Skip to main content
PMC home page
Cell Stress & Chaperones logoLink to Cell Stress & Chaperones
. 2013 Mar 31;18(6):711–718. doi: 10.1007/s12192-013-0421-3

Association analysis of HSP70A1A haplotypes with heat tolerance in Chinese Holstein cattle

Qi Xiong 1, Jin Chai 4, Haiqian Xiong 2, Wengong Li 2, Tao Huang 3, Yang Liu 1, Xiaojun Suo 1, Nian Zhang 1, Xiaofeng Li 1, Siwen Jiang 4, Mingxin Chen 1,✉
PMCID: PMC3789873  PMID: 23543596

Abstract

Single-nucleotide polymorphisms (SNPs) in the coding and untranslated regions of heat shock 70 kDa protein 1A (HSP70A1A), an inducible molecular chaperone that is responsible for cellular protection against heat stress, have been reported as being associated with heat tolerance. A fragment of the HSP70A1A gene was amplified in Chinese Holstein cattle and eight novel mutations were found. We performed comprehensive linkage disequilibrium (LD) and haplotype analyses of the eight SNPs of the HSP70A1A gene and examined their involvement in heat resistance in 600 Chinese Holstein cattle. Our results revealed the presence of significant differences between individuals carrying haplotype 1 and those without haplotype 1 for most of the heat-tolerance traits. Haplotype 1 increased the risk of heat stress; however, association analysis of its combination with haplotype 2 showed the lowest rectal temperature and red blood cell K+ level, moderate respiratory rate, and the highest red blood cell NKA level, suggesting a heterozygote advantage in the penetration of the phenotype. Protein expression levels in white blood cells among haplotype combinations further confirmed the hypothesis that heterozygotes for haplotypes 1 and 2 are more sensitive to heat stress. We presume that these mutations may be useful in the future as molecular genetic markers to assist selection for heat tolerance in cattle.

Keywords: HSP70, Heat stress, Haplotypes, Cattle, Association analysis

Introduction

Chinese Holstein is a heat-sensitive breed of cattle that originated in Europe. High environmental temperature exerts a negative influence on the performance of Chinese Holstein cattle, especially in South China. In summer, the high temperature and humidity can produce moderate heat stress, resulting in decreased dry-matter intake, immunity, milk secretion, and reproduction performance (Wolfenson et al. 2000; Berman 2011). Previous studies have focused on the alleviation of heat stress through physical monitoring of the environment (Collier et al. 2006). However, little is known about the molecular mechanisms underlying heat resistance in dairy cows.

Heat shock proteins (HSPs) have been implicated in thermotolerance and the ability of heat-induced denatured proteins to recover to their native state (Maloyan et al. 1999). The HSP70 protein, which is encoded by the HSP70A1A gene, is a widespread protein of the HSP family and an important intracellular molecular chaperone. The regulation of HSP70 production is critical to inhibit the apoptosis of cells (Mosser et al. 2000). Although stress-induced synthesis of HSP70 proteins represents a generalized molecular mechanism displayed by almost all cells, individual animals differ in their capacity to manage stress. In Chinese Holstein cows, a genetic polymorphism in the coding region of the HSP70A1A gene was associated with resistance to mastitis (Cheng et al. 2009). In human peripheral mononuclear cells, polymorphisms in the coding region of the HSP70A1A gene were associated with an increased ability to respond to heat stress (Singh et al. 2006). Moreover, it has been reported that nucleotide changes occurring naturally in the flanking regions of the HSP70A1A gene might affect the inducibility, degree of expression, and/or stability of the HSP70 mRNA and contribute to susceptibility to certain diseases and stress tolerance. In humans, an HSP70A1A gene polymorphism located in the 5′ untranslated region (UTR) was positively associated with coronary heart disease risk, which was mediated by the level of synthesis of the HSP70 protein (He et al. 2009). In pigs, an HSP70.2 gene polymorphism located in the functional promoter and 3′ UTR was associated with mRNA stability and stress response (Schwerin et al. 2001; Schwerin et al. 2002).

Although there are many previous studies on the function of the HSP70 protein, few reports have explored the association between HSP70A1A gene haplotypes and thermotolerance in Chinese Holstein cattle. Therefore, studies to verify the effects of HSP70A1A haplotypes on thermotolerance traits in Chinese dairy cows may uncover genetic tools that will improve tolerance to heat stress in cattle.

