Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Oct 1.
Published in final edited form as: J Immunol. 2013 Aug 30;191(7):3519–3525. doi: 10.4049/jimmunol.1300789

Exacerbation of allergen-induced eczema in TLR4 and TRIF deficient mice is mediated by TRIF

Eric B Brandt *, Aaron M Gibson *, Stacey Bass *, Carolyn Rydyznski *, Gurjit K Khurana Hershey *
PMCID: PMC3788607  NIHMSID: NIHMS512561  PMID: 23997219

Abstract

Despite its presence on resident skin cells, the role of TLR4 in skin diseases remains poorly understood. This is highly significant since the skin biome is rich with potential TLR4 agonists. We aimed to establish the contribution of TLR4 to atopic dermatitis and determine the mechanism by which TLR4 acts in an experimental model of atopic dermatitis (AD). MyD88, TLR4, or TRIF-deficient and wild type (WT) mice were epicutaneously exposed to Aspergillus fumigatus allergen over three weeks. Impaired skin barrier function was assessed by measuring transepidermal water loss (TEWL). Skin levels of innate and adaptive genes were quantified. In an experimental model of AD, TEWL, allergic sensitization and epidermal thickness were increased following cutaneous allergen exposure and these were further enhanced in the absence of TLR4. Increased allergen-induced skin levels of innate (S100A8/A9, IL1β, TNFα and CXCL2) and Th17 genes (IL17A and IL17F) were observed in TLR4 deficient mice compared to wild type mice. The absence of MyD88 alleviated disease (decreased TEWL, skin thickness, proinflammatory cytokines) whereas TRIF deficiency exacerbated disease. In conclusion, signaling through the TLR4 and TRIF pathways limits skin barrier dysfunction, cutaneous allergic sensitization, and proinflammatory cytokine production.

Keywords: atopic dermatitis, skin, TLR4, TRIF, MyD88, IL1, IL17, TSLP, S100A8, S100A9

INTRODUCTION

Atopic dermatitis (AD) is a chronic relapsing inflammatory skin disease whose prevalence in industrialized countries has nearly tripled in the past 30 years (1). A growing body of evidence suggests that defects in the innate immune system promote the development and severity of AD, and underlie the increased susceptibility of these patients to skin pathogens (2). Defects that have been reported in AD include those that affect skin barrier function, expression of antimicrobial proteins, the function and/or expression of pattern recognition receptors, and innate immune cells such as dendritic cell subsets (2). Over 20 studies have reported positive associations between polymorphisms in an essential skin barrier gene (filaggrin) and AD (3). In mice, a spontaneous AD like skin phenotype develops when filaggrin-deficient mice age in a conventional facility underscoring the key role of the skin barrier and environmental pathogens as drivers of disease (4, 5). Staphylococcus aureus colonizes the skin of over 90% of AD patients often promoting disease exacerbations (6).

Toll-like receptors (TLR) are pattern recognition receptors involved in sensing pathogens and helping mount pathogen-specific innate and adaptive immune responses. TLRs have been implicated in super infections of AD lesional skin (2, 7, 8). A SNP in TLR2 was associated with increased severity of S aureus infection in patients with AD (9). Furthermore, S aureus skin infection in TLR2 deficient mice resulted in more severe lesions (10). Genetic polymorphisms in the adaptor protein MyD88 adaptor-like (Mal), TLR9 and CD14, a TLR4 adaptor protein, have also been implicated in AD (11–13). Recently, PCR analysis of 16S rRNA sequences has revealed that residential skin flora is much more diverse than previously thought (14). In mice, Gram-negative bacteria, which are recognized by TLR4, represent the majority of commensal skin flora (15, 16). Accordingly, TLR4 has been implicated in AD specifically in the context of Escherichia coli colonization or vaccinia infection (17, 18).

All TLRs present on keratinocytes, except TLR3, signal through the myeloid differentiation primary-response protein 88 (MyD88). Thus LPS binding to TLR4 at the plasma membrane induces the MyD88 pathway. However LPS can also induce CD14-mediated TLR4 endocytosis, which promotes signaling through TRIF (Toll-interleukin 1 receptor domain-containing adapter-inducing interferon-β) and TRAM (TRIF-related adapter molecule) much like viral RNA binding to TLR3 (19, 20).

Despite the increasingly recognized role of innate immunity in the pathogenesis of AD and the expression of TLR4 on keratinocytes and other innate and adaptive immune cells present in the skin (7, 21), the role of TLR4 in AD has yet to be investigated (2, 5). Herein, our data reveal that whereas signaling through MyD88 promotes allergen induced skin barrier dysfunction, signaling through TLR4 and TRIF is protective.

METHODS

Mice

TLR4, TRIF and MYD88 deficient mice on a C57Bl/6 background and control C57Bl/6 mice (Jackson Laboratory, Bar Harbor, ME) were kept in a specific pathogen-free environment. All procedures were performed in accordance with the ethical guidelines in the Guide for the Care and Use of Laboratory Animals of the Institutional Animal Care and Use Committee approved by the Veterinary Services Department of the Cincinnati Children’s Hospital Medical Center Research Foundation.

Epicutaneous allergen exposure

Mice were anesthetized with Isoflurane (IsoFlo;Abbott Laboratories, North Chicago, Ill) and their backs shaved with an electric razor one day before the first allergen exposure. Either 200μl of sterile saline solution or Aspergillus fumigatus extract (Greer Laboratories, Lenior, NC), resuspended in saline solution at a concentration of 1mg/ml, was applied to a 2 by 2 cm patch of sterile gauze. The patch was secured by TegaDerm and the mouse was wrapped with a Band Aid and waterproof tape. After 6 days, the patch was removed and 24h later a new patch applied for a total of three patches over a three week period as shown in Figure 1A. Endotoxin levels in Aspergillus fumigatus extracts were assessed using the Cambrex QCL1000 assay (1mg/ml contains 1.5–2 EU/ml or 0.3–0.4 ng/ml of endotoxins, resulting 0.06–0.08 ng of endotoxins exposure per patch).

Figure 1. Impaired skin barrier function following Aspergillus fumigatus patches.

