Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Nov 1.
Published in final edited form as: Virology. 2013 Aug 8;446(0):17–24. doi: 10.1016/j.virol.2013.07.014

An unbiased in vivo screen reveals multiple transcription factors that control HPV E6-regulated hTERT in keratinocytes

Mei Xu 1,2,†, Rachel A Katzenellenbogen 1,3,4,†, Carla Grandori 1, Denise A Galloway 1,*
PMCID: PMC3787310  NIHMSID: NIHMS510125  PMID: 24074563

Abstract

Activation of telomerase by human papillomavirus 16 (HPV16) E6 is a critical step for cell immortalization and transformation in human foreskin keratinocytes (HFKs). Multiple transcription factors have been identified as being involved in E6-induced hTERT expression. Here, we adapted an unbiased in vivo screen using a LacO-LacI system in human cells to discover hTERT promoter-interacting regulators. This approach allowed us to identify a novel hTERT repressor, Maz, which bound the hTERT promoter. E6 expression reduced Maz binding and correspondingly increased Sp1 binding at the hTERT promoter. Knockdown of Maz further increased histone acetylation, as well as hTERT expression in the presence of E6. Overall, these data indicate the utility of a novel screen for promoter-interacting and transcription-regulating proteins. These data also highlight multiple factors that normally regulate hTERT repression in HFKs, and therefore are targeted by E6 for hTERT expression.

Keywords: HPV E6, hTERT, Keratinocytes, Maz, Sp1

INTRODUCTION

Linear chromosomes are capped with non-gene coding repetitive DNA, and in normal somatic cells, this DNA is serially eroded with each cellular division. Critically short, dysfunctional telomeres eventually induce cells to senesce or apoptose (Hayflick, 1965). hTERT, the catalytic subunit of telomerase, is the rate-limiting component of telomerase activity, which maintains telomere length to protect the ends of chromosomes from degradation as well as preventing end-to-end fusions (Blackburn, 2001). Germ cells and stem cells are able to replicate indefinitely due to constitutive expression of hTERT. Cancer cells also utilize telomerase, by increasing telomerase activity, to maintain telomere length. More than 85% of all cancer cells have activated hTERT transcription (Hiyama and Hiyama, 2003).

Increased telomerase activity due to the activation of hTERT expression has emerged as a hallmark of cancers, and hTERT transcriptional regulation has been a focus of intense study in cancer research. Researchers have been interested in cis and trans elements that regulate hTERT expression as well as the chromatin structure of the hTERT gene itself (Bryce et al., 2000; Cong, Wen, and Bacchetti, 1999; Wang and Zhu, 2004). The hTERT gene is located at the end of chromosome five within a semi-heterochromatic region (Bryce et al., 2000) that is nuclease-resistant (Wang and Zhu, 2004). Chromatin remodeling in telomerase-negative cells has been shown to play an important role in activation of hTERT expression (Hou et al., 2002; Takakura et al., 2001). Inhibition of histone deacetylase activity relaxes the chromatin allowing hTERT transcriptional activation (Hou et al., 2002; Wang and Zhu, 2004). Sequence analysis of the hTERT promoter revealed the hTERT promoter is GC-rich, lacks TATA and CAAT boxes, but contains several binding sites for transcription factors, such as E-boxes for Myc binding and Sp1 binding sites (Cong, Wen, and Bacchetti, 1999), all of which facilitated identification of candidate transcriptional regulators of hTERT in tumor cells.

Studies have indicated that the regulation of hTERT expression is multifactorial. Many proteins directly or indirectly regulate hTERT transcription, including transcriptional repressors, such as p53, Mad, Wt1, Mzf-2, Sip1 and Menin, as well as transcriptional activators, such as Myc, Sp1 and Ets family transcription factors (Greenberg et al., 1999; Horikawa and Barrett, 2003; Kyo et al., 2000; Li, Lee, and Avraham, 2002; Lin and Elledge, 2003; Maida et al., 2002; Racek et al., 2005). Therefore, there is no single factor utilized in oncogenic induction of hTERT expression, and chromatin remodeling plays an additional, critical role in transcriptional regulation.

Human tumor viruses have evolved multiple strategies to promote telomerase activation and maintain telomere length. High risk (HR) HPV16 oncoprotein E6 (E6) contributes to keratinocyte immortalization and carcinogenesis through activation of telomerase, primarily through trans-activation of hTERT (Fu, Quintero, and Baker, 2003; Gabet et al., 2008; Gewin et al., 2004; Oh, Kyo, and Laimins, 2001; Xu et al., 2008). We and others have shown that E6 interacts with Myc on the hTERT promoter to increase its expression (Gewin and Galloway, 2001; Veldman et al., 2003), and E6 modifies the chromatin structure of the hTERT promoter through histone acetylation and dimethylation, dependent on the endogenous E6-Associated cellular Protein (E6AP) (Bedard et al., 2008; James, Lee, and Klingelhutz, 2006; Liu et al., 2005; Xu et al., 2008). Our group identified a novel constitutive hTERT repressor, NFX1-91, which interacts with the mSin3A-histone deacetylase complex (HDAC) at the hTERT promoter and maintains the gene in a repressed state. E6 interacts with E6AP and targets NFX1-91 for proteasome-mediated degradation, removing the inhibitory histone deacetylase complex and allowing the activation of hTERT expression (Gewin et al., 2004; Xu et al., 2008). Knockdown of NFX1-91 is able to induce hTERT transcription, as well as chromatin modification at the hTERT promoter (Gewin et al., 2004; Xu et al., 2008). Therefore, E6 affects hTERT and increases telomerase activity through transcription factor interactions, transcription repressor degradation, and chromatin structure modifications.

However, many unanswered questions about E6-induced hTERT expression remain. In examining cis elements in the hTERT promoter, we and others found that both E-boxes and Sp1 binding sites at the hTERT promoter play important roles in E6-induced hTERT expression in keratinocytes (Cheng et al., 2008; Gewin and Galloway, 2001; Oh, Kyo, and Laimins, 2001; Xu et al., 2008). We have consistently detected Myc binding to the hTERT promoter in both HFK and E6 expressing cells without changes to the total Myc protein levels (Gewin and Galloway, 2001; Xu et al., 2008). Therefore, the underlying mechanism of E6-induced hTERT expression remained unclear.