Materials and methods

Animals and DNA isolation

The 600 Chinese Holstein Cows used in this study came from four dairy farms located in Huanggang City, Hubei Province, China, which is situated at a latitude of 30°27′ N and a longitude of 114°52′ E in the middle reaches of the north shore of the Yangtze River in South China Blood samples were collected using anticoagulant acid citrate dextrose and stored at −80 °C. DNA was extracted from 1 mL of frozen/thawed blood and diluted with distilled water to a final concentration of 50 ng/μL.

Measurement of heat-resistance traits

Sodium chloride was added in a 1:2 (w/v) ratio and the tube was shaken lightly and then centrifuged at 4 °C, 7,000 rpm for 8 min. The latter step was repeated twice; an erythrocyte-gained moiety was used to determine K+ and another to determine NKA levels (Wang et al. 2011). The rectal temperature and respiratory rate of cows were measured between 1200 and 1400 hours during the middle 10 days of August 2012 (the average temperature was 33.5 °C and the temperature–humidity index was 85.7, during which time the cows were regarded as being under heat stress). Milk samples were taken and milk yield recorded once a month for each cow in the course of routine controlled milking over the whole lactation. Milk yield decline = (corrected milk in March − corrected milk in August)/corrected milk in March.

Identification and genotyping of HSP70A1A variants

In an effort to discover SNPs in a cost-effective manner, SNP discovery was implemented by sequencing pooled PCR products, which were amplified from genomic DNAs from 60 Chinese Holstein cows. PCR primers (PF: 5′–CATCCTTATTACCAACTTGCGTG–3′; PR: 5′–CGGACAAGAAGAAGGTGCTG–3′) were designed for the partial amplification of the exons and 3′ flanking region of the HSP70A1A gene based on the genome sequence fragments from the assembly of chromosome 23 reported in GenBank (accession no. AC_000180.1). PCR was carried out in a 50 μL mixture containing 200 ng template DNA, 200 nm each primer, 2.5 mm MgCl2, 200 nm each dNTP, and 0.25 U Taq DNA polymerase with 1 μL PCR buffer supplied by the manufacturer (Takara, Tokyo, Japan). The PCR conditions were: initial denaturation at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 40 s, annealing at 59 °C for 40 s, elongation at 72 °C for 40 s, and final elongation at 72 °C for 10 min. The PCR products were purified with the MinElute PCR purification kit (QIAGEN, Madison, WI), and SNPs in the HSP70A1A bovine genomic DNA were identified by direct sequencing on an ABI PRISM 377 sequencer using the BigDye Terminator Cycle Sequencing FS Ready Reaction Kit (PE Applied Biosystems, Foster City, CA). Eight SNPs were found distributed over the entire gene (five in the 3′ flanking region at positions 2066, 2040, 2027, 1990, and 1980; three in the CDS at 1923, 1761, and 1737; Fig. 1). All eight SNPs were genotyped in all study individuals. All SNPs could be tested using direct sequencing of PCR products by the same primers.

Fig. 1.

Fig. 1

Open in a new tab

SNPs detected in the HSP70 gene, as shown by DNA antisense strand (a) and sequencing chromatograms (b) in Chinese Holstein cows. The STOP codon is boxed. Detection primers are underlined. The SNPs are indicated in red color

Western blotting

White blood cells collected from fresh blood of the indicated population during high temperature were solubilized in 100 μL of sodium dodecyl sulfate (SDS) sample buffer, boiled for 5 min, and ultrasonically homogenized for 3 min. Equal amounts of total protein were separated by electrophoresis on 10 or 12 % SDS–polyacrylamide gels and then transferred onto polyvinylidene difluoride membranes. The membranes were blocked in TBS-T with 3 % BSA for 2–3 h. Next, the membrane was incubated with rabbit anti-HSP70 polyclonal antibody (CST, Beverly, MA) at 4 °C overnight. This HSP70 antibody detects endogenous levels of total HSP70 protein and does not cross-react with other HSPs. After washing the membrane, the proteins were detected using peroxidase-conjugated immunopure goat anti-rabbit IgG (H + L) (Millipore, Bedford, MA).

Statistical analyses

Genotype and allele frequencies were estimated by gene counting. A Hardy–Weinberg equilibrium (HWE) test was performed for each SNP to determine deviations of observed genotypic distributions from the expected distribution. We used the Haploview software [version 2.1.1] to determine the LD structure of the SNPs located within the HSP70A1A gene and to test for HWE.