Figure 1

Open in a new tab

(A) Experimental protocol time line. (B) One day after each patch removal, transepidermal water loss (TEWL) measurements were obtained within the patched area. (n=4 mice/group; Mean±SEM; 2-way ANOVA with Bonferroni post-tests ***p<0.001). (C) Skin inflammatory score (Kruskal-Wallis ANOVA test p<0.0001 followed by Mann-Whitney test between Aspergillus exposed WT and KO mice * p = 0.018). (D) Epidermal thickness was assessed by morphometric analysis of 3–5 pictures/mouse; representative pictures of mice taken 24h after removal of third patch (n=16–19/group; **p< 0.01 Bonferroni’s Multiple Comparison Test). (E) Plasma Asp-specific IgG1 levels are expressed as OD for a specific dilution. (n=14 mice/group; * p < 0.05 One way ANOVA with Bonferroni’s Multiple Comparison Test).

Measurement of TEWL

TEWL was measured by using DermaLab’s instrument (DermaLab USB module; Cortex Technology, Hadsund, Denmark) as previously described(22). Briefly, TEWL was assessed over a 1-min period by placing the probe against the skin surface in the center of area exposed to the saline/allergen soaked patch. An average of the two readings per mouse was used and TEWL measurements were recorded as grams per meter squared per hour.

Skin Scoring System

Mice were visually assessed for excoriations, erythema and skin thickening in the area covered by the patch. Skin thickening was scored a 0 (thickness comparable to a wild type mouse skin), 1 (slight thickening of skin), 2 (significant thickening of the skin over at least 1/3 of the back) and 3 (significant thickening of the skin over at least 2/3 of the back). Excoriations were scored 0 (no scratches), 1 (1–3 excoriations), 2 (multiple excoriations on 1/3 of the back), 3 (multiple excoriations on most of the back). Measurements were made by two independent investigators and the average of the scores for each parameter was recorded. The total score from the excoriations and thickening are presented as the skin score for each mouse.

Allergen-specific antibody levels

Aspergillus-specific IgG1, IgG2c and IgE plasma levels were measured by ELISA. Briefly, plates were coated with Aspergillus fumigatus extract (100μg/ml) over night at 4°C. Blocking was done with 10% FBS in PBS and all washes were performed with 0.05% Tween-20 in PBS. Plasma samples were diluted 1:10, 25, 100 for IgG1 and 1:5 for IgG2c and IgE. After 2h of incubation, plates were washed and either HRP-conjugated anti-mouse IgG1 (X56; 1:1000; BD Biosciences-Pharmingen), HRP-conjugated anti-mouse IgG2c (1:400; Southern Biotech) or Biotin-anti-mouse IgE (R35-118; 1:250; Pharmingen) were added for 1h, followed by an incubation with streptavidin-HRP (R&D DY998; 1:200) in the case of IgE.) The reaction, generated by the addition of the TMB substrate reagent (BD Biosciences), was stopped with 2N H2SO4; the absorbance was read at 450nm.

Mast cell staining and measurement of skin thickness

Skin tissues were fixed in 10% formalin immediately after mice were euthanized. Paraffin-embedded tissues were cut into 5-μm sections and stained with either H&E to assess skin thickness or with Leder stain to identify mast cells (23). Epidermal thickness was quantified using morphometric software (Image Pro Plus 4.1; Media Cybernetics; Silver Spring, MD).

Immunohistochemistry

Tissue samples were fixed in 10% formalin and processed using standard histological techniques. Briefly, 5μm sections were quenched with H2O2, blocked with 3% normal goat serum, and stained over night at 4°C with rat anti-mouse MBP (1:1000; a kind gift of J. and N. Lee, Mayo Clinic, Scottsdale, AZ) or rat anti-mouse Ly6G (1:200; Biolegend). The slides were washed and incubated with biotinylated anti-rat antibody and avidin-peroxidase complex (Vectastain ABC Peroxidase Elite Kit; Vector Laboratories, Burlingame, CA). The slides were then developed by nickel diaminobenzidin to form black precipitates (DAB Kit; Vector Laboratories), and counterstained with nuclear fast red. Quantification of stained cells per field of dermis was performed blinded (15 to 20 fields at 40x objective were analyzed per skin section).

Lymph node cell isolation and culture

Skin draining inguinal and axillary lymph nodes were pooled and crushed with a syringe rubber through a 70μm cell strainer. Isolated cells were counted and plated at 106 cells per well in a 24 well plate. Cells were then stimulated with Asp (30μg/ml) and cultured at 37C for 5–6 days. IL4 and IL17A levels in culture supernatants were assessed by ELISA according to the manufacturer’s instructions (BioLegend).

Real time PCR

Total RNA was isolated from homogenized mouse skin using Trizol (Invitrogen) according to manufacturer’s instructions and DNase treated (Qiagen, Valencia, CA) before being reverse transcribed with First Strand Superscript Synthesis kit (Invitrogen). Quantitative real-time PCR analysis of murine skin was done using LightCycler FastStart DNA master SYBR green I as a ready-to-use reaction mixture (Roche). cDNA were amplified using the following primers and gene expression was normalized to HPRT; forward: TGCCGAGGATTTGGAAAAAG, reverse: CCCCCCTTGAGCACACAG; IFNγ-forward CAGCAACAGCAAGGCGAAAAAGG, reverse: TTTCCGCTTCCTGAGGCTGGAT; IL4 forward: CTGTAGGGCTTCCAAGGTGCTTCG, reverse: CCATTTGCATGATGCTCTTTAGGC; IL17A forward: ACTACCTCAACCGTTCCACG, reverse: AGAATTCATGTGGTGGTCCA; IL17F forward: TGGAGAAACCAGCATGAAGTG, reverse: AGTCCCAACATCAACAGTAGC; IL17C forward: CTGGAAGCTGACACTCACGA, reverse: ACACAAGCATTCTGCCACC; TSLP forward: TCAATCCTATCCCTGGCTG, reverse: GCATGAAGGAATACCACAATCTTA; IL1β-forward AAGCCTCGTGCTGTCGGACC, reverse: CCAGCTGCAGGGTGGGTGTG; IL6 forward: TGATGCACTTGCAGAAAACA, reverse: ACCAGAGGAAATTTTCAATAGGC; TNFα forward: AGGGTCTGGGCCATAGAACT, reverse: CCACCACGCTCTTCTGTCTAC; S100A8 forward: CCATGCCCTCTACAAGAATG, reverse: ATCACCATCGCAAGGAACTC; S100A9 forward: GAAGGAAGGACACCCTGACA, reverse: GTCCAGGTCCTCCATGATGT; CXCL1 forward: CCACACTCAAGAATGGTCGC, reverse: TCTCCGTTACTTGGGGACAC; CXCL2 forward: CCAACCACCAGGCTACA, reverse: GCCCTTGAGAGTGGCTATGA.

