressed as a fold change (2(–ΔΔCT)).

Table 2.

Primer sequences

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
GLUT1 ACCGGGCCAAGAGTGTGCTA GTAGGCGGGGGAGCGGAACA
CPT1 GAGTGACTGGTGGCAAGAGTACA CTTGATGAGCACAAGGTCCA
MyHC2 TGTCTCACTCCCAGGCTACA CCAAAAACAGCCAATTCTGAG
MyoD CACTACAGCGGCGACTCC TAGGCGCCTTCGTAGCAG
Myogenin GCTCAGCTCCCTCAACCA GCTGTGAGAGCTGCATTCG
18S GCAATTATTCCCCATGAACG GGCCTCACTAAACCATCCAA
Open in a new tab

Statistical analyses

For multiple comparisons statistical analysis was performed using one-way or two-way analysis of variance (ANOVA) with Bonferoni corrections. For data that were normalised to basal (i.e. fold changes) statistical analysis was performed using a one-sample t test with a hypothetical mean of 1. Data analysis was performed using GraphPad Prism software and considered statistically significant at P values < 0.05.

Results

Effect of chronic palmitate treatment on intracellular lipid accumulation and myocyte differentiation

In order to assess the effects of saturated fatty acids on muscle cells isolated from sedentary or extremely active individuals, myoblasts were treated for either 1, 2, 3 or 5 days with 300 μm palmitate during differentiation. The consequences of this treatment were then assessed. Treatment of differentiating myocytes with palmitate resulted in visible accumulation of lipid within myotubes at all time points (Fig. 1A). When lipid accumulation was quantified there was a significant group difference between the sedentary and active groups and there was a significant effect of the palmitate treatment in both groups (Fig. 1B). In order to evaluate differentiation, protein expression of myosin heavy chain (MyHC) was measured by western blot. There was no significant effect of palmitate treatment on the expression of MyHC in either group (Fig. 1C). Importantly there was no difference between protein expression of MyHC in basal cells between the two groups. In order to investigate further the differentiation status of the cells, mRNA expression of early and late myogenic markers were also measured by qPCR. Neither myosin heavy chain 2 (MyHC2; Fig. 1D), myogenic regulatory factor, MyoD (Fig. 1E) or myogenin (Fig. 1F) were significantly different between active and sedentary groups and there was no significant effect of palmitate treatment.

Figure 1. Effect of palmitate on lipid accumulation and differentiation of myotubes.

Figure 1

Open in a new tab

Satellite cells were isolated from vastus lateralis biopsies from sedentary or active volunteers and grown in culture until mature myotubes were formed. Cells were treated with 300 μm palmitate for 1, 2, 3 or 5 days during differentiation before fixation and staining with Oil Red O. A, representative white light images of myotubes (magnification ×20, scale bar 100px) stained with Oil Red O. B, quantification of Oil Red O staining relative to total protein content expressed as a fold change from basal. C, quantification and representative immunoblot of MyHC protein expression. Expression of MyHC2 mRNA (D), MyoD mRNA (E) and myogenin mRNA (F) were measured by qPCR and using the ΔCT method expressed as fold changes from basal. Values shown are the mean ± SEM from cells from 5 individuals for each group. An asterisk denotes a significant difference from basal of that group (*P < 0.05, (*)P= 0.08).

Effect of activity level and chronic palmitate treatment on markers of fat metabolism

In the basal state, myocytes from the active group had significantly lower protein expression of the fatty acid transporter FAT/CD36 (Fig. 2A) with P= 0.006. In order to measure fatty acid metabolism in myocytes treated with palmitate we measured the phosphorylation of acetyl coenzyme A carboxylase (ACC) as a marker of fatty acid oxidation. In myocytes from active individuals palmitate treatment caused a significant increase in ACC phosphorylation that increased in a treatment duration-dependent manner (Fig. 2A and B). However, in myocytes from sedentary individuals ACC phosphorylation in response to palmitate treatment was delayed (Fig. 2A and B). When amount of intracellular lipid was correlated to level of ACC phosphorylation we found a positive correlation in myocytes isolated from active individuals (P= 0.0014, Fig. 2C, filled circles); however, in myocytes from sedentary individuals this correlation was lost (P= 0.29, Fig. 2C, open circles). Expression of carnitine palmitoyltransferase (CPT1) was increased in both groups by palmitate treatment, with no difference between groups (Fig. 2D). In order to further characterise the cells, mRNA expression of mitochondrial biogenesis markers PGC1α, PPARα and citrate synthase were also measured. However, mRNA expression of these genes was not significantly different between sedentary and active myotubes and due to high variability between each subjects cells were expressed relative to basal expression (Supplemental Fig. 2). Palmitate treatment had no effect on the expression of these genes in either the sedentary or active group.

Figure 2. Effect of inactivity and chronic palmitate treatment on ACC phosphorylation and mitochondrial markers.

Figure 2

Open in a new tab

Satellite cells were isolated from vastus lateralis biopsies from sedentary or active volunteers and grown in culture until mature myotubes were formed. Cells were treated with 300 μm palmitate for 1, 2, 3 or 5 days during differentiation. A, lysates were immunoblotted to assess the phosphorylation status of ACC and total protein amount of CD36. B, effect of palmitate on ACC phosphorylation was quantified and expressed as arbitrary units. C, phosphorylation of ACC/total protein was correlated to amount of Oil Red O stain/total protein for each subjects cells from sedentary group (open circles, n= 5) and active group (filled circles, n= 4). Expression of CPT1 mRNA (D) was measured by qPCR and using the ΔCT method expressed as fold changes from basal. Values shown are the mean ± SEM from cells from 5 individuals for each group. An asterisk denotes a significant difference from basal of that group (*P < 0.05, **P < 0.005, ***P < 0.0005). Significant difference from sedentary basal (P < 0.05).