Haplotype construction and LD analysis

Haplotype analyses and graphical representation of the linkage disequilibrium (LD) structure as measured by coefficient D′ and r2 using expectation–maximization algorithm were performed with the HAPLOVIEW software (ver 3.32) (Barrett et al. 2005). Haplotypes were obtained for each animal using the PHASE computer program (ver 2.1), and the haplotype frequencies were estimated via permutation methods (Stephens et al. 2001). In large samples, D′ = 1 indicates complete LD, i.e., no evidence for recombination between the SNP pairs—such SNPs are good surrogates for each other; D′ = 0 indicates no LD. “Strong” LD was defined as having a pairwise D′ > 0.85. Haplotype-block structure was examined using the criteria described by Gabriel et al. (Gabriel et al. 2002), which use the 90 % confidence bounds of D′ to define sites of historical recombination between SNPs. Patterns of LD were visualized using Haploview.

Association analysis

The association analyses between HSP70 haplotype combinations and heat-resistance traits was performed using GLM process of SAS 8.0 and the following liner model: Yijklm = μ + Gi + Ysj + Hk + Pl + Sm + eijklm, where Yijklm = the heat-resistance capability value; μ = the overall mean; Gi = the effect of genotype; Ysj = the effect of seasons; j = 1 for April to September and 2 for October to next March; Hk = the effect of different farms; k = 1, 2, 3, or 4; Pl = the effect of paternal descent; Sm = the effect of maternal descent; and eijklm = random error.

Differences in baseline characteristics between the different genotype groups of the Hsp70 gene were compared as haplotype-dose effect. Haplotype-dose effect was defined as an increase or decrease in value per copy of the haplotype. The association analyses between different copy numbers of certain haplotypes and traits were implemented using GLM process of SAS 8.0 as mentioned above.

Results

Identification of eight polymorphisms in the bovine HSP70A1A gene and analysis of their characteristics

We identified eight polymorphisms in the bovine HSP70A1A gene using genomic DNA from 60 Holstein cows (Fig. 1). Five polymorphisms were located in the 3′ flanking region (HSP70a_1–HSP70a_5). Three polymorphisms were found in the HSP70A1A coding region (HSP70b_1–HSP70b_3). HSP70a_1 and HSP70a_5 were identified in the 3′ flanking region and resulted in a T to C change at positions 2066 and 1980 of the HSP70A1A gene, respectively. HSP70a_2 and HSP70a_3 were also located in the 3′ flanking region and resulted in an A to G change at positions 2040 and 2027 of the HSP70A1A gene, respectively. HSP70a_4 was identified in the 3′ flanking region and resulted in a G to T change at position 1990 of the HSP70A1A gene. Regarding the other three polymorphisms, which all led to silent mutations, HSP70b_1 and HSP70b_3 were detected in the CDS and resulted in an A to G change at positions 1923 and 1737, whereas HSP70b_2 resulted in a C to A change at position 1761 of the HSP70A1A gene.

Analyses of haplotypes and LD among the eight SNPs identified

The genotyping of all eight SNPs was successfully implemented using direct sequencing in 600 Holstein cows in primary studies. The minor allele frequency (MAF) at each marker ranged between 27 and 36 %. Table 1 shows allele frequencies and Hardy–Weinberg test P values. All eight SNPs, with the exception of HSP70a_4, were in Hardy–Weinberg equilibrium (P = 0.0004) for the combined data. All eight SNPs genotyped exhibited heterozygosity. The corresponding estimated D′ values are depicted using a color scheme in Fig. 2. All of the SNPs were identified as an LD block. “Strong” LD was observed in 39 % (11 of 28) SNP pairs (dark shading). Among these, we identified two distinct sets of “family of SNPs” that mutually exhibited strong LD with one another within the family. These were: I = {HSP70a_1, HSP70a_2, HSP70b_1, HSP70b_2, HSP70b_3} and II = {HSP70a_3, HSP70a_5}. However, we observed that 17 SNP pairs showed evidence of recombination (gray shading). Interestingly, five out of the 17 SNP pairs that showed evidence of recombination (HSP70a_2 and HSP70a_3, HSP70a_3 and HSP70a_4, HSP70a_4 and HSP70a_5, HSP70a_2, and HSP70b_1) in the 3′ flanking region were neighboring SNPs. The lower-than-expected degree of LD in the cases, even between closely spaced SNPs, might be caused by gene conversion.

Table 1.