Many recent studies have focused on testing and confirming hTERT promoter interacting transcription factors through analysis of the required cis elements in the hTERT promoter in vitro. However, modulations of protein and DNA elements used for these in vitro assays do not allow study of as-of-yet unknown factors that co-regulate hTERT expression. Therefore, we took an unbiased approach to identify proteins that bind to the hTERT core promoter in human cells in vivo using a LacO-LacI system. This screen has been successfully used in yeast to identify specific DNA interacting proteins (Akiyoshi et al., 2009). We adapted this system for human cells and using this approach, we not only confirmed previously identified hTERT transcriptional regulators, such as Myc/Max and Sp1, but we revealed two new proteins bound to the hTERT promoter, Foxc1 and Maz, that by functional siRNA screen regulated hTERT expression. Foxc1 is a member of the superfamily of forkhead transcription factors, and has been shown to play roles in multiple developmental processes (Birkenkamp and Coffer, 2003; Coffer and Burgering, 2004). Maz functions as a transcription factor (Himeda, Ranish, and Hauschka, 2008; Tsutsui et al., 1999), and studies have shown that Maz regulates gene expression through binding to the GC-rich elements, which are similar to the hTERT promoter Sp1 binding sites (Song et al., 2003). We found opposing binding of Sp1 and Maz on the hTERT promoter, with the switch mediated by E6. All of these proteins directly affected the chromatin structure of the hTERT promoter through histone acetylation and therefore affect hTERT expression.

These studies highlight a new non-biased protocol to screen for DNA binding proteins found at a gene promoter using mammalian cells. Using this screen, we identified proteins known to bind to our promoter of interest, hTERT, and new transcriptional regulators that affect hTERT expression through chromatin remodeling in E6 expressing keratinocytes. These data support that hTERT repression is multilayered, and multiple factors are targeted for regulation by E6 in HPV-associated disease and cancers to drive telomerase activity and oncogenic progression.

MATERIAL AND METHODS

Cell culture

HeLa cells, 293T cells, and HCT116 cells were cultured as described previously (Katzenellenbogen et al., 2010; Xu et al., 2010). Briefly, they were grown in Dulbecco's modified Eagle's medium (DME medium, Life Technologies, Carlsbad, CA) containing 10% fetal bovine serum and penicillin-streptomycin. 293TT cells (Buck et al., 2004) were grown in DME medium containing 10% fetal bovine serum and penicillin-streptomycin, supplemented with 1% Non-Essential Amino-acids, 1% Glutamax. 293TT cells were under hygromycin selection to maintain the expression of T-antigen. Primary HFKs were derived from neonatal foreskin and grown in Epilife medium supplemented with 60 μM calcium chloride and human keratinocyte growth supplement (Life Technologies, Carlsbad, CA). Primary HFKs cells stably expressing HPV16 E6 and control vector LXSN were previously described (Gewin and Galloway, 2001).

Plasmids and RNAi

The pYLacO plasmid was constructed as following: The pYseap vector (Pastrana et al., 2004) was digested with BamHI and ApoI restriction enzymes to obtain the fragment containing the pUC ori and Blasticidin R cDNA driven by the SV40 early promoter, which also encodes the SV40 ori. This fragment was ligated with sequences containing three copies of LacO that had been digested with BglII and EcoRI restriction enzymes. The pyLacO-hTERTp plasmid was constructed by releasing the hTERT promoter (−725 to +61bp) region from pGL3-hTERTp by digestion with HindIII and NcoI, followed by insertion into pYLacO vector. These constructs have been confirmed by sequencing. The plasmid pLacI-Flag was obtained from Dr. Sue Biggins (Akiyoshi et al., 2009). Plasmids expressing cDNA of HA-tagged Maz and the control vector were obtained from Dr. Thomas Shenk. siRNAs used in this study are listed as follows: Myc siRNA #1:GCUUGUACCUGCAGGAUCUTT #2: CGAUGUUGUUUCUGUGGAATT; Sp1 siRNA #1: TTGGGTAAGTGTGTTGTTTAA #2: TCCCAGAAAGTATATACTGAA; Maz siRNA #1: CTCGGCTTATATTTCGGACCA #2: TCCTATTTCCCTACCAACCAA; Foxc1 siRNA #1: AACGGGAATAGTAGCTGTCAA #2: CTCCAGTGAACGGGAATAGTA; Control siRNA specific to Luciferase #1: AACGTACGCGGAATACTTCGA #2: AACTTACGCTGAGTACTTCGA.

Transfection and infection

DNA was transiently transfected into 293T, 293TT and HeLa cells using FuGENE6 (Roche, Alameda, CA). siRNA oligos were transiently transfected into cells using Lipofectamine RNAiMax reagents (Life Technologies, Carlsbad, CA). Stably expressing of E6 HFK and LXSN HFK cells were obtained by viral transduction as previously described (Xu et al., 2008).

Western blot and antibodies

Mouse anti-HA (12CA5, Roche, Alameda, CA); Goat anti-Foxc1 (ab5079, Abcam, Cambridge, MA); Mouse-anti-Flag (M2, Sigma, St. Louis, MO); GAPDH (Abcam, Cambridge, MA); p53Ab6 (Calbiochem, LaJolla, CA); and Rabbit-anti-acetyl-Histone H4 (Upstate, Lake Placid, NY) were used; All other antibodies including Mouse anti-Myc (C33), Rabbit anti-Maz, Rabbit anti-Sp1, Rabbit-anti-Gcn5 (H-75), Goat anti-Actin (I-19) and Mouse anti-nucleolin were from Santa Cruz Biotechnology, Santa Cruz, CA.

Quantitative RT-PCR

Total RNAs were extracted from tissue culture plates using RNeasy mini Kit (Qiagen, Valencia, CA). One microgram of total RNA was used to synthesize cDNA using Iscript cDNA synthesis kit (Bio-Rad, Hercules, CA). Real-time quantitative PCR (qPCR) using power SYBR green (ABI Prism, London, UK) was conducted on an ABIPrism 9700 and analyzed with SDS 2.2.2 software. hTERT primers and 36B4 primers (as internal control) used in real-time PCR were previously described (Xu et al., 2008).