Effect of activity level and chronic palmitate treatment on inflammatory and cell stress markers

Treatment of differentiating myocytes with palmitate had no effect on stress markers: stress activated protein kinase/c-Jun NH2-terminal kinase (SAPK/JNK) phosphorylation, heat shock protein 70 (HSP70) protein expression or glutathione peroxidase 1 (GPX1) protein expression in either the sedentary or active group (Fig. 3A, B, C and D). Interestingly, in the basal state myocytes from the active group had significantly lower protein expression of HSP70 compared to myocytes from the sedentary group (Fig. 3A and B). Additionally, myocytes from the active group also exhibited lower basal p-JNK phosphorylation compared to myocytes from the sedentary group (Fig. 3A and C). Palmitate treatment had no effect on nuclear factor κB (NFκB) p65 subunit DNA binding activity (Fig. 3E) or interleukin-6 (IL6) secretion (Fig. 3F) in either group and there was no difference in these markers of inflammation between the groups in the basal state.

Figure 3. Effect of inactivity and chronic palmitate treatment on stress markers and inflammation.

Figure 3

Open in a new tab

Satellite cells were isolated from vastus lateralis biopsies from sedentary or active volunteers and grown in culture until mature myotubes were formed. Cells were treated with 300 μm palmitate for 1, 2, 3 or 5 days during differentiation. A, lysates were immunoblotted to assess the phosphorylation status of SAPK/JNK and total protein amount of HSP70 and GPX1. Equal gel loading was ascertained by immunoblotting with an antibody against β-tubulin. Immunoblots for HSP70 (B), phosphor-SAPK/JNK (C) and GPX1 (D) were quantified for both groups and expressed as arbitrary units. E, lysates were used to assess NFκB DNA binding activity. F, cell media were used to measure IL6 secretion by ELISA. Values shown are the mean ± SEM from cells from 5 individuals for each group. Asterisks denote a significant difference from basal of that group (*P < 0.05, **P < 0.01).

Effect of activity level and chronic palmitate on basal and insulin-stimulated glucose uptake and signalling components

Myocytes from sedentary individuals showed significantly higher glucose uptake compared to those isolated from active individuals despite the same amount of glucose available to the myocytes during differentiation (Fig. 4A). As saturated fatty acids are thought to be a causative factor in lifestyle-associated metabolic disease it was important to measure insulin-stimulated glucose uptake in active and sedentary myocytes treated with palmitate. Palmitate had no effect on non-insulin-stimulated glucose uptake in myocytes (Fig. 4A). In the absence of palmitate, myocytes from both groups showed significant increased glucose uptake in response to insulin (Fig. 4B). Myocytes from active individuals maintained a significant insulin-stimulated glucose uptake after palmitate treatment for 1, 2 or 3 days. However, insulin resistance was seen after 5 days of palmitate treatment in this group (Fig. 4B). Interestingly, myocytes from sedentary individuals become insulin resistant immediately following 1 day of palmitate treatment (Fig. 4B). Akt serine473 phosphorylation by insulin was not attenuated by palmitate treatment in either the sedentary or active group. Palmitate treatment alone had no effect on non-insulin-stimulated Akt phosphorylation (Fig. 4C) or expression of Akt protein. There was no significant difference between levels of glucose transporter 1 (GLUT1) between the groups (Fig. 4D). Palmitate treatment had no significant effect on GLUT1 expression in either group. Expression of GLUT4 was also measured and showed no significant effect of palmitate and no difference between groups (Supplemental Fig. 3).

Figure 4. Effect of inactivity and chronic palmitate on glucose uptake and insulin signalling.

Figure 4

Open in a new tab

Satellite cells were isolated from vastus lateralis biopsies from sedentary or active volunteers and grown in culture until mature myotubes were formed. Cells were treated with 300 μm palmitate for 1, 2, 3 or 5 days during differentiation. Subsequently myotubes were treated with insulin (100 nm) for 30 min before measuring glucose uptake in the sedentary group or the active group. A, effect of palmitate alone on glucose uptake was also measured for sedentary (open bars) and active (filled bars). B, insulin-stimulated glucose uptake was expressed as a fold change from the corresponding palmitate treatment alone (sedentary, open bars; active, filled bars). C, lysates were immunoblotted to assess the phosphorylation of Akt and total protein amount of Akt. Phosphorylation of Akt S473 normalised to total Akt was quantified and expressed as arbitrary units. Expression of GLUT1 mRNA (D) was measured by qPCR and using the ΔCT method expressed as fold changes from basal. Values shown are the mean ± SEM from cells from 5 individuals for each group. An asterisk denotes a significant difference from basal of that group (*P < 0.055, **P < 0.005, ***P < 0.0005).

Effect of inactivity and chronic palmitate treatment on IRS1 serine phosphorylation and JNK activity

Following serum starvation, myocytes from sedentary individuals have higher basal insulin receptor substrate 1 (IRS1) serine307 and SAPK/JNK phosphorylation compared to myocytes from active individuals (Fig. 5A). When cells were treated with palmitate, JNK phosphorylation was increased in the sedentary group. Myocytes from active individuals had increased IRS1 serine307 phosphorylation in response to insulin; this negative regulation by insulin was dysregulated in myocytes from sedentary individuals. In the sedentary group JNK phosphorylation positively correlated with IRS1 serine phosphorylation (Fig. 5B); however, this correlation was not seen in the active group (P= 0.1, r2= 0.055, data not shown).