Characteristics of the SNPs located in the 3′ flanking and coding regions of the HSP70 gene and their MAF

No. Name Region Position Alleles MAF HW P
1 HSP70a_1 3′ Flanking region 2066 T > C 0.345 0.3698
2 HSP70a_2 3′ Flanking region 2040 A > G 0.302 0.3892
3 HSP70a_3 3′ Flanking region 2027 A > G 0.289 0.9853
4 HSP70a_4 3′ Flanking region 1990 G > T 0.358 0.0004
5 HSP70a_5 3′ Flanking region 1980 T > C 0.267 0.7565
6 HSP70b_1 Coding region 1923 A > G 0.345 0.3698
7 HSP70b_2 Coding region 1761 C > A 0.353 0.4462
8 HSP70b_3 Coding region 1737 G > A 0.345 0.3698
Open in a new tab

MAF minor allele frequency, A > B implies that B is the minor allele; HW P Hardy–Weinberg test P value

Fig. 2.

Fig. 2

Open in a new tab

Linkage disequilibrium (LD) patterns of the HSP70 gene in a Chinese Holstein population. LD was estimated based on the pairwise LD coefficient, D′. The color scheme is dark gray for “strong” LD and light gray for “evidence of historical recombination”. Patterns of LD were visualized using Haploview

Haplotype association analysis

Three major haplotypes accounted for 91.8 % of the alleles: haplotype 1, –TAATTACG– (35.8 %); haplotype 2, –CGAGTGAA– (29.7 %), and haplotype 3, –TAGGCACG– (26.3 %). So, the six haplotype combinations 11 (TAATTACG/TAATTACG), 12 (TAATTACG/CGAGTGAA), 13 (TAATTACG/ TAGGCACG), 22 (CGAGTGAA/CGAGTGAA), 23 (CGAGTGAA/TAGGCACG), and 33 (TAGGCACG/TAGGCACG) accounted for the major genotypes of the HSPA1A gene, and we named the corresponding genotypes as genotype 11, 12, 13, 22, 23, or 33. The results of association analyses between haplotype combinations and the heat-tolerance traits are shown in Table 2. There were significant differences (P < 0.05) between haplotype combinations regarding some of the heat-tolerance traits analyzed. There was a significant difference between individuals carrying haplotype 1 and those without haplotype 1 for all traits, with the exception of decreased rate of milk yield. The presence of haplotype 1 favored red blood cell K+ levels with a very high significance (P < 0.0001). Haplotype 3 showed no significant associations with any of the heat-tolerance traits. Haplotype 2 was only associated with rectal temperature and red blood cell K+ levels. In contrast to what was observed for haplotype 1, cows with haplotype 2 had a tendency for decreased rectal temperature and red blood cell K+ levels during the hot days of summer; i.e., to some extent, cows with haplotype 2 had more thermal resistance than did cows with haplotype 1. However, cows with genotype 12 had much lower respiratory rate, rectal temperature, and red blood cell K+ levels, but higher red blood cell NKA levels, than did cows with genotype 22, suggesting a heterozygote advantage in the penetration of the phenotype.

Table 2.

Associations between HSP70 haplotype combinations and copy numbers of specific haplotype and heat-tolerance traits, respectively

LSM (SE) of haplotype combination LSM (SE) of copies of haplotype 1-TAATTACG- LSM (SE) of copies of haplotype 2-CGAGTGAA- LSM (SE) of copies of haplotype 3-TAGGCACG-
Trait 11, n = 120 12, n = 100 13, n = 72 22, n = 44 23, n = 144 33, n = 34 P value 0, n = 222 1, n = 172 2, n = 120 P value 0, n = 226 1, n = 244 2, n = 44 P value 0, n = 264 1, n = 216 2, n = 34 P value
RT 40.25 ± 0.51a 39.89 ± 0.74b 40.16 ± 0.65ab 39.98 ± 0.98ab 39.95 ± 0.56b 40.07 ± 0.41ab 0.035 40.00 ± 0.36b 40.03 ± 0.58b 40.25 ± 0.51a 0.004 40.16 ± 0.38a 39.92 ± 0.55b 39.98 ± 0.98ab 0.003 40.04 ± 0.42 40.06 ± 0.48 40.07 ± 0.41 0.926
RR 91.18 ± 6.14a 88.48 ± 7.68bc 86.40 ± 5.55c 89.73 ± 4.91ab 90.14 ± 9.08ab 89.15 ± 4.87abc 0.043 89.67 ± 4.81a 87.44 ± 5.48b 91.18 ± 6.14a 0.0002 88.91 ± 4.62 89.31 ± 7.43 89.73 ± 4.91 0.799 89.80 ± 4.76 88.27 ± 5.36 89.15 ± 4.87 0.066
K+ 628.24 ± 72.65a 491.45 ± 58.15d 583.15 ± 49.13b 534.59 ± 78.93c 545.37 ± 36.74c 558.67 ± 58.92bc <0.0001 546.21 ± 35.83b 537.3 ± 45.72b 628.24 ± 72.65a <0.0001 590.02 ± 47.63a 518.41 ± 33.98b 534.59 ± 78.93b <0.0001 551.43 ± 55.53 564.26 ± 33.86 558.67 ± 58.92 0.120
NKA 9.84 ± 4.31b 13.01 ± 5.43a 11.16 ± 4.93ab 12.25 ± 3.85a 10.25 ± 4.13b 12.08± 0.003 11.53 ± 3.58a 12.09 ± 4.75a 9.84± 0.005 11.03 ± 3.54 11.63 ± 3.95 12.25 ± 3.85 0.266 11.70 ± 3.66 10.71 ± 3.98 12.08 ± 3.72 0.094
MYD 28.45 ± 9.84 27.39 ± 10.65 26.17 ± 9.99 25.69 ± 12.26 31.94 ± 11.67 29.48 ± 3.72ab 0.954 29.04 ± 9.73 26.78 ± 9.62 28.45 ± 9.84 0.262 28.03 ± 9.43 29.67 ± 10.37 25.69 ± 12.26 0.174 27.18 ± 9.63 29.06 ± 9,74 29.48 ± 9.87 0.275
Open in a new tab