LacO-LacI immunoprecipitation assay

100 μg anti-Flag antibody (M2, Sigma, St. Louis, MO) was crosslinked with prewashed Protein G-Dynabeads using crosslinking solution (20mM DMP in 0.2M triethanolamine, pH8.2) for 40 minutes. 293TT cells from 5 × p150 plates were harvested after three hours treatment with 10 μM MG-132 and lysed in NP40 lysis buffer. Cell lysates were precleared with Protein G-Dynabeads and then incubated with antibody-conjugated Dynabeads overnight at 4°C. After overnight incubation with Protein G-Dynabeads, the beads were rinsed three times with NP40 lysis buffer, washed three times with NP40 lysis buffer, three times with pre-Elution buffer (50mM Tris pH8.3, 75mM KCl and 1mM EGTA), and eluted in 250 μL Elution buffer (50mM Tris pH 8.3, 1% Rapigest and 1mM EDTA). Immunoprecipitates were separated by SDS-PAGE and immunoblotted with each specific antibody.

Mass spectrometry analysis

The sample elutions were proteolytically digested by adding 0.25 μg of sequencing-grade trypsin (Promega, Madison, WI) and incubating them at 37°C for eighteen hours. The peptides were then concentrated using Millipore Zip-Tip u-c18 Pipette tip and eluted with 10 μL 50% Acetonitrile. The peptides were dried down using a speed vacuum and resuspended in 7 μL 0.1% Formic acid. The digested samples were analyzed on the Thermo finnigan LTQ mass-spec instrument (Thermo Fisher scientific, Waltham, MA). Data were collected in a data-dependent mode, and MS scans were followed by MS/MS scans of the most abundant ions from the preceding MS scan. Proteins were identified by searching against IPI human database (EBI) using X!Tandem search engine on CPAS (Computational, proteomic analysis system, FHCRC). Protein identification results were filtered by using raw scores greater than 200 for +1 ions, 300 for +2 ions, and 300 for +3 ions; Z scores greater than or equal to 3; percent ions greater than or equal to 15%; and unique peptides greater than or equal to 2.

Chromatin immunoprecipitation assay

Chromatin Immunoprecipitation assays for anti-AcH4 and anti-Myc antibodies were conducted as previously described (Xu et al., 2008). Chromatin immunoprecipitation assays for Gcn5, Tip60, Sp1, Maz, and Foxc1 were conducted using protocols from Santa Cruz Biotechnology, Santa Cruz, CA. Antibodies used for ChIP assay including Goat anti-Foxc1 (ab5079, Abcam, Cambridge, MA); All other antibodies including Rabbit anti-Maz (sc-28745×), Goat anti-Sp1 (sc-59×), Rabbit anti-Gcn5, and Rabbit anti-Tip60 are from Santa Cruz Biotechnology, Santa Cruz, CA. Rabbit and Goat control IgG are from Santa Cruz Biotechnology, Santa Cruz, CA. Primers for both hTERT promoter and control β-globin promoter in ChIP assay were previously described (Xu et al., 2008). Assays were normalized to control IgG or β-globin based on their consistency across repeated experiments within a specific protocol.

RESULTS

Characterization of the LacO-LacI system in mammalian cells

The majority of studies on regulation of hTERT expression have focused on testing putative transcription factors that likely bound to the hTERT promoter based on sequences motifs. Here in contrast, we adapted a LacO-LacI system initially developed in yeast to identify hTERT transcription regulators in human cells (Figure 1A). To overcome the low copy number of transfected plasmids in mammalian cells, pYLacO was constructed to contain the SV40 origin and three copies of the LacO sequence. The SV40 origin drives plasmid replication under the regulation of large T antigen expressed by the 293TT; approximately 500 copies of the plasmid per cell 24 hours after transfection, and 2000 copies per cell 48 hours after transfection, were detected using these plasmid modifications (data not shown). The core 787 base pair (bp) hTERT promoter (−725 bp to +61 bp) was inserted into pYLacO to give the pYLacO-hTERTp plasmid. With the SV40 origin driving plasmid amplification, there was a significant increase in the number of hTERT promoter sites to which factors could bind. pYLacO-hTERTp and the Flag-tagged LacI (LacI-Flag) construct were co-transfected into 293TT cells. This allowed the LacI-Flag protein to bind to the three LacO elements in pYLacO-hTERTp. Immunoprecipitation by anti-Flag antibody then pulled down the expressed LacI-Flag, its interacting plasmid pYLacO-hTERTp, and endogenous 293TT proteins bound to the pYLacO-hTERTp. Proteins were identified by Mass Spectrometry (MS) analysis (Figure 1A).

Figure 1. Characterization of the LacO-LacI system in 293TT cells.

Figure 1

Open in a new tab

A: Schematic diagram of the LacO-LacI system adapted in 293TT cells. Proteins bound to the pYLacO-hTERTp plasmid containing LacO repeats were captured by LacI-Flag affinity purification. B: Venn diagram of proteins identified in LacI-Flag only, LacI-Flag cotransfected with pYLacO, and LacI-Flag cotransfected with pYLacO-hTERTp by MS analysis.

Two controls were used in this experiment in parallel: first, cells were transfected with LacI-Flag only, to exclude proteins bound to the LacI-Flag protein, the anti-Flag antibody or to the beads. Second, cells were co-transfected with LacI-Flag and pYlacO (lacking the hTERT promoter), to identify proteins that bound to non-hTERT sequences such as the SV40 promoter. Stringent filter parameters and at least two unique peptides were required to identify a given protein by MS analysis. Twenty-two proteins were identified in all three experimental samples, indicating that they may be non-specifically bound (Figure 1B). Fifty proteins were identified in both the pYLacO and pYLacO-hTERTp samples (Figure 1B); these proteins could be bound bound to sequences common to the pYLacO backbone, or to both the backbone and the hTERT promoter. Thirty-five proteins were found to be unique in the pYLacO-hTERTp sample (Figure 1B). Complete lists of these proteins are shown in the Supplementary Tables S1 and S2.

Confirmation of putative hTERT regulator in HFKs

Although 293TT cells were used for the LacO-LacI screen to identify hTERT promoter-binding proteins in mammalian cells as 293TT cells could amplify the copy number of the transfected plasmid up to 2,000 fold per cells, we were interested in the regulation of hTERT expression in HFK cells and specifically in E6-expressing HFK cells. Of the 85 proteins identified as bound to the pYLacO-hTERTp and/or pYLacO backbone plasmid in 293TT cells (Supplementary Table 1), 21 proteins with known transcriptional activity were chosen for further screening in HFKs. Each was tested as a potential regulator of hTERT expression in HFK cells with and without E6 by a siRNA screen, with two independent siRNAs targeting each individual genes for knock down. Four proteins showed consistent effects on hTERT expression in E6 HFKs when they were knocked down, as shown in Table 1. Myc and Sp1 were confirmed by siRNA as transcriptional activators of hTERT in E6 HFKs, and two novel hTERT repressors were found in the LacO-LacI screen, Maz and FoxC1, (Table 1).