Figure 5. Effect of inactivity and chronic palmitate treatment on IRS1 serine phosphorylation.

Figure 5

Open in a new tab

Satellite cells were isolated from vastus lateralis biopsies from sedentary or active volunteers and grown in culture until mature myotubes were formed. Cells were treated with 300 μm palmitate for 1, 2, 3 or 5 days during differentiation. Subsequently myotubes were treated with insulin (100 nm) for 15 min before lysis. B, lysates were immunoblotted to assess the phosphorylation status of SAPK/JNK and IRS1 serine307. A, Phosphorylation of IRS1 was quantified and expressed as arbitrary units. C, Phosphorylation of IRS1 was correlated to phosphorylation of SAPK/JNK for each cell ID in the sedentary group. ¤ Significant change from the sedentary basal (P < 0.05).

Discussion

Our findings indicate that human skeletal muscle satellite cells that are grown and differentiated into myocytes in culture, despite multiple passages, exhibit metabolic differences. This has allowed us to investigate how myocytes from sedentary or extremely active individuals respond to chronic palmitate treatment as a model of high fat diet ex vivo. Our data suggest that satellite cells are likely to be programmed corresponding to their donor activity level and thus may reflect muscle adaptations of physical activity. Here, we specifically demonstrate physical activity-associated protection against development of insulin resistance associated with saturated free fatty acids. This finding supports the idea that satellite cells retain metabolic differences associated with physical activity and that our model can be used to decipher the mechanisms by which physical activity can potentially afford protection against the development of insulin resistance. Additionally, as satellite cells are important in muscle maintenance and repair, this finding could have an impact on skeletal muscle physiology. It is also important to highlight that not all measured parameters significantly varied between sedentary and active myotubes. Specifically, both groups had the same expression profile of differentiation marker MyHC2. MyHC2 has been shown to be increased in exercised muscle (Harber et al. 2012; Liu et al. 2008), suggesting that not all in vivo differences are retained in culture.

Interestingly, myocytes from sedentary individuals had significantly higher basal glucose uptake levels than myocytes from active individuals. Importantly, myocytes from active individuals were able to partially prevent the development of insulin resistance associated with palmitate treatment, while the sedentary myocytes more rapidly developed insulin resistance following treatment. In line with this, sedentary myocytes also showed a dysregulated IRS1 serine phosphorylation, significantly higher in the basal state compared to active myocytes and further enhanced by palmitate treatment. Interestingly, IRS1 serine phosphorylation positively correlated with the amount of JNK phosphorylation in the sedentary group. Importantly, JNK has been shown to promote insulin resistance through phosphorylation of IRS1 (Tanti & Jager, 2009). While CPT1 mRNA was increased by palmitate treatment in both groups, sedentary myocytes showed delayed ACC phosphorylation in response to palmitate treatment compared to active myocytes.

We have previously demonstrated that satellite cells isolated from obese-type 2 diabetic individuals retain both insulin-resistant and inflammatory phenotypes (Green et al. 2011b). Interestingly, these cells showed a trend towards increased basal glucose uptake compared with cells derived from non-obese healthy individuals. Additionally, we have also shown that satellite cells differentiated under hyperglycaemic conditions (22.5 mm) have significantly higher basal glucose uptake than satellite cells differentiated in normal glycaemic (5 mm) conditions (Green et al. 2012). In the current study, the sedentary individuals from which satellite cells were isolated did have significantly higher fasting glucose levels (Table 1); however, these were in the healthy range (3.9–5.5 mmol l−1). Nevertheless, the cells from sedentary subjects had a significantly higher level of basal glucose uptake compared to cells from active individuals despite the same amount of glucose available to the cells during differentiation, indicating that the glucose uptake is in part determined by cell programming in vivo. Additionally, the sedentary group had a higher mean fasting insulin concentration (Table 1) than the active group (although this was not significant) which may have resulted in an adaptation of the cells resulting in increased glucose uptake ex vivo. Neither the basal, nor palmitate-treated elevations could be associated with increased expression of the non-insulin-dependent transporter (GLUT1) or elevated phosphorylation of Akt.

Interestingly, we found that myocytes from sedentary individuals had higher basal IRS1 serine307 phosphorylation compared to myocytes from active individuals. Serine phosphorylation of IRS1 inhibits autophosphorylation and activation of the insulin receptor thus switching off the insulin signal (Bollag et al. 1986; Strack et al. 2000). Serine phosphorylation of IRS1 also results in increased proteasomal degradation of IRS protein (Tanti et al. 1994; Greene et al. 2003). Therefore serine phosphorylation of IRS1 has been suggested to be a potential contributor to the development of insulin resistance in vivo (Shulman, 2000). In this study we observed that sedentary myotubes had enhanced IRS1 serine307 phosphorylation and that this correlated positively (P= 0.0026, r2= 0.33) with increased SAPK/JNK phosphorylation in the same cells. SAPK/JNK can be activated by inflammatory cytokines and fatty acids and promotes serine phosphorylation of IRS proteins (Nguyen et al. 2005). Therefore the observed dysregulated JNK-IRS1 (serine307) phosphorylation observed in sedentary myocytes in the basal state could contribute to the development of insulin resistance within these cells when challenged by palmitate. Interestingly, no correlation between IRS serine307 and SAPK/JNK phosphorylation was seen in active myotubes (P= 0.1, r2= 0.06, data not shown). This could suggest that the insulin resistance that develops in the active myotubes following 3 days of palmitate treatments occurs independently of IRS1 inhibition.