Letters a, b, and/or c differed significantly (P < 0.05) from each other

Trait: 0, 1, 2 represents different copy numbers of certain haplotypes

RT rectal temperature, RR respiratory rate, K + red blood cell K+ level, NKA red blood cell Na+/K+-ATPase level, MYD milk yield decline, LSM (SE) least squares means and their standard errors

Polymorphisms and HSP70 expression

To investigate the possible functional significance of the SNPs of the HSPA1A gene, HSP70 protein levels were compared between haplotype combinations in white blood cells during high temperature (Fig. 3a). Under heat-stress status, the levels of expression of the HSP70 protein in cows with genotype 12 were remarkably higher than those observed in cows carrying other genotypes (Fig. 3b). As for the other five distinct combined genotypes, the expression of genotypes 11, 13, and 33 was significantly lower than that of genotypes 22 and 23; however, no differences were found between genotypes 11 and 13 nor between genotypes 22 and 23, suggesting that the reduction in expression was due to the presence of haplotype 1. This result further confirmed the suggestion that heterozygotes for haplotypes 1 and 2 may be more sensitive to heat stress and that the occurrence of heat stress upregulated the synthesis of the HSP70 protein to protect the individual from heat stress.

Fig. 3.

Fig. 3

Open in a new tab

Effects of heat stress on heat shock protein 70 (HSP70) expression levels in bovine white blood cells. Cells with genotypes 11, 12, 13, 22, 23, and 33 were analyzed for protein level of HSP70 and quantified by western blotting under heat-stress status (a). Relative levels of HSP70 protein were calculated by imaging densitometer with reference protein (β-actin) in each sample (b). Bars represent the mean ± SE (n = 3). *P < 0.05, the differences in the levels of expression were significant by t test

Discussion

In cattle, several promoter and 3′ UTR variants have been identified in HSP70A1A (Adamowicz et al. 2005; Basirico et al. 2011; Brown et al. 2010; Grosz et al. 1994; Li et al. 2011; Rosenkrans et al. 2010). However, to date, only a few variants have been found in the coding and 3′ flanking regions of HSP70A1A, which may also affect inducibility, degree of expression, and/or stability of the HSP70 mRNA and may contribute to different individual stress tolerances. In our study, the bovine HSP70A1A 3′ flanking region is different from the 3′ UTR, which is transcribed from upstream of the bovine HSP70A1A gene. In addition, five novel SNPs located in the 3′ flanking region of the inducible bovine HSP70A1A gene were identified in a Chinese Holstein population. These data are not consistent with the information of the HSPA1A SNP GeneView report published in NCBI (geneID 281825). These comparison data indicated that the allele frequency of a specific SNP is not identical in different populations of the same breed. There is increasing evidence that the influence of noncoding regulatory variants on complex traits may be beyond the effects of coding-region variants (Glazier et al. 2002). To date, a good number of noncoding DNA variants have been identified in candidate genes that affect production traits in livestock. There is evidence that conserved elements located in 3′ flanking regions control transcriptional gene regulation. Beck et al. (1991) have identified an enhancer element located in the 3′ flanking region of the human erythropoietin gene that controls transcriptional response to hypoxia. Trujillo et al. (2006) have also found that the human growth hormone gene contains a silencer embedded within an Alu repeat located in its 3′ flanking region. Moreover, three novel SNPs identified in the coding region of the bovine HSP70A1A gene were not reported by Li et al. (2011) in a Chinese Holstein population. In addition, the three SNPs were all silent mutations that did not change the amino acid sequence. However, the silent mutations might also affect the protein expression level through a synonymous codon usage bias or transcription differences. Duan et al. (2003) have reported that silent mutations in the human dopamine receptor D2 (DRD2) gene affect its mRNA stability and the synthesis of the receptor (Duan et al. 2003). Parmley et al. (2006) have found that silent mutations affect the stability of the secondary structure of mRNA in mammals (Parmley et al. 2006).