Table 1.

hTERT regulators identified by small RNA interference

Gene symbol Gene ID siRNA #1* siRNA #2*
Myc NM_002467 − − − −
Sp1 NM_138473 − − −
Maz NM_002383 +++ +
Foxc1 NM_001453 ++ +
Control (Luciferase) x65324 NC NC
Open in a new tab
*

hTERT mRNA level:

+: up more than 1.75 fold;

++: up more than 3 fold;

+++: up more than 6 fold;

−: down more than 1.75 fold;

−−: down more than 3 fold;

NC-no change

E6 expression regulated Maz and Sp1 binding at the hTERT promoter

Sp1, a known transcriptional regulator of hTERT in E6 expressing cells (Kyo et al., 2000; Pang, Chen, and Wu, 2002), was confirmed in the LacO-LacI screen. As the SV40 regulatory region contains GC-rich Sp1 binding sites, and Sp1 has also been shown to bind the SV40 early promoter (Dynan et al., 1985; Dynan and Tjian, 1983), we were encouraged that Sp1 was found in both the pYLacO-hTERTp and pYLacO samples (Table S1). Maz was also identified in the LacO-LacI screen, and it is a transcriptional repressor known to bind to GC-rich elements in promoters (Himeda, Ranish, and Hauschka, 2008; Parks and Shenk, 1996; Song et al., 2003),

First, expression of both Sp1 and Maz was confirmed by Western blot in HFKs, and the steady state levels were not altered by E6 (Figure 2A). Second, when Sp1 was knocked down by two different siRNAs in E6 expressing HFKs, there was a parallel decrease in hTERT expression (Table 1). Third, ChIP assay was used to confirm the specific binding of Sp1 and Maz to the hTERT promoter. A fourfold enrichment of Maz was detected in HFKs (Figure 2B), but surprisingly this was reduced to background IgG levels with E6 expression (Figure 2B). Conversely, Sp1 was at background levels in HFKs but was increased three fold at the promoter of E6 expressing HFKs (Figure 2B). The change in promoter occupancy of Maz and Sp1 is not mediated by changes in the levels of these proteins but is facilitated by some as yet uncharacterized activity of E6.

Figure 2. E6 altered the binding of Maz and Sp1 at the hTERT promoter in HFKs without changing their total protein levels.

Figure 2

Open in a new tab

A: E6 expression did not change total protein levels of Maz and Sp1 in HFKs. (Loss of p53 expression used as an indicator of E6 expression, and C23 used as a loading control.) B: ChIP showed Maz was enriched at the hTERT promoter in HFKs, and Sp1was enriched at the hTERT promoter in E6-HFKs.. (β-globin used as an internal control. Error bars represent standard deviations of multiple PCRs from two independent experiments.)

Knock down of Maz in E6 HFKs further induced histone acetylation at the hTERT promoter

Although we only detected a background level of Maz at the hTERT promoter in E6 HFKs, knock down of Maz by siRNA (Figure 3A) resulted in increased hTERT mRNA expression (Figure 3B and Table 1). However, knock down of Maz in HFKs in the absence of E6 did not induce hTERT expression (Figure 3B), indicating that multiple repressors may be involved in blocking hTERT expression in HFKs.

Figure 3. Knock down of Maz in E6 HFKs further induced histone acetylation at the hTERT promoter.

Figure 3

Open in a new tab

A: Knock down of Maz by siRNAs was determined by western blot analysis. (C23 used as a loading control). B: hTERT mRNA expression was increased by knock down of Maz in E6 HFKs, but not in HFKs alone. (36B4 used as an internal normalizing control. Error bars represent standard deviations of multiple PCRs from two independent experiments.) C: ChIP of AcH4 at the hTERT promoter in E6 HFKs showed augmentation of AcH4 with Maz knock down in E6 HFKs. (Error bars represent standard deviations of multiple PCRs from two independent experiments.)

To determine if Maz regulated hTERT expression through histone modifications, as do NFX1-91 and other transcriptional repressors, we knocked down Maz in E6 HFKs and performed ChIP for acetylated histone H4 at the hTERT promoter. We detected an increased level of AcH4 at the hTERT promoter with E6 expression that was augmented by knock down of Maz (Figure 3C). Therefore, the removal of Maz from the hTERT promoter by E6 (Figure 2B) coupled with further knock down of Maz by siRNA, led to increased hTERT expression and histone acetylation at the hTERT promoter (Figure 3B and C).

Overexpression of Maz in cell lines reduced hTERT expression

Because Maz was an important transcriptional repressor of hTERT in HFKs, we wanted to determine the expression of Maz in different cell types. We found that Maz was expressed in all cell types tested, however at varying amounts (Figure 4A). Considerably more Maz expression was detected in HFKs that do not express hTERT, and relatively less in HCT116, HeLa and 293T cells, which do express hTERT. As the expression level of Maz was low in HeLa and 293T cells, we chose to overexpress HA-tagged Maz in these cell lines and quantify any change in hTERT expression (either driven by E6 expression in HeLa cells, or not in 293T cells). HA-tagged Maz (HA-Maz) was overexpressed in both 293T cells and HeLa cells (Figure 4B), resulting in decreased in hTERT mRNA levels (Figure 4C). Thus Maz may be a general repressor of hTERT transcription.

Figure 4. Overexpression of Maz repressed hTERT expression in both 293T and HeLa cells.

Figure 4

Open in a new tab

A: Western blot analysis showed variable expression of Maz in HFKs and cell lines. (GAPDH used as a loading control). B: Overexpression of HA-tagged Maz (HA-Maz) in both 293T and HeLa cells by western blot analysis. (C23 used as a loading control). C: Overexpression of HA-Maz reduced the hTERT mRNA levels in 293T and HeLa cells. (Error bars represent standard deviations of multiple PCRs from two independent experiments. 36B4 used as an internal normalizing control.)