We have shown that satellite cells isolated from extremely physically active males and differentiated into myocytes are partially protected from fatty acid-induced insulin resistance whereas cells from sedentary individuals are not. It has been well documented in the literature that muscle adapts to endurance and resistance training (reviewed in Baar, 2009) and that physical activity prevents development of a number of chronic diseases (reviewed in Booth & Laye, 2009). Fatty acid oversupply (such as that seen with obesity) is thought to be a key mediator in the development of skeletal muscle insulin resistance, and acute exercise has been shown to prevent fatty acid-induced insulin resistance and increase the lipogenic capacity of muscle (Schenk & Horowitz, 2007). In line with this it has recently been shown that contractile activity of human satellite cells can prevent insulin resistance induced by adipocyte culture medium (Lambernd et al. 2012).

In obesity, the accumulation of fatty acids is thought to promote inflammation through increased NFκB activity and impairing insulin signalling (Barma et al. 2009). Green et al. have previously shown that palmitate induces inflammation in L6 rat myotubes (Green et al. 2011a). Therefore we were surprised to find that palmitate treatment did not promote inflammation in either sedentary or active myocytes. These findings suggest species-dependent differences and underscore the value of our human model. Indeed we previously demonstrated that only satellite cells from obese-type 2 diabetics were significantly inflamed and that cells from obese-normal glucose-tolerant subjects were comparable to lean controls (Green et al. 2011b). This would support the idea that fatty acids/obesity alone is not sufficient to induce inflammation. Although there is evidence in the literature that lifestyle-associated metabolic disease is associated with peripheral inflammation, inactivity alone is unlikely to be the causative factor. In support of this we have shown that reducing physical activity for 14 days promotes reduced whole body insulin sensitivity but has no effect on levels of tumour necrosis α (TNFα) or IL6 in the plasma (Knudsen et al. 2012). Additionally, in a 9 day bed rest study it has been shown that NFκB activity and monocyte chemoattractant protein 1 (MCP1) expression in muscle were unaffected by bed rest (Friedrichsen et al. 2012). The finding that sedentary myocytes treated with palmitate show no inflammation but do develop insulin resistance supports the hypothesis that fatty acid-induced insulin resistance precedes the development of inflammation.

Metabolic inflexibility is defined as a reduced capacity to increase fatty acid oxidation upon increased fatty acid availability. Subsequently, this has been suggested to lead to the accumulation of intra-myocellular lipid and promote the development of insulin resistance (Kudo et al. 1995; Winder & Hardie, 1996; Park et al. 2002). ACC phosphorylation leads to its inhibition and subsequent decreased malonyl coenzyme A content and increased fatty acid oxidation. In myocytes isolated from active males we observed an increase in ACC phosphorylation following palmitate treatment. However, in myocytes from sedentary individuals, phosphorylation of ACC following palmitate treatment was delayed. This finding is suggestive that differentiated satellite cells from sedentary individuals may exhibit hampered metabolic flexibility. To fully understand this defect in sedentary myotubes, it would be useful to investigate the effects of other fatty acids; plasma only contains 35% of saturated fatty acids and different fatty acids have been shown to have specific effects (Watt et al. 2012). Palmitate was chosen in this study as it has been shown to promote inflammation in various cell types (Weigert et al. 2004; Jove et al. 2006). It has been shown that oleate reduces the cytotoxic effects of palmitate when co-incubated (Coll et al. 2008) and therefore is often used in a 1:2 molar ratio with palmitate. In this current study, we observed no effect on inflammatory markers of palmitate treatment in either group. Therefore it is unlikely that the observable effects are due to enhanced inflammation in the cells. It is important to highlight that this study was performed with physiologically relevant concentrations of palmitate (50–750 μm) and importantly all palmitate treatments were conjugated to albumin in a 0.5:3 molar ratio also reflecting in vivo conditions (Spector et al. 1971).

CPT1 is the transporter required to carry fatty acids from the cytoplasm into the mitochondria and therefore critical for oxidation of fatty acids. The simultaneous lack of increase in PGC1α and PPARα suggests an increase in mitochondrial activity rather than mitochondrial number. The palmitate-dependent increase in CPT1 may be beneficial for maintaining insulin sensitivity as overexpression of CPT1 in rat muscle has been shown to improve insulin action in rats fed a high fat diet. Importantly, this overexpression had no effect on markers of mitochondrial capacity or function (Bruce et al. 2009). It has been shown in high-fat feeding studies in mice that the gastrocnemius upregulates CD36, leading to a larger clearance of lipid into the muscle (Hegarty et al. 2002) by increasing the capacity of the muscle to take up fatty acids from the circulation. To this end, we found that the protein expression of FAT/CD36 was significantly elevated in sedentary myotubes compared to active ones in the basal state but was not further elevated following palmitate treatment. This supports the idea that the sedentary myotubes might take up more fatty acids than the active myotubes, which could lead to an overload of the electron transport chain, increasing the production of reactive oxygen species (ROS). Heat shock proteins are markers of cellular redox changes (Cumming et al. 2004; Calabrese et al. 2004). In line with this, our finding that sedentary myotubes express significantly higher protein levels of HSP70 in the basal state compared to active myotubes supports the idea of increased oxidative stress in the sedentary group. Increased ROS generation has, in turn, been shown to promote insulin resistance (Yuzefovych et al. 2010; Lefort et al. 2010).