Because the eight SNPs located in the coding and 3′ flanking region of the HSP70A1A gene at adjacent positions were detected in a 426-bp fragment, we performed comprehensive LD and haplotype analyses of these SNPs and examined possible interactions of the genotypes with the level of heat stress. In the present study, LD analysis showed a strong association between tightly linked variants. Thus, three major haplotypes accounted for 91.8 % of the alleles. Association results revealed the presence of significant genotypes with probable consequences on heat tolerance. We suggest that genotype 12 confers better heat tolerance and higher HSP70 protein levels in response to high temperature compared with any of the other genotypes. Interestingly, six pairs of alleles of genotype 12 were heterozygous. These findings indicate that potential overdominance of the HSP70A1A gene may play a role in mediating resistivity to heat stress. Heterozygote advantage at a locus (often called overdominance) is one form of balancing selection. Balancing selection favors guarding resistance proteins (Van der Hoorn et al. 2002). Indeed, heterozygote advantage has been used to explain the polymorphisms in the major histocompatibility complex, as heterozygotes presented two sets of epitopes to T cells and were able to respond more efficiently to pathogens (Carrington et al. 1999; Jeffery et al. 2000; Thursz et al. 1997). Heat shock proteins are known to protect cells from several stressors. Basirico et al. (2011) have also found that cows heterozygous at g1128G/T in the HSP70A1A 5′ UTR had higher cell viability and an increase in the levels of the HSP70A1A gene and HSP70 protein after HS compared with cows homozygous for guanine or homozygous for thymine. Furthermore, the population genetics of balancing selection shows that in addition to maintaining diversity at the selected sites themselves, it increases diversity at closely linked neutral sites. This concept provides an explanation for the high number of polymorphisms found here in the short sequence of the HSP70A1A gene analyzed. Moreover, we cannot formally exclude the possibility that the associations observed result from distinct sequence variants in LD with the heat-resistant traits because a high level of genetic variation may be closely related to the gene migration flow, which is attributed to long-term adaptation to the environment. Some loci known to be involved in defense processes have high sequence polymorphism. One such locus in Arabidopsis thaliana is estimated to have nucleotide diversity above 4 % for synonymous sites (and even for nonsynonymous ones) (Rose et al. 2004).

Here, we identified eight SNPs in the HSP70A1A 3′ flanking and CDS regions of a Holstein population from South China. The high sequence polymorphism observed may be a reflection of the fact that a self-protection mechanism present in Holstein cattle from South China under heat stress may bring self-regulation into full play to adapt to the hot environment. It is probably the case that haplotypes 1 and 2, with different structures, act together to exert stronger phenotypic effects. However, further studies of the underlying molecular mechanisms are needed to determine whether heterozygote advantage does exist for the HSP70A1A polymorphisms and how these polymorphisms alter HSP70 gene or protein expression. The mutation sites ascertained in this study may be useful in the future as molecular genetic markers to assist selection for heat tolerance in cattle.

Acknowledgments

This work was supported financially by the Key Program of National Natural Science Foundation of Hubei Province (2010CBB01301), the Hubei Key Laboratory of Animal Embryo Engineering and Molecular Breeding (2010ZD111), (2012ZD105) the Science Foundation for Young Scholars of Hubei Academy of Agricultural Sciences (2011NKYJJ16), the Earmarked Fund for the Modern Agro-industry Technology Research System (CARS-35), the 12th Five Years Key Programs for Science and Technology Development of China (2011BAD28B01-01), the Special Fund for Agro-scientific Research in the Public Interest (201003036–02), the Specialized Research Fund for the Doctoral Program of Higher Education (20120146120016), and the public welfare scientific research of Hubei province (2012DBA22).