Statistical analysis

Reported values are expressed as mean±SEM. Statistical analysis was performed using Prism 5 (GraphPad Software). One-way ANOVA followed by Bonferroni’s multiple comparison tests was performed on all experiments. Correlations were assessed using Spearman’s nonparametric test. Significance was set at a p value of 0.05.

RESULTS

Exacerbated skin barrier dysfunction in TLR4 deficient mice following repeated cutaneous allergen exposure

One of the cardinal features of atopic dermatitis is an impaired skin barrier, which is commonly demonstrated by measuring increased trans-epidermal water loss (TEWL) (22, 24). In a murine model of AD, TLR4 deficiency did not result in altered TEWL at baseline or in saline-patched mice (Figure 1B). TEWL levels remained unaltered following the first Aspergillus patch and increased after each subsequent exposure to the allergen (Figure 1B). Repeated epicutaneous allergen exposures results in skin inflammation and epidermal thickening as well as other clinical features of atopic dermatitis reflected by elevated skin scores (Figure 1C). Asp-patched TLR4-deficient mice had markedly increased TEWL and skin scores compared to wild type mice (Figure 1B, C).

Because of significant baseline differences between female and male mice in the thickness of their dermis and sub-dermal fatty layer, we examined epidermal thickness. A 3 to 5-fold increase in epidermal thickness was observed between saline and Asp-patched mice (Figure 1D). Epidermal thickness was significantly increased in TLR4 deficient mice compared to wild type mice following the third Aspergillus exposure (Figure 1D). Furthermore, a significant correlation was observed between TEWL and epidermal thickness among Asp-exposed skin samples from WT and TLR4 deficient mice (r=0.38, p=0.018).

Increased sensitization to Aspergillus in TLR4 deficient mice

To assess if the observed skin barrier disruption was associated with increased allergen sensitization via the skin, plasma levels of Asp-specific IgG1, IgG2c and IgE were determined. Three weeks of epicutaneous Aspergillus exposure resulted in measurable levels of Asp-specific IgG1 (Figure 1E), but Asp-specific IgE or IgG2c antibodies were mostly undetectable (data not shown). No significant differences in total baseline IgG1, IgG2c, or IgE levels were observed between naïve TLR4 deficient and wild type mice (data not shown). However, among Asp-treated mice, TLR4 deficient mice had significantly higher Asp-specific IgG1 titers compared to wild type mice indicating increased allergen sensitization (Figure 1E).

Allergen-induced recruitment of inflammatory cells in WT and TLR4 deficient mice

Previous studies have reported that experimental atopic dermatitis resulting from repeated OVA exposure of tape-stripped skin is characterized not only by skin thickening, elevated OVA-specific antibodies but also by dermal accumulation of Th2 cells, eosinophils and mast cells (25). In our experimental model, increases in inflammatory cells were observed in the dermis of Aspergillus-patched mice compared to saline-patched mice. In order to assess the nature of the inflammatory infiltrate, paraffin embedded skin sections were stained for eosinophils (anti-MBP), mast cells (Leder stain) and neutrophils (anti-Ly6G). Mast cell, eosinophil and neutrophil numbers were all significantly increased in the dermis of Asp-patched mice (Figure 2A–C). However, TLR4 deficiency did not significantly alter dermal eosinophil, mast cells or neutrophil numbers following Aspergillus exposure (Figure 2A–C). Unlike eosinophils and mast cells, neutrophils were almost exclusively observed infiltrating the dermis below excoriations (Figure 2C).

Figure 2. Allergen-induced skin inflammation unaltered by TLR4 deficiency.

Figure 2

Open in a new tab

(A) Leder stained mast cells were counted in the dermis. (B) Dermal eosinophils were identified by immunohistochemistry for major basic protein. (C) Representative photograph of Ly6G+ neutrophils infiltrating the dermis beneath a neutrophil-rich wound. Cells counts represent the mean of 16–20 separate high power fields (40x objective; ***p< 0.001 Bonferroni’s Multiple Comparison Test).

Increased allergen-induced IL-17A skin levels in TLR4 deficient mice

To assess the nature of the adaptive immune response, we measured Th2 (IL4), Th1 (IFNγ) and Th17 (IL17A, IL17F) cytokines in the skin beneath the patched area by real time PCR following the second and third patches. Following the 2nd Asp-patch, IFNγ and IL4 mRNA skin levels remain unchanged whereas IL17A and IL17F mRNA but not IL21 and IL23p19 mRNA levels were increased (Figure 3A–C; data not shown). Despite a trend suggesting increased IL4 generation in TLR4 deficient mice after the second Asp-patch, the absence of TLR4 had no significant impact following the third Asp-patch on IL4 skin mRNA levels or IL4 protein levels in Asp-stimulated lymph node cell cultures (Figures 3B, 3D). Following the third Asp patch, IL17A skin mRNA levels were increased while IFNγ were decreased in TLR4 deficient mice (Figure 3A, 3C). TLR4 deficiency resulted in increased IL17A protein levels in the supernatant of Asp-stimulated cells isolated from skin draining lymph nodes (Figure 3E) consistent with the mRNA data.

Figure 3. TLR4 deficiency enhances IL17A skin levels after 3rd Aspergillus patch.