Satellite cells, like all stem cells, are able to undergo self-renewal (Collins & Partridge, 2005) and are thought to be critical in adult skeletal muscle maintenance as they fuse to contribute their nuclei and to form renewed fibres to compensate for muscle turnover through normal wear and tear. Additionally, satellite cells are important in regeneration of muscle following injury (Lepper et al. 2011; Murphy et al. 2011). Therefore a less metabolically flexible satellite cell population may have significant impact on the metabolic profile of the muscle as a whole, which in turn could have serious metabolic health consequences as skeletal muscle accounts for approximately 40% of adult body weight and is the main site of glucose disposal in the body. In conclusion, we have shown that satellite cells isolated from sedentary individuals display metabolic differences compared to satellite cells from physically active donors. We have concluded that myocytes from active individuals have a higher tolerance (compared to myocytes from sedentary individuals) to chronic exposure to palmitate allowing them to maintain metabolic flexibility and that this is associated with decreased basal phosphorylation of IRS1 in the active individuals.

Acknowledgments

We would like to thank Louise Seier Hansen, Mille Bækdl Nielsen and Matthew James Laye for designing and carrying out the clinical study and taking muscle biopsies from which satellite cells were isolated.

Glossary

ACC

acetyl coenzyme A carboxylase

CPT1

carnitine palmitoyltransferase

GLUT1

glucose transporter 1

GLUT4

glucose transporter 4

GPX1

gluthathione peroxidase 1

HSP70

heat shock protein 70

IL6

interleukin-6

IRS1

insulin receptor substrate 1

JNK

c-Jun NH2-terminal kinase

MyHC

myosin heavy chain

NFκB

nuclear factor κB

SAPK

stress-activated protein kinase

Additional information

Competing interests

None.

Author contributions

C.J.G. was involved in all aspects of the study: (1) conception and design of the experiments, (2) collection, analysis and interpretation of data, (3) drafting the article or revising it critically for important intellectual content. T.B. was involved in (2) and (3). B.K.P. was involved in (1) and (3). C.S. was involved in (1), (2) and (3). All authors have approved the final version of the manuscript.

Funding

This research was supported by a Marie Curie Intra European Fellowship within the 7th European Community Framework Programme. The Centre of Inflammation and Metabolism (CIM) is supported by a grant from the Danish National Research Foundation (no. 02-512-55). CIM is part of the UNIK Project: Food, Fitness & Pharma for Health and Disease, supported by the Danish Ministry of Science, Technology, and Innovation, and a member of DD2, the Danish Center for Strategic Research in Type 2 Diabetes (the Danish Council for Strategic Research, grant nos 09-067009 and 09-075724).

Supplementary material

Supplemental Fig. 1

Supplemental Fig. 2

Supplemental Fig. 3

tjp0591-4621-SD1.ppt (477.5KB, ppt)