Max and Myc induced hTERT expression in HFKs through enhanced histone acetylation regulation

Max was the most abundant protein co-purified with the pYLacO-hTERTp construct (See Supplementary Table S2). It is a transcriptional regulator that directly binds DNA and regulates gene expression through forming either a homodimer with itself or a hetermodimer with multiple transcriptional activators and repressors (Baudino and Cleveland, 2001; McDuff et al., 2009) including Myc. Myc/Max heterodimers have been previously shown to bind to the hTERT promoter at E boxes that flank the transcription start site and upregulate transcription in multiple cell types (Greenberg et al., 1999; Kyo et al., 2000; Veldman et al., 2003; Xu et al., 2001). Although Max, but not Myc, was detected by MS analysis in the LacO-LacI screen, Myc was also not detected in another MS analysis where it was shown to be a co-purifying protein by other methods (Dominguez-Sola et al., 2007). Therefore, we tested by Western blot for the presence of both Max and Myc in the anti-Flag IPs from the pYLacO-hTERTp containing 293TT cells. As a control a pYLacO-hTERTp plasmid, containing mutant E boxes in the hTERT promoter was transfected into 293TT cells. Max and Myc were both immunoprecipitated by LacI-Flag using the wildtype hTERT promoter plasmid, but not with the E box mutant promoter (Figure 5A).

Figure 5. Myc/Max regulated histone acetylation at the hTERT promoter.

Figure 5

Open in a new tab

A: Myc and Max co-purified by IP-western blot analysis with wildtype pYLacO-hTERTp but not when the hTERT E-boxes were mutated in 293TT cells. B: Tip60 and p53 expression in E6 versus vector (LXSN) HFKs and HeLa cells by western blot analysis. (Loss of p53 expression used as an indicator of E6 expression, and GAPDH used as a loading control.) C: Increased levels of both Gcn5 and Tip60 bound to the hTERT promoter in E6 HFKs by ChIP assay. D: Knock down of Myc by siRNA in E6 HFKs reduced total acetylated histone H4 (AcH4) protein in E6 HFKs by western blot analysis. (C23 used as a loading control) E: Knock down of Myc reduced the relative level of AcH4 by half at the hTERT promoter by ChIP assay. (β-globin used as an internal control for C and E. Error bars represent standard deviations of multiple PCRs from two independent experiments.)

We and others have shown that Myc plays a role in regulating E6-induced hTERT expression in HFK cells (Gewin and Galloway, 2001; Veldman et al., 2003; Xu et al., 2008). Myc is also known to recruit histone acetyltransferases (HATs) to promoters and increase gene expression (Frank et al., 2001; Knoepfler, 2007). Multiple HATs have been shown to interact with Myc and regulate Myc-dependent histone acetylation, including Gcn5 and Tip60 (Frank et al., 2003; Kenneth et al., 2007). Although the steady state levels of Tip60 are reduced by high-risk E6 (Figure 5B) (Jha et al., 2010), like Gcn5, Tip60 was increased at the hTERT promoter in E6-expressing HFKs (Figure 5C). This parallels chromatin immunoprecipitation and expression data of Tip60 at the HPV promoter in HeLa cells (Jha et al., 2010). Because Myc can recruit HAT to increase acetylated histones at the hTERT promoter, if Myc were knocked down, it could decrease histone acetylation. Indeed, knock down of Myc by two different siRNAs in E6 HFKs resulted in a decrease in the total amount of acetylated histone H4 (AcH4) (Figure 5D), as well as a specific decrease in the level of AcH4 at the hTERT promoter (Figure 5E). Overall this suggests that Myc/Max heterodimers recruit histone acetylases to E boxes in the hTERT promoter of E6 expressing HFKs to regulate hTERT transcription.

DISCUSSION

hTERT expression is critical for both cell immortalization and transformation, as well as maintaining a normal stem cell state (Ju and Rudolph, 2006). Studying mechanisms by which hTERT transcription is regulated in both normal and cancer cells is important and has broad biologic implications. ChIP analysis is a good method to determine the DNA-protein interactions in vivo. However, it is dependent on the availability of highly sensitive and specific antibodies. In this study, we developed a new system to identify DNA-interacting proteins in human cells by immunoprecipitating DNA-protein complexes with a Flag-tagged LacI protein bound to LacO elements in high copy number plasmids. Proteins in these complexes can be identified by MS analysis or interrogated by western blot assay. Using this LacO-LacI screen, new transcriptional regulators were identified, Maz and Foxc1, and the previously known hTERT regulators Myc and Sp1 were confirmed.

Interestingly, Maz bound to the hTERT promoter in HFK cells, and E6 expression reduced Maz binding and correspondingly increased Sp1 binding at the hTERT promoter (Figure 2B). Knock down of Maz further induced histone acetylation at the hTERT promoter, as well as hTERT expression in the presence of E6 (Figure 3B and C). Although knock down of Maz alone was not able to induce hTERT expression, it is likely that Maz adds to the repression of the hTERT gene with another previously reported repressor NFX1-91. Degradation of NFX1-91 releases the inhibitory mSin3A-HDAC complex (Gewin et al., 2004; Xu et al., 2008), which facilitates Myc's recruitment of HATs to the hTERT promoter. With the removal of Maz at the hTERT promoter by E6, Sp1 was able to bind and cooperate with Myc to remodel the chromatin structure and upregulate hTERT transcription. Our data suggest that both Tip60 and Gcn5 HAT complexes played roles in regulating E6-induced hTERT transcription, likely due to their shared binding affinity to TRRAP. This is also supported by a published study indicating multiple HATs can bind to the same gene promoter and may regulate expression of the same gene (Wang et al., 2009).

E6 induced the exchange of Maz and Sp1 at the hTERT promoter without causing any change in their total protein levels (Figure 2). Casein Kinase 2 (CK2) has been shown to regulate the phosphorylation of both Maz and Sp1, which affects their DNA binding activity and transcriptional activities (Armstrong et al., 1997; Tsutsui et al., 1999), and as such it is interesting to consider whether E6 may also directly regulate DNA binding activity of Maz and Sp1, either through protein modifications or changes in chromatin structure at the hTERT promoter. Although we did not detect a significant change in Maz protein levels in E6 expressing HFK cells, a lower Maz expression level was found in HeLa cells (Figure 4A), which expresses HPV18 E6. It is possible that other factors in HeLa cells may affect Maz expression.

We also found that Foxc1 may regulate hTERT transcription (Table 1), although we were unable to detect Foxc1 direct binding at the hTERT promoter by ChIP assay (data not shown). This may be due to the lack of high quality, ChIP-grade, Foxc1 antibodies. Alternatively, Foxc1 could be indirectly regulating other factors that regulate hTERT transcription. Previous studies indicated that Foxc1 is a TGFβ signaling responsive gene in breast cancer cells (Zhou et al., 2002), so it will be interesting to determine whether Foxc1 plays a role in TGFβ signaling-regulated hTERT expression in specific cell types.