Figure 3

Open in a new tab

(A) IFNγ, (B) IL4, (C) IL17A and IL17F mRNA skin levels were assessed by quantitative real-time PCR after the 2nd and 3rd patch (n=5–8 and n=6–12 respectively) and expressed as a ratio over the house keeping gene HPRT (*p< 0.05 **p< 0.01 one way ANOVA with Bonferroni’s Multiple Comparison Test). (D and E) Axillary and inguinal lymph nodes cells, collected after the 3rd patch, were stimulated in vitro with Asp (30μg/ml) for 6 days. Secreted IL4 and IL17A levels were assessed by ELISA (n=5–7 mice/group; *p< 0.05 Bonferroni’s Multiple Comparison Test; n.s. not significant).

Increased allergen-induced pro-inflammatory cytokine levels in TLR4 deficient mice

In order to assess the nature of the innate immune response, keratinocyte-derived genes were quantified following the second and third allergen patches. Keratinocytes are a major source of thymic stromal lymphopoietin (TSLP) in acute and chronic lesions of AD and TSLP has been implicated in disease pathogenesis (26–28). In our model, TSLP skin mRNA levels were increased after the second allergen patch in TLR4 deficient mice compared to wild type mice, but were similar to wild type mice after the third Aspergillus patch (Figure 4A).

Figure 4. Aspergillus-induced inflammatory cytokines are increased in TLR4 deficient mice following 2nd and 3rd patch.

Figure 4

Open in a new tab

(A) TSLP, (B) IL17C, (C) S100A8 and S100A9, (D) IL1β, (E) IL6, (F) TNFα, and (G) CXCL2 mRNA skin levels were assessed by quantitative real-time PCR after the 2nd and 3rd patch (n=5–8 and n=6–12 respectively) and expressed as a ratio over the house keeping gene HPRT (*p< 0.05 **p< 0.01 one way ANOVA with Bonferroni’s Multiple Comparison Test; n.s. not significant).

Among keratinocyte derived IL17 family members, IL17C was significantly elevated following the second but not third allergen patch in TLR4 deficient mice (Figure 4B), whereas IL25 skin levels (IL17E) remained unchanged following Aspergillus exposure (data not shown).

In AD, keratinocytes overexpress antimicrobial peptides including calprotectin (a heterodimer of S100A8 and S100A9). Accordingly in our model, skin levels of S100A8 and S100A9 were elevated following Aspergillus exposure and further increased in TLR4 deficient mice compared to wild type mice (Figure 4C).

In the absence of TLR4, pro-inflammatory cytokines (IL1β, IL6 and TNFα) were elevated following the second and third allergen patches, but only IL1β and TNFα were significantly increased in TLR4 deficient mice compared to wild type mice (Figure 4D–F). S100A8 and A9 mRNA skin levels were also increased in TLR4 deficient mice compared to wild type mice following the second and third allergen patches (Figure 4D and data not shown).

Neutrophil chemokines CXCL1 (KC) and CXCL2 were both increased following the second and third Asp-patches but only CXCL2 skin mRNA levels were further increased in TLR4 deficient mice compared to wild type mice (Figure 4G and data not shown). Other chemokines (CCL2, CCL11, CCL20) were not induced by Aspergillus exposure (data not shown).

MyD88 deficiency is protective whereas TRIF deficiency exacerbates experimental AD

We next investigated which downstream pathway was involved in TLR4-mediated exacerbation of experimental AD. MyD88 and TRIF deficient mice were subjected to the experimental AD model described in Figure 1A. Unlike TLR4 deficient mice, the absence of MyD88 partially protected mice from allergen-induced experimental AD as demonstrated by decreased TEWL, epidermal thickness, and epicutaneous sensitization (Figures 5A–C). Accordingly, IL4 and IL17A skin mRNA levels and protein levels in Asp-stimulated draining lymph nodes were also decreased (Figure 5D–E). MyD88 deficiency also impaired induction of S100A8/A9, IL1β, IL-6 and TNFα and CXCL2 in the skin following allergen exposure (Figure 5F).

Figure 5. MyD88 deficiency alleviates Aspergillus-induced skin barrier dysfunction.

Figure 5

Open in a new tab

(A) TEWL measurements taken the day after each patch removal (n=6–8 mice/group; Mean±SEM; 2-way ANOVA with Bonferroni post-tests ***p<0.001). (B) Epidermal thickness was assessed by morphometric analysis. (C) Asp-specific IgG1 plasma levels after the 3rd Aspergillus patch. (D) IL4 and IL17A skin levels. (E) Asp-stimulated lymph node cell secretion of IL4 and IL17A was assessed by ELISA. (F) S100A8, IL1β, IL-6 and CXCL2 skin mRNA levels were assessed by quantitative real-time PCR after the 3rd patch (n=3–6 mice/group). Representative results from 2 separate experiments (*p<0.05, **p<0.01, ***p<0.001 one way ANOVA with Bonferroni’s Multiple Comparison Test).

This was in marked contrast to the exacerbated phenotype observed in TRIF deficient mice. Similar to TLR4 deficient mice, TRIF deficient mice demonstrated impaired skin barrier function as assessed by increased water loss (TEWL) following allergen exposure (Figure 6A). Skin scores and epidermal thickness were also increased in TRIF deficient mice, but did not reach significance (Figure 6B, 6C). Epicutaneous sensitization was increased, as demonstrated by elevated Asp-specific IgG1 and IgG2c blood levels in TRIF and TLR4 deficient mice (Figure 6D). Similar to TLR4 deficient mice, total IgE levels and IL4 skin mRNA levels were not further increased in TRIF deficient mice compared to wild type mice and IFNγ levels were decreased in TRIF deficient mice (Figure 6D, 6E). Surprisingly, skin IL17A, which were increased in TLR4 deficient mice, were decreased in Aspergillus exposed TRIF deficient mice (Figure 6E). IL17A released by Aspergillus stimulated lymph node cells from TRIF deficient mice did not reach significance (Figure 6F). In vitro restimulated lymph node cells from wild type and TRIF deficient mice released similar levels of IL4 and IFNγ (Figure 6F). Consistent with skin IL17A levels, Aspergillus-induced increases in IL17F skin mRNA levels were impaired in TRIF deficient mice compared to wild type mice (Figure 6G). Accordingly, skin mRNA levels of the pro-Th17 cytokine IL6 trended lower in TRIF deficient mice compared to wild type mice (Figure 6G). Similar to TLR4 deficient mice, TRIF deficient mice demonstrated increased IL1β, TNFα and CXCL2 skin mRNA levels compared to WT mice (Figures 6H).