References

  1. Alfaro LA, Dick SA, Siegel AL, Anonuevo AS, McNagny KM, Megeney LA, Cornelison DD, Rossi FM. CD34 promotes satellite cell motility and entry into proliferation to facilitate efficient skeletal muscle regeneration. Stem Cells. 2011;29:2030–2041. doi: 10.1002/stem.759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baar K. The signalling underlying FITness. Appl Physiol Nutr Metab. 2009;34:411–419. doi: 10.1139/H09-035. [DOI] [PubMed] [Google Scholar]
  3. Barma P, Bhattacharya S, Bhattacharya A, Kundu R, Dasgupta S, Biswas A, Bhattacharya S, Roy SS, Bhattacharya S. Lipid induced overexpression of NF-κB in skeletal muscle cells is linked to insulin resistance. Biochim Biophys Acta. 2009;1792:190–200. doi: 10.1016/j.bbadis.2008.11.014. [DOI] [PubMed] [Google Scholar]
  4. Biensø RS, Ringholm S, Kiilerich K, Aachmann-Andersen NJ, Krogh-Madsen R, Guerra B, Plomgaard P, van Hall G, Treebak JT, Saltin B, Lundby C, Calbet JA, Pilegaard H, Wojtaszewski JF. GLUT4 and glycogen synthase are key players in bed rest-induced insulin resistance. Diabetes. 2012;61:1090–1099. doi: 10.2337/db11-0884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bollag GE, Roth RA, Beaudoin J, Mochly-Rosen D, Koshland DE., Jr Protein kinase C directly phosphorylates the insulin receptor in vitro and reduces its protein-tyrosine kinase activity. Proc Natl Acad Sci U S A. 1986;83:5822–5824. doi: 10.1073/pnas.83.16.5822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Booth FW, Laye MJ. Lack of adequate appreciation of physical exercise's complexities can pre-empt appropriate design and interpretation in scientific discovery. J Physiol. 2009;587:5527–5539. doi: 10.1113/jphysiol.2009.179507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bouzakri K, Roques M, Gual P, Espinosa S, Guebre-Egziabher F, Riou JP, Laville M, Marchand-Brustel Y, Tanti JF, Vidal H. Reduced activation of phosphatidylinositol-3 kinase and increased serine 636 phosphorylation of insulin receptor substrate1 in primary culture of skeletal muscle cells from patients with type 2 diabetes. Diabetes. 2003;52:1319–1325. doi: 10.2337/diabetes.52.6.1319. [DOI] [PubMed] [Google Scholar]
  8. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  9. Brocca L, Cannavino J, Coletto L, Biolo G, Sandri M, Bottinelli R, Pellegrino MA. The time course of the adaptations of human muscle proteome to bed rest and the underlying mechanisms. J Physiol. 2012;590:5211–5230. doi: 10.1113/jphysiol.2012.240267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Broholm C, Brandt C, Schultz NS, Nielsen AR, Pedersen BK, Scheele C. Deficient leukemia inhibitory factor signalling in muscle precursor cells from patients with type 2 diabetes. Am J Physiol Endocrinol Metab. 2012;303:E283–E292. doi: 10.1152/ajpendo.00586.2011. [DOI] [PubMed] [Google Scholar]
  11. Bruce CR, Hoy AJ, Turner N, Watt MJ, Allen TL, Carpenter K, Cooney GJ, Febbraio MA, Kraegen EW. Overexpression of carnitine palmitoyltransferase–1 in skeletal muscle is sufficient to enhance fatty acid oxidation and improve high-fat diet-induced insulin resistance. Diabetes. 2009;58:550–558. doi: 10.2337/db08-1078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Calabrese V, Stella AM, Butterfield DA, Scapagnini G. Redox regulation in neurodegeneration and longevity: role of the heme oxygenase and HSP70 systems in brain stress tolerance. Antioxid Redox Signal. 2004;6:895–913. doi: 10.1089/ars.2004.6.895. [DOI] [PubMed] [Google Scholar]
  13. Coll T, Eyre E, Rodriguez-Calvo R, Palomer X, Sanchez RM, Merlos M, Laguna JC, Vazquez-Carrera M. Oleate reverses palmitate-induced insulin resistance and inflammation in skeletal muscle cells. J Biol Chem. 2008;283:11107–11116. doi: 10.1074/jbc.M708700200. [DOI] [PubMed] [Google Scholar]
  14. Collins CA, Partridge TA. Self-renewal of the adult skeletal muscle satellite cell. Cell Cycle. 2005;4:1338–1341. doi: 10.4161/cc.4.10.2114. [DOI] [PubMed] [Google Scholar]
  15. Cumming RC, Andon NL, Haynes PA, Park M, Fischer WH, Schubert D. Protein disulfide bond formation in the cytoplasm during oxidative stress. J Biol Chem. 2004;279:21749–21758. doi: 10.1074/jbc.M312267200. [DOI] [PubMed] [Google Scholar]
  16. Friedrichsen M, Ribel-Madsen R, Mortensen B, Hansen CN, Alibegovic AC, Hojbjerre L, Sonne MP, Wojtaszewski JF, Stallknecht B, Dela F, Vaag A. Muscle inflammatory signaling in response to 9 days of physical inactivity in young men with low compared to normal birth weight. Eur J Endocrinol. 2012;167:829–838. doi: 10.1530/EJE-12-0498. [DOI] [PubMed] [Google Scholar]
  17. Galgani JE, Moro C, Ravussin E. Metabolic flexibility and insulin resistance. Am J Physiol Endocrinol Metab. 2008;295:E1009–E1017. doi: 10.1152/ajpendo.90558.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gaster M, Kristensen SR, Beck-Nielsen H, Schroder HD. A cellular model system of differentiated human myotubes. APMIS. 2001;109:735–744. doi: 10.1034/j.1600-0463.2001.d01-140.x. [DOI] [PubMed] [Google Scholar]
  19. Gaster M, Petersen I, Hojlund K, Poulsen P, Beck-Nielsen H. The diabetic phenotype is conserved in myotubes established from diabetic subjects: evidence for primary defects in glucose transport and glycogen synthase activity. Diabetes. 2002;51:921–927. doi: 10.2337/diabetes.51.4.921. [DOI] [PubMed] [Google Scholar]