References

  1. Adamowicz T, Pers E, Lechniak D. A new SNP in the 3'-UTR of the hsp 70–1 gene in Bos taurus and Bos indicus. Biochem Genet. 2005;43(11–12):623–627. doi: 10.1007/s10528-005-9119-2. [DOI] [PubMed] [Google Scholar]
  2. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21(2):263–265. doi: 10.1093/bioinformatics/bth457. [DOI] [PubMed] [Google Scholar]
  3. Basirico L, Morera P, Primi V, Lacetera N, Nardone A, Bernabucci U. Cellular thermotolerance is associated with heat shock protein 70.1 genetic polymorphisms in Holstein lactating cows. Cell Stress Chaperones. 2011;16(4):441–448. doi: 10.1007/s12192-011-0257-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Beck I, Ramirez S, Weinmann R, Caro J (1991) Enhancer element at the 3'-flanking region controls transcriptional response to hypoxia in the human erythropoietin gene. J Biol Chem 266(24):15563–15566 [PubMed]
  5. Berman A. Invited review: are adaptations present to support dairy cattle productivity in warm climates? J Dairy Sci. 2011;94(5):2147–2158. doi: 10.3168/jds.2010-3962. [DOI] [PubMed] [Google Scholar]
  6. Brown A, Reiter S, Brown M, Johnson Z, Nabhan I, Lamb M, Starnes A, Rosenkrans C. Effects of heat shock protein-70 gene and forage system on milk yield and composition of beef cattle. Prof Ani Sci. 2010;26(4):398–403. [Google Scholar]
  7. Carrington M, Nelson GW, Martin MP, Kissner T, Vlahov D, Goedert JJ, Kaslow R, Buchbinder S, Hoots K, O'Brien SJ. HLA and HIV-1: heterozygote advantage and B*35-Cw*04 disadvantage. Science. 1999;283(5408):1748–1752. doi: 10.1126/science.283.5408.1748. [DOI] [PubMed] [Google Scholar]
  8. Cheng WJ, Li QL, Wang CF, Wang HM, Li JB, Sun YM, Zhong JF. Genetic polymorphism of HSP70-1 gene and its correlation with resistance to mastitis in Chinese Holstein. Yi Chuan. 2009;31(2):169–174. doi: 10.3724/SP.J.1005.2009.00169. [DOI] [PubMed] [Google Scholar]
  9. Collier RJ, Dahl GE, VanBaale MJ. Major advances associated with environmental effects on dairy cattle. J Dairy Sci. 2006;89(4):1244–1253. doi: 10.3168/jds.S0022-0302(06)72193-2. [DOI] [PubMed] [Google Scholar]
  10. Duan J, Wainwright MS, Comeron JM, Saitou N, Sanders AR, Gelernter J, Gejman PV. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet. 2003;12(3):205–216. doi: 10.1093/hmg/ddg055. [DOI] [PubMed] [Google Scholar]
  11. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DeFelice M, Lochner A, Faggart M, Liu-Cordero SN, Rotimi C, Adeyemo A, Cooper R, Ward R, Lander ES, Daly MJ, Altshuler D. The structure of haplotype blocks in the human genome. Science. 2002;296(5576):2225–2229. doi: 10.1126/science.1069424. [DOI] [PubMed] [Google Scholar]
  12. Glazier AM, Nadeau JH, Aitman TJ. Finding genes that underlie complex traits. Science. 2002;298(5602):2345–2349. doi: 10.1126/science.1076641. [DOI] [PubMed] [Google Scholar]
  13. Grosz MD, Skow LC, Stone RT. An AluI polymorphism at the bovine 70 kD heat-shock protein-1 (HSP70-1) locus. Anim Genet. 1994;25(3):196. doi: 10.1111/j.1365-2052.1994.tb00113.x. [DOI] [PubMed] [Google Scholar]
  14. He M, Guo H, Yang X, Zhang X, Zhou L, Cheng L, Zeng H, Hu FB, Tanguay RM, Wu T. Functional SNPs in HSPA1A gene predict risk of coronary heart disease. PLoS One. 2009;4(3):e4851. doi: 10.1371/journal.pone.0004851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Jeffery KJ, Siddiqui AA, Bunce M, Lloyd AL, Vine AM, Witkover AD, Izumo S, Usuku K, Welsh KI, Osame M, Bangham CR. The influence of HLA class I alleles and heterozygosity on the outcome of human T cell lymphotropic virus type I infection. J Immunol. 2000;165(12):7278–7284. doi: 10.4049/jimmunol.165.12.7278. [DOI] [PubMed] [Google Scholar]