Figure 6. TLR4 and TRIF deficiencies exacerbate experimental AD.

Figure 6

Open in a new tab

(A) TEWL measurements after 3rd patch (n=9–13 mice/group from 2 separate experiments). (B) Skin scores were generated as described in the method section. Skin scores and (C) epidermal thickness following the third Asp-patch. (D) Plasma Asp-specific IgG1 and IgG2c levels and total IgE levels. (E) Skin mRNA levels and (F) protein levels of IL17A, IFNγ and IL4. (G) IL17F, IL6 (H) IL1β, TNFα and CXCL2 skin mRNA levels were assessed by quantitative real-time PCR after the 3rd patch (n=3–6 mice/group; representative results from 2 separate experiments; *p< 0.05, **p<0.01, one way ANOVA with Bonferroni’s Multiple Comparison Test; n.s. not significant).

DISCUSSION

Our data demonstrate that defective TLR4 or TRIF signaling results in disease exacerbation as evidenced by increased skin barrier dysfunction (TEWL) and epicutaneous sensitization. Thus, signaling through TLR4 protects from early inflammatory events leading to impaired skin barrier and disease development. Mechanistically, this protective effect is likely mediated by TRIF, not MyD88.

Our data reveal that early innate events protect from allergen-induced skin barrier dysfunction. Indeed, the increased TEWL observed after the second allergen patch in TLR4 deficient mice is associated with increases in pro-inflammatory cytokines (IL1β, TNFα). Similarly, in AD patients harboring mutations in the filaggrin gene as well as in filaggrin deficient mice, increased skin levels of IL1β were observed (29). Filaggrin deficient mice also develop a local Th17 response, as evidences by increased skin mRNA levels of IL17A, whereas elevated skin levels of Th2 cytokines were only observed months later (5). Similarly, mice rendered deficient for either IgE, STAT6, IL4, IL13, mast cells or eosinophils still develop an AD like skin phenotype when exposed to allergen-patches indicating that none of these are essential for allergen-mediated skin inflammation (25, 30).

The Th2-promoting innate cytokine TSLP is increased in AD lesions(28). Overexpression of TSLP in keratinocytes resulted in spontaneous development of an AD like phenotype in mice (26). In the absence of TSLP, OVA-induced increases in skin Th2 cytokines is ablated (27). Additionally, TSLP dependent accumulation of type 2 innate lymphoid cells in AD was recently shown to contribute to disease (31). TSLP skin mRNA levels were increased in our model after the second, but not the third Aspergillus patch. While we cannot exclude a role for TSLP in disease initiation, the downregulation of TSLP following the third allergen patch suggest that TSLP is not essential in disease progression.

Keratinocyte specific overexpression of IL17C in mice resulted in increased skin levels of IL1β, IL6, TNFα, IL17A and F as well as the antimicrobial peptide calprotectin (S100A8/A9) (32). In our model, all of these genes were elevated after the second allergen patch, but the absence of any induction of IL17C following the third Aspergillus patch argues against a role for IL17C in disease progression.

Calprotectin has been suggested to signal through TLR4 (33). Skin mRNA levels of S100A8 and A9 were significantly increased in mice repeatedly exposed to Aspergillus fumigatus, and TLR4 deficiency was associated with enhanced expression of S100A8 and A9. Indeed, S100A8/A9 skin levels correlate with skin barrier dysfunction suggesting a role in disease pathogenesis. However, treatment with blocking antibodies against S100A8 and A9 did not significantly alter TEWL in our model (data not shown).

In mice exposed to three patches of OVA over a 2-month period, an increase in Th17 cytokines (IL17A, IL17F) was observed in the skin of OVA-patched Balb/c mice compared to control mice (34). The authors propose that the ability of epicutaneous OVA to induce a Th17 response is mediated by IL23 expressing skin DC. In our model, no increase in IL23p19 mRNA skin levels was observed after the second allergen patch despite elevated IL17A and IL17F mRNA skin levels, suggesting that in our model other innate cytokines promote IL17A skin levels. Indeed IL23 is not essential for Th17 differentiation; combinations of IL1β and IL6 have been shown to promote Th17 differentiation (35).

In the absence of TLR4, TEWL is exacerbated following the second Aspergillus patch, while skin Th17 cytokines are similar between wild type and TLR4 deficient mice at this time point, suggesting that skin barrier disruption precede rather than results from increased Th17 responses. In contrast to TLR4 deficient mice, allergen-induced upregulation of Th17 cytokines (IL17A, IL17F) may be impaired in TRIF deficient mice. In the absence of TLR4, signaling through other TLRs still occurs. Beside viral double stranded RNA, self non-coding RNA resulting from skin damage can also signal through TLR3 (36). The TRIF pathway, downstream of TLR3 and TLR4, mediates LPS upregulation of costimulatory molecules on macrophages and dendritic cells as well as LPS induced activation and cytokine release, including type 1 interferons, IL6 and IL12 (37–39), which is consistent with lower skin levels of Th1 and Th17 cytokines. The difference in IL-17A response between the TLR4 deficient mice and the TRIF deficient mice in this model may explain the milder phenotype observed in the TRIF deficient mice.