NFX1-91 was found to bind to the hTERT promoter in our previous studies (Gewin et al., 2004; Xu et al., 2008) but was not identified by the MS analysis in this LacO-LacI screen. Like Myc, NFX1-91 has a short half-life, and as such may be present in low amounts in the Flag-Lac IPs. Alternatively many proteins do not ionize well in MS, which may be the case for Myc. Additionally, there are limitations to the LacO-LacI system design itself. The LacO-LacI system depends of detectable levels of proteins for MS analysis or western blot assay, and low abundance or unstable proteins may be difficult to capture and detect using this screen. Second, plasmids may not have the same chromatin status as genomic DNA. Finally, factors that bind to the hTERT promoter could be different in 293TT cells versus HFKs or could be detected only by repeated analyses. It should be noted that other previously reported hTERT transcriptional regulators, such as Sip1, Menin, Wt1 and Mzf-2, were not identified in our MS analysis, however, their binding sites had been mapped outside the core hTERT promoter contained in pYLacO-hTERTp (Fujimoto et al., 2000; Lin and Elledge, 2003; Oh et al., 1999), so this was not unexpected.

It was interesting to find that both activators and repressors bound to the hTERT promoter in the LacO-LacI system, even though hTERT expression is activated in 293TT cells. There are several reasons why this may have occurred. First, there is a balance of negative and positive factors acting on any given gene, even those that are actively expressed (Eberharter, Ferreira, and Becker, 2005). Secondly, plasmids were purified from unsynchronized cells, so the combination of both activators and repressors being detected could be due to cells being collected during different times in the cell cycle. Third, different chromatin conformations (open or closed state) may be adopted for each individual plasmid based on its localization within the nucleus, so different proteins were recruited by different plasmids.

In summary, a transcription factor binding system developed in yeast was successfully adapted for use in mammalian cells. With that system, we identified new transcriptional regulators of hTERT expression in HFKs and further defined the concurrent, layered regulation of a gene critical to HPV- associated cancer development.

Supplementary Material

01
02

  • Yeast LacO-LacI system was adapted to identify promoter bound proteins in human cells

  • New transcriptional repressors were identified on the hTERT promoter with this system

  • These transcriptional repressors were regulated during E6-induced hTERT expression

Acknowledgements

We thank Kristin L. Robinson for assisting with tissue culture, Philip R. Gafken and Deepa R. Hedge in the proteomics facility at FHCRC for helping with the Mass Spectrometry analysis, Sue Biggins, Bungo Akiyoshi and Toshi Tsukiyama at FHCRC for providing the LacO vector and sharing their expertise, Thomas Shenk (Princeton University) for providing the HA-tagged Maz cDNA construct, and Ann Roman for critical review of this manuscript.