  20. Green CJ, Henriksen TI, Pedersen BK, Solomon TP. Glucagon like peptide–1-induced glucose metabolism in differentiated human muscle satellite cells is attenuated by hyperglycemia. PLoS One. 2012;7:e44284. doi: 10.1371/journal.pone.0044284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Green CJ, Macrae K, Fogarty S, Hardie DG, Sakamoto K, Hundal HS. Counter-modulation of fatty acid-induced pro-inflammatory nuclear factor κB signalling in rat skeletal muscle cells by AMP-activated protein kinase. Biochem J. 2011a;435:463–474. doi: 10.1042/BJ20101517. [DOI] [PubMed] [Google Scholar]
  22. Green CJ, Pedersen M, Pedersen BK, Scheele C. Elevated NF-κB activation is conserved in human myocytes cultured from obese type 2 diabetic patients and attenuated by AMP-activated protein kinase. Diabetes. 2011b;60:2810–2819. doi: 10.2337/db11-0263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Greene MW, Sakaue H, Wang L, Alessi DR, Roth RA. Modulation of insulin-stimulated degradation of human insulin receptor substrate–1 by serine 312 phosphorylation. J Biol Chem. 2003;278:8199–8211. doi: 10.1074/jbc.M209153200. [DOI] [PubMed] [Google Scholar]
  24. Harber MP, Konopka AR, Undem MK, Hinkley JM, Minchev K, Kaminsky LA, Trappe TA, Trappe S. Aerobic exercise training induces skeletal muscle hypertrophy and age-dependent adaptations in myofiber function in young and older men. J Appl Physiol. 2012;113:1495–1504. doi: 10.1152/japplphysiol.00786.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hegarty BD, Cooney GJ, Kraegen EW, Furler SM. Increased efficiency of fatty acid uptake contributes to lipid accumulation in skeletal muscle of high fat-fed insulin-resistant rats. Diabetes. 2002;51:1477–1484. doi: 10.2337/diabetes.51.5.1477. [DOI] [PubMed] [Google Scholar]
  26. Holloszy JO. The biology of aging. Mayo Clin Proc. 2000;75(Suppl):S3–S8. [PubMed] [Google Scholar]
  27. Jové M, Planavila A, Sanchez RM, Merlos M, Laguna JC, Vázquez-Carrera M. Palmitate induces tumor necrosis factor–α expression in C2C12 skeletal muscle cells by a mechanism involving protein kinase C and nuclear factor-κB activation. Endocrinology. 2006;147:552–561. doi: 10.1210/en.2005-0440. [DOI] [PubMed] [Google Scholar]
  28. Kelley DE, He J, Menshikova EV, Ritov VB. Dysfunction of mitochondria in human skeletal muscle in type 2 diabetes. Diabetes. 2002;51:2944–2950. doi: 10.2337/diabetes.51.10.2944. [DOI] [PubMed] [Google Scholar]
  29. Knudsen SH, Hansen LS, Pedersen M, Dejgaard T, Hansen J, Hall GV, Thomsen C, Solomon TP, Pedersen BK, Krogh-Madsen R. Changes in insulin sensitivity precede changes in body composition during 14 days of step reduction combined with overfeeding in healthy young men. J Appl Physiol. 2012;113:7–15. doi: 10.1152/japplphysiol.00189.2011. [DOI] [PubMed] [Google Scholar]
  30. Kolb H, Mandrup-Poulsen T. The global diabetes epidemic as a consequence of lifestyle-induced low-grade inflammation. Diabetologia. 2010;53:10–20. doi: 10.1007/s00125-009-1573-7. [DOI] [PubMed] [Google Scholar]
  31. Kudo N, Barr AJ, Barr RL, Desai S, Lopaschuk GD. High rates of fatty acid oxidation during reperfusion of ischemic hearts are associated with a decrease in malonyl-CoA levels due to an increase in 5′-AMP-activated protein kinase inhibition of acetyl-CoA carboxylase. J Biol Chem. 1995;270:17513–17520. doi: 10.1074/jbc.270.29.17513. [DOI] [PubMed] [Google Scholar]
  32. Lambernd S, Taube A, Schober A, Platzbecker B, Gorgens SW, Schlich R, Jeruschke K, Weiss J, Eckardt K, Eckel J. Contractile activity of human skeletal muscle cells prevents insulin resistance by inhibiting pro-inflammatory signalling pathways. Diabetologia. 2012;55:1128–1139. doi: 10.1007/s00125-012-2454-z. [DOI] [PubMed] [Google Scholar]
  33. Lefort N, Glancy B, Bowen B, Willis WT, Bailowitz Z, De Filippis EA, Brophy C, Meyer C, Hojlund K, Yi Z, Mandarino LJ. Increased reactive oxygen species production and lower abundance of complex I subunits and carnitine palmitoyltransferase 1B protein despite normal mitochondrial respiration in insulin-resistant human skeletal muscle. Diabetes. 2010;59:2444–2452. doi: 10.2337/db10-0174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lepper C, Partridge TA, Fan CM. An absolute requirement for Pax7-positive satellite cells in acute injury-induced skeletal muscle regeneration. Development. 2011;138:3639–3646. doi: 10.1242/dev.067595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu Y, Heinichen M, Wirth K, Schmidtbleicher D, Steinacker JM. Response of growth and myogenic factors in human skeletal muscle to strength training. Br J Sports Med. 2008;42:989–993. doi: 10.1136/bjsm.2007.045518. [DOI] [PubMed] [Google Scholar]
  36. Monninkhof EM, Elias SG, Vlems FA, van der Tweel I, Schuit AJ, Voskuil DW, van Leeuwen FE, TFPAC Physical activity and breast cancer: a systematic review. Epidemiology. 2007;18:137–157. doi: 10.1097/01.ede.0000251167.75581.98. [DOI] [PubMed] [Google Scholar]
  37. Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, Kardon G. Satellite cells, connective tissue fibroblasts and their interactions are crucial for muscle regeneration. Development. 2011;138:3625–3637. doi: 10.1242/dev.064162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nguyen MT, Satoh H, Favelyukis S, Babendure JL, Imamura T, Sbodio JI, Zalevsky J, Dahiyat BI, Chi NW, Olefsky JM. JNK and tumor necrosis factor-α mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. J Biol Chem. 2005;280:35361–35371. doi: 10.1074/jbc.M504611200. [DOI] [PubMed] [Google Scholar]
  39. Nocon M, Hiemann T, Muller-Riemenschneider F, Thalau F, Roll S, Willich SN. Association of physical activity with all-cause and cardiovascular mortality: a systematic review and meta-analysis. Eur J Cardiovasc Prev Rehabil. 2008;15:239–246. doi: 10.1097/HJR.0b013e3282f55e09. [DOI] [PubMed] [Google Scholar]