A significant decrease in IFNγ skin mRNA levels was observed in Asp-exposed TRIF and TLR4 deficient mice. A similar observation was made in TLR2 deficient mice epicutaneously exposed to three patches of OVA over a 2-month period (40). OVA-induced skin mRNA levels of Th2 cytokines were unaltered whereas IFNγ levels were decreased (40). In contrast to TLR4 deficient mice, TLR2 deficiency was associated with decreased epidermal thickness (40). The authors did not examine whether Th17 cytokines, which are increased in our model, were affected by TLR2 deficiency. The absence of MyD88 in the same OVA model was associated with decreased IL17A skin mRNA levels following OVA exposure (34). This is consistent with MyD88 mediating IL1 receptor signaling and IL1β being involved in Th17 differentiation. The protective role of MyD88 deficiency in our model supports a role for MyD88 signaling in disease exacerbation. Accordingly, pro-inflammatory cytokines and chemokines skin levels were markedly decreased. The impact on skin barrier was however more limited, suggesting that Aspergillus can induce skin disease independently of MyD88, possibly through the TRIF pathway.

TLR3 and TLR4, both of which signal through TRIF, have been implicated in wound healing: mice deficient in either TLR4 or TLR3 demonstrated impaired wound healing (41, 42). In human epithelial cells, wound repair was promoted by low doses of LPS whereas high doses were deleterious (43). Similarly, when we exposed mice to high doses of LPS (1ug/patch) in the presence of Aspergillus, disease was exacerbated (data not shown). Like many allergens, Aspergillus possesses considerable proteolytic activity. The proteolytic activity of cockroach and house dust mite allergens has been shown to delay skin barrier recovery following skin injury (44). One advantage of our study is that we utilized an allergen with no known interactions with TLR4. House dust mite associated protease Derp2 can interact with TLR4 (45), while endotoxin contamination of OVA contributes to its ability to mount a Th2 response (46). Endotoxin levels within the Aspergillus fumigatus extract were very low (less than 0.1ng/patch), but it remains possible that other TLR4 ligands may be present in the extract and may contribute to our phenotype.

In conclusion, in an experimental model of allergen-induced atopic dermatitis, defective TLR4 and TRIF signaling results in disease exacerbation as evidenced by increased skin barrier dysfunction (TEWL) and epicutaneous sensitization associated with elevated pro-inflammatory cytokines, notably IL1β and TNFα.

Acknowledgments

We thank Umasundari Sivaprasad for critical review of this manuscript, Kayla Kinker and Brandy Day for technical assistance and Cynthia Chappell for editorial assistance.

This work was supported in part by NIEHS T32 ES010957 (EBB) and RO1AR054490 (GKKH)