Funding Research reported in this publication was supported by the National Cancer Institute of the National Institutes of Health under award number R01CA064795 to D.A.G and K08CA131171 to R.A.K. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Akiyoshi B, Nelson CR, Ranish JA, Biggins S. Quantitative proteomic analysis of purified yeast kinetochores identifies a PP1 regulatory subunit. Genes Dev. 2009;23(24):2887–99. doi: 10.1101/gad.1865909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Armstrong SA, Barry DA, Leggett RW, Mueller CR. Casein kinase II-mediated phosphorylation of the C terminus of Sp1 decreases its DNA binding activity. J Biol Chem. 1997;272(21):13489–95. doi: 10.1074/jbc.272.21.13489. [DOI] [PubMed] [Google Scholar]
  3. Baudino TA, Cleveland JL. The Max network gone mad. Mol Cell Biol. 2001;21(3):691–702. doi: 10.1128/MCB.21.3.691-702.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bedard KM, Underbrink MP, Howie HL, Galloway DA. The E6 oncoproteins from human betapapillomaviruses differentially activate telomerase through an E6AP-dependent mechanism and prolong the lifespan of primary keratinocytes. J Virol. 2008;82(8):3894–902. doi: 10.1128/JVI.01818-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Birkenkamp KU, Coffer PJ. Regulation of cell survival and proliferation by the FOXO (Forkhead box, class O) subfamily of Forkhead transcription factors. Biochem Soc Trans. 2003;31(Pt 1):292–7. doi: 10.1042/bst0310292. [DOI] [PubMed] [Google Scholar]
  6. Blackburn EH. Switching and signaling at the telomere. Cell. 2001;106(6):661–73. doi: 10.1016/s0092-8674(01)00492-5. [DOI] [PubMed] [Google Scholar]
  7. Bryce LA, Morrison N, Hoare SF, Muir S, Keith WN. Mapping of the gene for the human telomerase reverse transcriptase, hTERT, to chromosome 5p15.33 by fluorescence in situ hybridization. Neoplasia. 2000;2(3):197–201. doi: 10.1038/sj.neo.7900092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Buck CB, Pastrana DV, Lowy DR, Schiller JT. Efficient intracellular assembly of papillomaviral vectors. J Virol. 2004;78(2):751–7. doi: 10.1128/JVI.78.2.751-757.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cheng YW, Wu TC, Chen CY, Chou MC, Ko JL, Lee H. Human telomerase reverse transcriptase activated by E6 oncoprotein is required for human papillomavirus-16/18-infected lung tumorigenesis. Clin Cancer Res. 2008;14(22):7173–9. doi: 10.1158/1078-0432.CCR-08-0850. [DOI] [PubMed] [Google Scholar]
  10. Coffer PJ, Burgering BM. Forkhead-box transcription factors and their role in the immune system. Nat Rev Immunol. 2004;4(11):889–99. doi: 10.1038/nri1488. [DOI] [PubMed] [Google Scholar]
  11. Cong YS, Wen J, Bacchetti S. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum Mol Genet. 1999;8(1):137–42. doi: 10.1093/hmg/8.1.137. [DOI] [PubMed] [Google Scholar]
  12. Dominguez-Sola D, Ying CY, Grandori C, Ruggiero L, Chen B, Li M, Galloway DA, Gu W, Gautier J, Dalla-Favera R. Non-transcriptional control of DNA replication by c-Myc. Nature. 2007;448(7152):445–51. doi: 10.1038/nature05953. [DOI] [PubMed] [Google Scholar]
  13. Dynan WS, Saffer JD, Lee WS, Tjian R. Transcription factor Sp1 recognizes promoter sequences from the monkey genome that are simian virus 40 promoter. Proc Natl Acad Sci U S A. 1985;82(15):4915–9. doi: 10.1073/pnas.82.15.4915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dynan WS, Tjian R. The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell. 1983;35(1):79–87. doi: 10.1016/0092-8674(83)90210-6. [DOI] [PubMed] [Google Scholar]
  15. Eberharter A, Ferreira R, Becker P. Dynamic chromatin: concerted nucleosome remodelling and acetylation. Biol Chem. 2005;386(8):745–51. doi: 10.1515/BC.2005.087. [DOI] [PubMed] [Google Scholar]
  16. Frank SR, Parisi T, Taubert S, Fernandez P, Fuchs M, Chan HM, Livingston DM, Amati B. MYC recruits the TIP60 histone acetyltransferase complex to chromatin. EMBO Rep. 2003;4(6):575–80. doi: 10.1038/sj.embor.embor861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Frank SR, Schroeder M, Fernandez P, Taubert S, Amati B. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 2001;15(16):2069–82. doi: 10.1101/gad.906601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fu B, Quintero J, Baker CC. Keratinocyte growth conditions modulate telomerase expression, senescence, and immortalization by human papillomavirus type 16 E6 and E7 oncogenes. Cancer Res. 2003;63(22):7815–24. [PubMed] [Google Scholar]
  19. Fujimoto K, Kyo S, Takakura M, Kanaya T, Kitagawa Y, Itoh H, Takahashi M, Inoue M. Identification and characterization of negative regulatory elements of the human telomerase catalytic subunit (hTERT) gene promoter: possible role of MZF-2 in transcriptional repression of hTERT. Nucleic Acids Res. 2000;28(13):2557–62. doi: 10.1093/nar/28.13.2557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gabet AS, Accardi R, Bellopede A, Popp S, Boukamp P, Sylla BS, Londono-Vallejo JA, Tommasino M. Impairment of the telomere/telomerase system and genomic instability are associated with keratinocyte immortalization induced by the skin human papillomavirus type 38. Faseb J. 2008;22(2):622–32. doi: 10.1096/fj.07-8389com. [DOI] [PubMed] [Google Scholar]
  21. Gewin L, Galloway DA. E box-dependent activation of telomerase by human papillomavirus type 16 E6 does not require induction of c-myc. J Virol. 2001;75(15):7198–201. doi: 10.1128/JVI.75.15.7198-7201.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gewin L, Myers H, Kiyono T, Galloway DA. Identification of a novel telomerase repressor that interacts with the human papillomavirus type-16 E6/E6-AP complex. Genes Dev. 2004;18(18):2269–82. doi: 10.1101/gad.1214704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Greenberg RA, O'Hagan RC, Deng H, Xiao Q, Hann SR, Adams RR, Lichtsteiner S, Chin L, Morin GB, DePinho RA. Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. Oncogene. 1999;18(5):1219–26. doi: 10.1038/sj.onc.1202669. [DOI] [PubMed] [Google Scholar]
  24. Hayflick L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 1965;37:614–36. doi: 10.1016/0014-4827(65)90211-9. [DOI] [PubMed] [Google Scholar]
  25. Himeda CL, Ranish JA, Hauschka SD. Quantitative proteomic identification of MAZ as a transcriptional regulator of muscle-specific genes in skeletal and cardiac myocytes. Mol Cell Biol. 2008;28(20):6521–35. doi: 10.1128/MCB.00306-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hiyama E, Hiyama K. Telomerase as tumor marker. Cancer Lett. 2003;194(2):221–33. doi: 10.1016/s0304-3835(02)00709-7. [DOI] [PubMed] [Google Scholar]
  27. Horikawa I, Barrett JC. Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms. Carcinogenesis. 2003;24(7):1167–76. doi: 10.1093/carcin/bgg085. [DOI] [PubMed] [Google Scholar]
  28. Hou M, Wang X, Popov N, Zhang A, Zhao X, Zhou R, Zetterberg A, Bjorkholm M, Henriksson M, Gruber A, Xu D. The histone deacetylase inhibitor trichostatin A derepresses the telomerase reverse transcriptase (hTERT) gene in human cells. Exp Cell Res. 2002;274(1):25–34. doi: 10.1006/excr.2001.5462. [DOI] [PubMed] [Google Scholar]