  16. Li Q, Han J, Du F, Ju Z, Huang J, Wang J, Li R, Wang C, Zhong J. Novel SNPs in HSP70A1A gene and the association of polymorphisms with thermo tolerance traits and tissue specific expression in Chinese Holstein cattle. Mol Biol Rep. 2011;38(4):2657–2663. doi: 10.1007/s11033-010-0407-5. [DOI] [PubMed] [Google Scholar]
  17. Maloyan A, Palmon A, Horowitz M. Heat acclimation increases the basal HSP72 level and alters its production dynamics during heat stress. Am J Physiol. 1999;276(5 Pt 2):R1506–R1515. doi: 10.1152/ajpregu.1999.276.5.R1506. [DOI] [PubMed] [Google Scholar]
  18. Mosser DD, Caron AW, Bourget L, Meriin AB, Sherman MY, Morimoto RI, Massie B. The chaperone function of hsp70 is required for protection against stress-induced apoptosis. Mol Cell Biol. 2000;20(19):7146–7159. doi: 10.1128/MCB.20.19.7146-7159.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Parmley JL, Chamary J, Hurst LD. Evidence for purifying selection against synonymous mutations in mammalian exonic splicing enhancers. Mol Biol Evol. 2006;23(2):301–309. doi: 10.1093/molbev/msj035. [DOI] [PubMed] [Google Scholar]
  20. Rose LE, Bittner-Eddy PD, Langley CH, Holub EB, Michelmore RW, Beynon JL. The maintenance of extreme amino acid diversity at the disease resistance gene, RPP13, in Arabidopsis thaliana. Genetics. 2004;166(3):1517–1527. doi: 10.1534/genetics.166.3.1517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Rosenkrans C, Jr, Banks A, Reiter S, Looper M. Calving traits of crossbred Brahman cows are associated with Heat Shock Protein 70 genetic polymorphisms. Anim Reprod Sci. 2010;119(3–4):178–182. doi: 10.1016/j.anireprosci.2010.02.005. [DOI] [PubMed] [Google Scholar]
  22. Schwerin M, Maak S, Kalbe C, Fuerbass R. Functional promoter variants of highly conserved inducible hsp70 genes significantly affect stress response. Biochim Biophys Acta. 2001;1522(2):108–111. doi: 10.1016/S0167-4781(01)00313-X. [DOI] [PubMed] [Google Scholar]
  23. Schwerin M, Maak S, Hagendorf A, von Lengerken G, Seyfert HM. A 3′-UTR variant of the inducible porcine hsp70.2 gene affects mRNA stability. Biochim Biophys Acta. 2002;1578(1–3):90–94. doi: 10.1016/s0167-4781(02)00448-7. [DOI] [PubMed] [Google Scholar]
  24. Singh R, Kolvraa S, Bross P, Jensen UB, Gregersen N, Tan Q, Knudsen C, Rattan SI. Reduced heat shock response in human mononuclear cells during aging and its association with polymorphisms in HSP70 genes. Cell Stress Chaperones. 2006;11(3):208–215. doi: 10.1379/CSC-184R.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Stephens M, Smith NJ, Donnelly P. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet. 2001;68(4):978–989. doi: 10.1086/319501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Trujillo MA, Sakagashira M, Eberhardt NL (2006) The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3'-flanking region. Mol Endocrinol 20(10):2559–2575. doi:10.1210/me.2006-0147 [DOI] [PubMed]
  27. Thursz MR, Thomas HC, Greenwood BM, Hill AV. Heterozygote advantage for HLA class-II type in hepatitis B virus infection. Nat Genet. 1997;17(1):11–12. doi: 10.1038/ng0997-11. [DOI] [PubMed] [Google Scholar]
  28. Van der Hoorn RA, De Wit PJ, Joosten MH. Balancing selection favors guarding resistance proteins. Trends Plant Sci. 2002;7(2):67–71. doi: 10.1016/S1360-1385(01)02188-4. [DOI] [PubMed] [Google Scholar]
  29. Wang Z, Wang G, Huang J, Li Q, Wang C, Zhong J. Novel SNPs in the ATP1B2 gene and their associations with milk yield, milk composition and heat-resistance traits in Chinese Holstein cows. Mol Biol Rep. 2011;38(3):1749–1755. doi: 10.1007/s11033-010-0289-6. [DOI] [PubMed] [Google Scholar]
  30. Wolfenson D, Roth Z, Meidan R. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim Reprod Sci. 2000;60–61:535–547. doi: 10.1016/S0378-4320(00)00102-0. [DOI] [PubMed] [Google Scholar]

Articles from Cell Stress & Chaperones are provided here courtesy of Elsevier

RESOURCES