Abbreviations used in this paper

AD

atopic dermatitis

TEWL

transepidermal water loss

Asp

Aspergillus fumigatus extract

MyD88

myeloid differentiation primary-response protein 88

TRIF

Toll-interleukin 1 receptor domain-containing adapter-inducing interferon-β

TSLP

thymic stromal lymphopoietin

References

  • 1.Williams H, Flohr C. How epidemiology has challenged 3 prevailing concepts about atopic dermatitis. J Allergy Clin Immunol. 2006;118:209–213. doi: 10.1016/j.jaci.2006.04.043. [DOI] [PubMed] [Google Scholar]
  • 2.Kuo IH, Yoshida T, De Benedetto A, Beck LA. The cutaneous innate immune response in patients with atopic dermatitis. J Allergy Clin Immunol. 2013;131:266–278. doi: 10.1016/j.jaci.2012.12.1563. [DOI] [PubMed] [Google Scholar]
  • 3.Barnes KC. An update on the genetics of atopic dermatitis: scratching the surface in 2009. J Allergy Clin Immunol. 2010;125:16–29. e11–11. doi: 10.1016/j.jaci.2009.11.008. quiz 30–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fallon PG, Sasaki T, Sandilands A, Campbell LE, Saunders SP, Mangan NE, Callanan JJ, Kawasaki H, Shiohama A, Kubo A, Sundberg JP, Presland RB, Fleckman P, Shimizu N, Kudoh J, Irvine AD, Amagai M, McLean WH. A homozygous frameshift mutation in the mouse Flg gene facilitates enhanced percutaneous allergen priming. Nat Genet. 2009;41:602–608. doi: 10.1038/ng.358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Oyoshi MK, Murphy GF, Geha RS. Filaggrin-deficient mice exhibit TH17-dominated skin inflammation and permissiveness to epicutaneous sensitization with protein antigen. J Allergy Clin Immunol. 2009;124:485–493. 493 e481. doi: 10.1016/j.jaci.2009.05.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Boguniewicz M, Leung DY. Recent insights into atopic dermatitis and implications for management of infectious complications. J Allergy Clin Immunol. 2010;125:4–13. doi: 10.1016/j.jaci.2009.11.027. quiz 14–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Miller LS, Modlin RL. Toll-like receptors in the skin. Semin Immunopathol. 2007;29:15–26. doi: 10.1007/s00281-007-0061-8. [DOI] [PubMed] [Google Scholar]
  • 8.Howell MD, Kim BE, Gao P, Grant AV, Boguniewicz M, DeBenedetto A, Schneider L, Beck LA, Barnes KC, Leung DY. Cytokine modulation of atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol. 2009;124:R7–R12. doi: 10.1016/j.jaci.2009.07.012. [DOI] [PubMed] [Google Scholar]
  • 9.Ahmad-Nejad P, Mrabet-Dahbi S, Breuer K, Klotz M, Werfel T, Herz U, Heeg K, Neumaier M, Renz H. The toll-like receptor 2 R753Q polymorphism defines a subgroup of patients with atopic dermatitis having severe phenotype. J Allergy Clin Immunol. 2004;113:565–567. doi: 10.1016/j.jaci.2003.12.583. [DOI] [PubMed] [Google Scholar]
  • 10.Miller LS, O’Connell RM, Gutierrez MA, Pietras EM, Shahangian A, Gross CE, Thirumala A, Cheung AL, Cheng G, Modlin RL. MyD88 mediates neutrophil recruitment initiated by IL-1R but not TLR2 activation in immunity against Staphylococcus aureus. Immunity. 2006;24:79–91. doi: 10.1016/j.immuni.2005.11.011. [DOI] [PubMed] [Google Scholar]
  • 11.An Y, Ohnishi H, Matsui E, Funato M, Kato Z, Teramoto T, Kaneko H, Kimura T, Kubota K, Kasahara K, Kondo N. Genetic variations in MyD88 adaptor-like are associated with atopic dermatitis. Int J Mol Med. 2011;27:795–801. doi: 10.3892/ijmm.2011.645. [DOI] [PubMed] [Google Scholar]
  • 12.Novak N, Yu CF, Bussmann C, Maintz L, Peng WM, Hart J, Hagemann T, Diaz-Lacava A, Baurecht HJ, Klopp N, Wagenpfeil S, Behrendt H, Bieber T, Ring J, Illig T, Weidinger S. Putative association of a TLR9 promoter polymorphism with atopic eczema. Allergy. 2007;62:766–772. doi: 10.1111/j.1398-9995.2007.01358.x. [DOI] [PubMed] [Google Scholar]
  • 13.Lange J, Heinzmann A, Zehle C, Kopp M. CT genotype of promotor polymorphism C159T in the CD14 gene is associated with lower prevalence of atopic dermatitis and lower IL-13 production. Pediatr Allergy and Immunol. 2005;16:456–457. doi: 10.1111/j.1399-3038.2005.00277.x. [DOI] [PubMed] [Google Scholar]
  • 14.Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, Bouffard GG, Blakesley RW, Murray PR, Green ED, Turner ML, Segre JA. Topographical and temporal diversity of the human skin microbiome. Science. 2009;324:1190–1192. doi: 10.1126/science.1171700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Scharschmidt TC, List K, Grice EA, Szabo R, Renaud G, Lee CC, Wolfsberg TG, Bugge TH, Segre JA. Matriptase-deficient mice exhibit ichthyotic skin with a selective shift in skin microbiota. J Invest Dermatol. 2009;129:2435–2442. doi: 10.1038/jid.2009.104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Scharschmidt TC, Man MQ, Hatano Y, Crumrine D, Gunathilake R, Sundberg JP, Silva KA, Mauro TM, Hupe M, Cho S, Wu Y, Celli A, Schmuth M, Feingold KR, Elias PM. Filaggrin deficiency confers a paracellular barrier abnormality that reduces inflammatory thresholds to irritants and haptens. J Allergy Clin Immunol. 2009;124:496–506. 506 e491–496. doi: 10.1016/j.jaci.2009.06.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Penders J, Thijs C, Mommers M, Stobberingh EE, Dompeling E, Reijmerink NE, van den Brandt PA, Kerkhof M, Koppelman GH, Postma DS. Host-microbial interactions in childhood atopy: toll-like receptor 4 (TLR4), CD14, and fecal Escherichia coli. J Allergy Clin Immunol. 2010;125:231–236. e231–235. doi: 10.1016/j.jaci.2009.10.011. [DOI] [PubMed] [Google Scholar]
  • 18.Grigoryev DN, Howell MD, Watkins TN, Chen YC, Cheadle C, Boguniewicz M, Barnes KC, Leung DY. Vaccinia virus-specific molecular signature in atopic dermatitis skin. J Allergy Clin Immunol. 2010;125:153–159 e128. doi: 10.1016/j.jaci.2009.10.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kagan JC, Su T, Horng T, Chow A, Akira S, Medzhitov R. TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta. Nat Immunol. 2008;9:361–368. doi: 10.1038/ni1569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zanoni I, Ostuni R, Marek LR, Barresi S, Barbalat R, Barton GM, Granucci F, Kagan JC. CD14 controls the LPS-induced endocytosis of Toll-like receptor 4. Cell. 2011;147:868–880. doi: 10.1016/j.cell.2011.09.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lebre MC, van der Aar AM, van Baarsen L, van Capel TM, Schuitemaker JH, Kapsenberg ML, de Jong EC. Human keratinocytes express functional Toll-like receptor 3, 4, 5, and 9. J Invest Dermatol. 2007;127:331–341. doi: 10.1038/sj.jid.5700530. [DOI] [PubMed] [Google Scholar]
  • 22.Sivaprasad U, Warrier MR, Gibson AM, Chen W, Tabata Y, Bass SA, Rothenberg ME, Khurana Hershey GK. IL-13Ralpha2 has a protective role in a mouse model of cutaneous inflammation. J Immunol. 2010;185:6802–6808. doi: 10.4049/jimmunol.1002118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Leder LD. The chloroacetate esterase reaction. A useful means of histological diagnosis of hematological disorders from paraffin sections of skin. Am J Dermatopathol. 1979;1:39–42. [PubMed] [Google Scholar]
