First Report of Zucchini yellow mosaic virus Infecting Gherkin (Cucumis anguira) in India

Abstract

A field visit in September 2011 to the Cucumis anguira (Gherkin) growing regions of Kuppam, Chittoor district of Andhra Pradesh, India revealed occurrence of mosaic, blistering and fruit malformation leading to the crop losses. Analysis of field samples revealed association of Zucchini yellow mosaic virus (ZYMV) with the disease. This is the first confirmed report of natural occurrence of ZYMV on Gherkin in India.

Gherkin (Cucumis anguira L.), a member of Cucurbitaceae is cultivated in India especially for export purposes. While conducting field survey during September 2011 in the gherkin growing regions of Kuppam, Chittoor district of Andhra Pradesh, India upto 80 % of gherkin plants were observed with mosaic, blistering of leaves and malformed fruits (Fig. 1a, c). The associated virus from the symptomatic leaves were isolated through sap inoculation and maintained on pumpkin plants (Cucurbita pepo), which produced mosaic-blistering symptoms at 2 weeks of post inoculation (Fig. 1b). Electron microscopy of the infected leaves from experimentally as well as naturally infected plants showed the presence of flexuous virus particles measuring about 750 × 12 nm which are characteristic of the family Potyviridae (Fig. 1d). DAC-ELISA conducted according to the method of Clark and Adams [1] using polyclonal antisera to Zucchini yellow mosaic virus (ZYMV), Papaya ringspot virus-watermelon isolate (W), PRSV-papaya isolate (PRSV-P), Potato virus Y showed that symptomatic gherkin samples reacted strongly with antiserum to ZYMV.

Fig. 1.

Disease symptoms and detection of Zucchini yellow mosaic virus in gherkin (Cucumis anguira) in southern India during September 2011. a Field symptoms on gherkin. b Symptoms on pumpkin following sap transmission. c Gherkin fruit showing blistering and distortion. d Electron microscopy showing filamentous virion in gherkin. e Amplification of ~1.1 kbp band of ZYMV in gherkin (S1) and pumpkin (S2) samples by RT-PCR, M Marker. f Phylogenetic relationships among the gherkin isolate of Zucchini yellow mosaic virus (ZYMV) from India with the other ZYMV isolates from rest of the world based on nucleotide sequence of the 3′terminal genome containing partial Nib gene, coat protein gene and 3′ UTR of ZYMV. The tree was constructed using Neighbor Joining method using Clustal X2.0.12 Tool

The identity of the virus was further confirmed by amplifying the 3′ terminal region of the virus in reverse transcription polymerase chain reaction (RT-PCR). Total RNA from the virus infected and healthy pumpkin and gherkin leaves was isolated using Trizol Reagent (Sigma, USA) and (ZY2 gctccatacatagctgagacagc and ZY3 taggctttttgcaaacggagtctaatc) the primers reported by Thomson et al. [3] were used in RT-PCR. Reverse transcription was conducted using oligo-dT primer and revert aid reverse transcriptase (Fermentas, USA) using 1 μg of total RNA as template. PCR amplification was performed using recombinant Taq DNA polymerase (Fermentas, USA) and 30 ng of cDNA. Thermocycling conditions were same as reported by Thomson et al. [3]. RT-PCR resulted in amplification of ~1.1 Kbp in both of the symptomatic samples of Gherkin and Pumpkin (Fig. 1e). The RT-PCR product was cloned into pTZ57R/T vector (Fermentas, USA) and was sequenced. A total of 1,171 nucleotides was obtained comprising 3′ untranslated region, coat protein gene and partial NIb gene. The sequence homologs were searched by using BLAST tool at NCBI server which revealed close similarity to ZYMV. The sequence of the ZYMV-gherkin isolate was submitted to the GenBank Database GQ482976. The sequence comparison showed that the present isolate shared 98.4–98.9 % sequence identity with coat protein gene of the other ZYMV isolates (AJ316228, AJ429071, EF122498, EU561044, FJ705256, GQ25152, AJ420020, AB188116, AJ420019, JF797206, FJ705272, EF062582, EF062583, M35095, AY188994, AB127936, AB458595, EU999760, DQ124239, AJ420015, AJ251527, AJ420018, GQ482976, EU561043, AY611023). Phylogenetic analysis based on 3′ genome sequence (1,171 nucleotides) resulted in an unrooted bootstrapped NJ tree showing relationship of ZYMV gherkin isolate with that of ZYMV-bottle gourd and cucumber isolates reported from India (Fig. 1f).

The Kuppam area, where the ZYMV-gherkin isolate was collected, covers a large scale cultivation of gherkin that was chiefly introduced by Private Agro companies from Israel. ZYMV is known to be seed borne in some cucurbits [4]. It could be possible that ZYMV might have been moved from Israel through seed and introduced to this particular place as there was no previous record of ZYMV in any other crops in this region. However, occurrence of ZYMV in bottle gourd in Pune (West India) was reported in 2004 [2]. The present study is the first report of natural occurrence of ZYMV on gherkin in India.