  29. James MA, Lee JH, Klingelhutz AJ. HPV16-E6 associated hTERT promoter acetylation is E6AP dependent, increased in later passage cells and enhanced by loss of p300. Int J Cancer. 2006;119(8):1878–85. doi: 10.1002/ijc.22064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jha S, Vande Pol S, Banerjee NS, Dutta AB, Chow LT, Dutta A. Destabilization of TIP60 by human papillomavirus E6 results in attenuation of TIP60-dependent transcriptional regulation and apoptotic pathway. Mol Cell. 2010;38(5):700–11. doi: 10.1016/j.molcel.2010.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ju Z, Rudolph KL. Telomeres and telomerase in stem cells during aging and disease. Genome Dyn. 2006;1:84–103. doi: 10.1159/000092502. [DOI] [PubMed] [Google Scholar]
  32. Katzenellenbogen RA, Vliet-Gregg P, Xu M, Galloway DA. Cytoplasmic poly(A) binding proteins regulate telomerase activity and cell growth in human papillomavirus type 16 E6-expressing keratinocytes. J Virol. 2010;84(24):12934–44. doi: 10.1128/JVI.01377-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kenneth NS, Ramsbottom BA, Gomez-Roman N, Marshall L, Cole PA, White RJ. TRRAP and GCN5 are used by c-Myc to activate RNA polymerase III transcription. Proc Natl Acad Sci U S A. 2007;104(38):14917–22. doi: 10.1073/pnas.0702909104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Knoepfler PS. Myc goes global: new tricks for an old oncogene. Cancer Res. 2007;67(11):5061–3. doi: 10.1158/0008-5472.CAN-07-0426. [DOI] [PubMed] [Google Scholar]
  35. Kyo S, Takakura M, Taira T, Kanaya T, Itoh H, Yutsudo M, Ariga H, Inoue M. Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT) Nucleic Acids Res. 2000;28(3):669–77. doi: 10.1093/nar/28.3.669. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li H, Lee TH, Avraham H. A novel tricomplex of BRCA1, Nmi, and c-Myc inhibits c-Myc-induced human telomerase reverse transcriptase gene (hTERT) promoter activity in breast cancer. J Biol Chem. 2002;277(23):20965–73. doi: 10.1074/jbc.M112231200. [DOI] [PubMed] [Google Scholar]
  37. Lin SY, Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase. Cell. 2003;113(7):881–9. doi: 10.1016/s0092-8674(03)00430-6. [DOI] [PubMed] [Google Scholar]
  38. Liu X, Yuan H, Fu B, Disbrow GL, Apolinario T, Tomaic V, Kelley ML, Baker CC, Huibregtse J, Schlegel R. The E6AP ubiquitin ligase is required for transactivation of the hTERT promoter by the human papillomavirus E6 oncoprotein. J Biol Chem. 2005;280(11):10807–16. doi: 10.1074/jbc.M410343200. [DOI] [PubMed] [Google Scholar]
  39. Maida Y, Kyo S, Kanaya T, Wang Z, Yatabe N, Tanaka M, Nakamura M, Ohmichi M, Gotoh N, Murakami S, Inoue M. Direct activation of telomerase by EGF through Ets-mediated transactivation of TERT via MAP kinase signaling pathway. Oncogene. 2002;21(26):4071–9. doi: 10.1038/sj.onc.1205509. [DOI] [PubMed] [Google Scholar]
  40. McDuff FO, Naud JF, Montagne M, Sauve S, Lavigne P. The Max homodimeric b-HLH-LZ significantly interferes with the specific heterodimerization between the c-Myc and Max b-HLH-LZ in absence of DNA: a quantitative analysis. J Mol Recognit. 2009;22(4):261–9. doi: 10.1002/jmr.938. [DOI] [PubMed] [Google Scholar]
  41. Oh S, Song Y, Yim J, Kim TK. The Wilms' tumor 1 tumor suppressor gene represses transcription of the human telomerase reverse transcriptase gene. J Biol Chem. 1999;274(52):37473–8. doi: 10.1074/jbc.274.52.37473. [DOI] [PubMed] [Google Scholar]
  42. Oh ST, Kyo S, Laimins LA. Telomerase activation by human papillomavirus type 16 E6 protein: induction of human telomerase reverse transcriptase expression through Myc and GC-rich Sp1 binding sites. J Virol. 2001;75(12):5559–66. doi: 10.1128/JVI.75.12.5559-5566.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Pang JX, Chen XY, Wu SG. Regulation of telomerase activity in Jurkat T cells by transcription factors Sp1 and Sp3. Di Yi Jun Yi Da Xue Xue Bao. 2002;22(6):481–5. [PubMed] [Google Scholar]
  44. Parks CL, Shenk T. The serotonin 1a receptor gene contains a TATA-less promoter that responds to MAZ and Sp1. J Biol Chem. 1996;271(8):4417–30. doi: 10.1074/jbc.271.8.4417. [DOI] [PubMed] [Google Scholar]
  45. Pastrana DV, Buck CB, Pang YY, Thompson CD, Castle PE, FitzGerald PC, Kruger Kjaer S, Lowy DR, Schiller JT. Reactivity of human sera in a sensitive, high-throughput pseudovirus-based papillomavirus neutralization assay for HPV16 and HPV18. Virology. 2004;321(2):205–16. doi: 10.1016/j.virol.2003.12.027. [DOI] [PubMed] [Google Scholar]
  46. Racek T, Mise N, Li Z, Stoll A, Putzer BM. C-terminal p73 isoforms repress transcriptional activity of the human telomerase reverse transcriptase (hTERT) promoter. J Biol Chem. 2005;280(49):40402–5. doi: 10.1074/jbc.C500193200. [DOI] [PubMed] [Google Scholar]
  47. Song J, Ugai H, Nakata-Tsutsui H, Kishikawa S, Suzuki E, Murata T, Yokoyama KK. Transcriptional regulation by zinc-finger proteins Sp1 and MAZ involves interactions with the same cis-elements. Int J Mol Med. 2003;11(5):547–53. [PubMed] [Google Scholar]
  48. Takakura M, Kyo S, Sowa Y, Wang Z, Yatabe N, Maida Y, Tanaka M, Inoue M. Telomerase activation by histone deacetylase inhibitor in normal cells. Nucleic Acids Res. 2001;29(14):3006–11. doi: 10.1093/nar/29.14.3006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Tsutsui H, Geltinger C, Murata T, Itakura K, Wada T, Handa H, Yokoyama KK. The DNA-binding and transcriptional activities of MAZ, a myc-associated zinc finger protein, are regulated by casein kinase II. Biochem Biophys Res Commun. 1999;262(1):198–205. doi: 10.1006/bbrc.1999.1130. [DOI] [PubMed] [Google Scholar]
  50. Veldman T, Liu X, Yuan H, Schlegel R. Human papillomavirus E6 and Myc proteins associate in vivo and bind to and cooperatively activate the telomerase reverse transcriptase promoter. Proc Natl Acad Sci U S A. 2003;100(14):8211–6. doi: 10.1073/pnas.1435900100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang S, Zhu J. The hTERT gene is embedded in a nuclease-resistant chromatin domain. J Biol Chem. 2004;279(53):55401–10. doi: 10.1074/jbc.M411352200. [DOI] [PubMed] [Google Scholar]
  52. Wang Z, Zang C, Cui K, Schones DE, Barski A, Peng W, Zhao K. Genome-wide mapping of HATs and HDACs reveals distinct functions in active and inactive genes. Cell. 2009;138(5):1019–31. doi: 10.1016/j.cell.2009.06.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Xu D, Popov N, Hou M, Wang Q, Bjorkholm M, Gruber A, Menkel AR, Henriksson M. Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells. Proc Natl Acad Sci U S A. 2001;98(7):3826–31. doi: 10.1073/pnas.071043198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Xu M, Katzenellenbogen RA, Grandori C, Galloway DA. NFX1 plays a role in human papillomavirus type 16 E6 activation of NFkappaB activity. J Virol. 2010;84(21):11461–9. doi: 10.1128/JVI.00538-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xu M, Luo W, Elzi DJ, Grandori C, Galloway DA. NFX1 interacts with mSin3A/histone deacetylase to repress hTERT transcription in keratinocytes. Mol Cell Biol. 2008;28(15):4819–28. doi: 10.1128/MCB.01969-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhou Y, Kato H, Asanoma K, Kondo H, Arima T, Kato K, Matsuda T, Wake N. Identification of FOXC1 as a TGF-beta1 responsive gene and its involvement in negative regulation of cell growth. Genomics. 2002;80(5):465–72. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01
NIHMS510125-supplement-01.docx (16.3KB, docx)
02
NIHMS510125-supplement-02.docx (15.4KB, docx)

RESOURCES