  • 24.Gupta J, Grube E, Ericksen MB, Stevenson MD, Lucky AW, Sheth AP, Assa’ad AH, Khurana Hershey GK. Intrinsically defective skin barrier function in children with atopic dermatitis correlates with disease severity. J Allergy Clin Immunol. 2008;121:725–730. e722. doi: 10.1016/j.jaci.2007.12.1161. [DOI] [PubMed] [Google Scholar]
  • 25.Oyoshi MK, He R, Kumar L, Yoon J, Geha RS. Cellular and molecular mechanisms in atopic dermatitis. Adv Immunol. 2009;102:135–226. doi: 10.1016/S0065-2776(09)01203-6. [DOI] [PubMed] [Google Scholar]
  • 26.Yoo J, Omori M, Gyarmati D, Zhou B, Aye T, Brewer A, Comeau MR, Campbell DJ, Ziegler SF. Spontaneous atopic dermatitis in mice expressing an inducible thymic stromal lymphopoietin transgene specifically in the skin. J Exp Med. 2005;202:541–549. doi: 10.1084/jem.20041503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.He R, Oyoshi MK, Garibyan L, Kumar L, Ziegler SF, Geha RS. TSLP acts on infiltrating effector T cells to drive allergic skin inflammation. Proc Natl Acad Sci U S A. 2008;105:11875–11880. doi: 10.1073/pnas.0801532105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Comeau MR, Ziegler SF. The influence of TSLP on the allergic response. Mucosal Immunol. 2010;3:138–147. doi: 10.1038/mi.2009.134. [DOI] [PubMed] [Google Scholar]
  • 29.Kezic S, O’Regan GM, Lutter R, Jakasa I, Koster ES, Saunders S, Caspers P, Kemperman PM, Puppels GJ, Sandilands A, Chen H, Campbell LE, Kroboth K, Watson R, Fallon PG, McLean WH, Irvine AD. Filaggrin loss-of-function mutations are associated with enhanced expression of IL-1 cytokines in the stratum corneum of patients with atopic dermatitis and in a murine model of filaggrin deficiency. J Allergy Clin Immunol. 2012;129:1031–1039. e1031. doi: 10.1016/j.jaci.2011.12.989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Brandt EB, Sivaprasad U. Th2 Cytokines and Atopic Dermatitis. J Clin Cell Immunol. 2011;2:110. doi: 10.4172/2155-9899.1000110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kim BS, Siracusa MC, Saenz SA, Noti M, Monticelli LA, Sonnenberg GF, Hepworth MR, Van Voorhees AS, Comeau MR, Artis D. TSLP elicits IL-33-independent innate lymphoid cell responses to promote skin inflammation. Sci Transl Med. 2013;5:170ra116. doi: 10.1126/scitranslmed.3005374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Johnston A, Fritz Y, Dawes SM, Diaconu D, Al-Attar PM, Guzman AM, Chen CS, Fu W, Gudjonsson JE, McCormick TS, Ward NL. Keratinocyte overexpression of IL-17C promotes psoriasiform skin inflammation. J Immunol. 2013;190:2252–2262. doi: 10.4049/jimmunol.1201505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Ehrchen JM, Sunderkotter C, Foell D, Vogl T, Roth J. The endogenous Toll-like receptor 4 agonist S100A8/S100A9 (calprotectin) as innate amplifier of infection, autoimmunity, and cancer. J Leukoc Biol. 2009;86:557–566. doi: 10.1189/jlb.1008647. [DOI] [PubMed] [Google Scholar]
  • 34.He R, Oyoshi MK, Jin H, Geha RS. Epicutaneous antigen exposure induces a Th17 response that drives airway inflammation after inhalation challenge. Proc Natl Acad Sci U S A. 2007;104:15817–15822. doi: 10.1073/pnas.0706942104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Korn T, Bettelli E, Oukka M, Kuchroo VK. IL-17 and Th17 Cells. Annu Rev Immunol. 2009;27:485–517. doi: 10.1146/annurev.immunol.021908.132710. [DOI] [PubMed] [Google Scholar]
  • 36.Bernard JJ, Cowing-Zitron C, Nakatsuji T, Muehleisen B, Muto J, Borkowski AW, Martinez L, Greidinger EL, Yu BD, Gallo RL. Ultraviolet radiation damages self noncoding RNA and is detected by TLR3. Nat Med. 2012;18:1286–1290. doi: 10.1038/nm.2861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hoebe K, Janssen EM, Kim SO, Alexopoulou L, Flavell RA, Han J, Beutler B. Upregulation of costimulatory molecules induced by lipopolysaccharide and double-stranded RNA occurs by Trif-dependent and Trif-independent pathways. Nat Immunol. 2003;4:1223–1229. doi: 10.1038/ni1010. [DOI] [PubMed] [Google Scholar]
  • 38.Weighardt H, Jusek G, Mages J, Lang R, Hoebe K, Beutler B, Holzmann B. Identification of a TLR4- and TRIF-dependent activation program of dendritic cells. Eur J Immunol. 2004;34:558–564. doi: 10.1002/eji.200324714. [DOI] [PubMed] [Google Scholar]
  • 39.Shen H, Tesar BM, Walker WE, Goldstein DR. Dual signaling of MyD88 and TRIF is critical for maximal TLR4-induced dendritic cell maturation. J Immunol. 2008;181:1849–1858. doi: 10.4049/jimmunol.181.3.1849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jin H, Kumar L, Mathias C, Zurakowski D, Oettgen H, Gorelik L, Geha R. Toll-like receptor 2 is important for the T(H)1 response to cutaneous sensitization. J Allergy Clin Immunol. 2009;123:875–882. e871. doi: 10.1016/j.jaci.2009.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen L, Guo S, Ranzer MJ, Dipietro LA. Toll-Like Receptor 4 Has an Essential Role in Early Skin Wound Healing. J Invest Dermatol. 2013;133(1):258–267. doi: 10.1038/jid.2012.267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Lin Q, Fang D, Fang J, Ren X, Yang X, Wen F, Su SB. Impaired wound healing with defective expression of chemokines and recruitment of myeloid cells in TLR3-deficient mice. J Immunol. 2011;186:3710–3717. doi: 10.4049/jimmunol.1003007. [DOI] [PubMed] [Google Scholar]
  • 43.Koff JL, Shao MX, Kim S, Ueki IF, Nadel JA. Pseudomonas lipopolysaccharide accelerates wound repair via activation of a novel epithelial cell signaling cascade. J Immunol. 2006;177:8693–8700. doi: 10.4049/jimmunol.177.12.8693. [DOI] [PubMed] [Google Scholar]
  • 44.Jeong SK, Kim HJ, Youm JK, Ahn SK, Choi EH, Sohn MH, Kim KE, Hong JH, Shin DM, Lee SH. Mite and cockroach allergens activate protease-activated receptor 2 and delay epidermal permeability barrier recovery. J Invest Dermatol. 2008;128:1930–1939. doi: 10.1038/jid.2008.13. [DOI] [PubMed] [Google Scholar]
  • 45.Trompette A, Divanovic S, Visintin A, Blanchard C, Hegde RS, Madan R, Thorne PS, Wills-Karp M, Gioannini TL, Weiss JP, Karp CL. Allergenicity resulting from functional mimicry of a Toll-like receptor complex protein. Nature. 2009;457:585–588. doi: 10.1038/nature07548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Eisenbarth SC, Zhadkevich A, Ranney P, Herrick CA, Bottomly K. IL-4-dependent Th2 collateral priming to inhaled antigens independent of Toll-like receptor 4 and myeloid differentiation factor 88. J Immunol. 2004;172:4527–4534. doi: 10.4049/jimmunol.172.7.4527. [DOI] [PubMed] [Google Scholar]

RESOURCES