  40. Park SH, Gammon SR, Knippers JD, Paulsen SR, Rubink DS, Winder WW. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. J Appl Physiol. 2002;92:2475–2482. doi: 10.1152/japplphysiol.00071.2002. [DOI] [PubMed] [Google Scholar]
  41. Robson LG, Di Foggia V, Radunovic A, Bird K, Zhang X, Marino S. Bmi1 is expressed in postnatal myogenic satellite cells, controls their maintenance and plays an essential role in repeated muscle regeneration. PLoS One. 2011;6:e27116. doi: 10.1371/journal.pone.0027116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Sambasivan R, Yao R, Kissenpfennig A, Van Wittenberghe L, Paldi A, Gayraud-Morel B, Guenou H, Malissen B, Tajbakhsh S, Galy A. Pax7-expressing satellite cells are indispensable for adult skeletal muscle regeneration. Development. 2011;138:3647–3656. doi: 10.1242/dev.067587. [DOI] [PubMed] [Google Scholar]
  43. Scheele C, Nielsen S, Kelly M, Broholm C, Nielsen AR, Taudorf S, Pedersen M, Fischer CP, Pedersen BK. Satellite cells derived from obese humans with type 2 diabetes and differentiated into myocytes in vitro exhibit abnormal response to IL–6. PLoS One. 2012;7:e39657. doi: 10.1371/journal.pone.0039657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schenk S, Horowitz JF. Acute exercise increases triglyceride synthesis in skeletal muscle and prevents fatty acid-induced insulin resistance. J Clin Invest. 2007;117:1690–1698. doi: 10.1172/JCI30566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Shulman GI. Cellular mechanisms of insulin resistance. J Clin Invest. 2000;106:171–176. doi: 10.1172/JCI10583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Soman VR, Koivisto VA, Deibert D, Felig P, Defronzo RA. Increased insulin sensitivity and insulin binding to monocytes after physical training. N Engl J Med. 1979;301:1200–1204. doi: 10.1056/NEJM197911293012203. [DOI] [PubMed] [Google Scholar]
  47. Spector AA, Fletcher JE, Ashbrook JD. Analysis of long-chain free fatty acid binding to bovine serum albumin by determination of stepwise equilibrium constants. Biochemistry. 1971;10:3229–3232. doi: 10.1021/bi00793a011. [DOI] [PubMed] [Google Scholar]
  48. Stein TP, Wade CE. Metabolic consequences of muscle disuse atrophy. J Nutr. 2005;135:1824S–1828S. doi: 10.1093/jn/135.7.1824S. [DOI] [PubMed] [Google Scholar]
  49. Stettler R, Ith M, Acheson KJ, Décombaz J, Boesch C, Tappy L, Binnert C. Interaction between dietary lipids and physical inactivity on insulin sensitivity and on intramyocellular lipids in healthy men. Diabetes Care. 2005;28:1404–1409. doi: 10.2337/diacare.28.6.1404. [DOI] [PubMed] [Google Scholar]
  50. Strack V, Hennige AM, Krutzfeldt J, Bossenmaier B, Klein HH, Kellerer M, Lammers R, Haring HU. Serine residues 994 and 1023/25 are important for insulin receptor kinase inhibition by protein kinase C isoforms beta2 and theta. Diabetologia. 2000;43:443–449. doi: 10.1007/s001250051327. [DOI] [PubMed] [Google Scholar]
  51. Tanti JF, Grémeaux T, van Obberghen E, Le Marchand-Brustel Y. Serine/threonine phosphorylation of insulin receptor substrate 1 modulates insulin receptor signalling. J Biol Chem. 1994;269:6051–6057. [PubMed] [Google Scholar]
  52. Tanti JF, Jager J. Cellular mechanisms of insulin resistance: role of stress-regulated serine kinases and insulin receptor substrates (IRS) serine phosphorylation. Curr Opin Pharmacol. 2009;9:753–762. doi: 10.1016/j.coph.2009.07.004. [DOI] [PubMed] [Google Scholar]
  53. Thyfault JP, Booth FW. Lack of regular physical exercise or too much inactivity. Curr Opin Clin Nutr Metab Care. 2011;14:374–378. doi: 10.1097/MCO.0b013e3283468e69. [DOI] [PubMed] [Google Scholar]
  54. Tuomilehto J, Lindström J, Eriksson JG, Valle TT, Hämäläinen H, Ilanne-Parikka P, Keinänen-Kiukaanniemi S, Laakso M, Louheranta A, Rastas M, Salminen V, Uusitupa M, Finnish Diabetes Prevention Study Group Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N Engl J Med. 2001;344:1343–1350. doi: 10.1056/NEJM200105033441801. [DOI] [PubMed] [Google Scholar]
  55. Watt MJ, Hoy AJ, Muoio DM, Coleman RA. Distinct roles of specific fatty acids in cellular processes: implications for interpreting and reporting experiments. Am J Physiol Endocrinol Metab. 2012;302:E1–E3. doi: 10.1152/ajpendo.00418.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Weigert C, Brodbeck K, Staiger H, Kausch C, Machicao F, Häring HU, Schleicher ED. Palmitate, but not unsaturated fatty acids, induces the expression of interleukin–6 in human myotubes through proteasome-dependent activation of nuclear factor-κB. J Biol Chem. 2004;279:23942–23952. doi: 10.1074/jbc.M312692200. [DOI] [PubMed] [Google Scholar]
  57. Winder WW, Hardie DG. Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol Endocrinol Metab. 1996;270:E299–E304. doi: 10.1152/ajpendo.1996.270.2.E299. [DOI] [PubMed] [Google Scholar]
  58. Wolin KY, Yan Y, Colditz GA, Lee IM. Physical activity and colon cancer prevention: a meta-analysis. Br J Cancer. 2009;100:611–616. doi: 10.1038/sj.bjc.6604917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yuzefovych L, Wilson G, Rachek L. Different effects of oleate vs. palmitate on mitochondrial function, apoptosis, and insulin signalling in L6 skeletal muscle cells: role of oxidative stress. Am J Physiol Endocrinol Metab. 2010;299:E1096–E1105. doi: 10.1152/ajpendo.00238.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

tjp0591-4621-SD1.ppt (477.5KB, ppt)

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES