Summary
Memory T cells protect hosts from pathogen reinfection, but how these cells emerge from a pool of antigen-experienced T cells is unclear. Here we show that mice lacking the transcription factor Foxo1 in activated CD8+ T cells had defective secondary, but not primary, responses to Listeria monocytogenes infection. Compared to short-lived effector T cells, memory precursor T cells expressed higher amounts of Foxo1, which promoted their generation and maintenance. Chromatin immunoprecipitation sequencing experiments revealed the transcription factor Tcf7 and the chemokine receptor Ccr7 as Foxo1-bound target genes, which have critical functions in central memory T cell differentiation and trafficking. These findings demonstrate that Foxo1 is selectively incorporated into the genetic program that regulates memory CD8+ T cell responses to infection.
Introduction
A defining hallmark of adaptive immunity is the development of immunological memory characterized by swifter and more vigorous responses against secondary encounter with a pathogen (Ahmed and Gray, 1996; Bevan, 2011). During infection, engagement of T cell receptor (TCR) in the context of co-stimulatory and pro-inflammatory signals activates naïve CD8+ T cells to undergo clonal expansion and effector T cell differentiation; this is followed by a contraction phase in which most of the antigen-experienced T cells die, and a small subset of them differentiate into memory cells. In response to antigen restimulation, memory CD8+ T cells rapidly proliferate and differentiate into cytolytic T lymphocytes that confer enhanced protection against intracellular pathogens.
Understanding how antigen-experienced T cells differentiate to memory CD8+ T cells is an area of active research(Arens and Schoenberger, 2010; Harty and Badovinac, 2008; Jameson and Masopust, 2009; Kaech and Cui, 2012; Lefrancois, 2006; Williams and Bevan, 2007). Recent studies have identified the cellular markers that can be used to differentiate effector T cell subsets based on their memory T cell-forming potential. Effector T cells with low expression of the Interleukin-7 receptor α (IL-7Rα) and high expression of the Killer cell lectin-like receptor G1 (KLRG1) are typically short-lived, whereas the IL-7RαhiKLRG1lo effector T cells are poised to differentiate into long-lived memory cells(Joshi et al., 2007; Kaech et al., 2003; Sarkar et al., 2008; Schluns et al., 2000).
A crucial determinant of the cell-fate choice between short-lived effectors and long-lived memory cells is the strength and/or duration of the signals delivered by antigen, co-stimulation, and pro-inflammatory cytokines(Badovinac et al., 2005; Badovinac et al., 2004). Excessive stimulation of T cells enhances the expression of transcription factors, including T-bet, which promotes CD8+ T cell differentiation into short-lived effectors(Joshi et al., 2007). In addition, T cell activation suppresses the expression of the transcription factor TCF-7, also known as T cell factor 1 (TCF1), which is re-induced in memory T cells(Sarkar et al., 2008). TCF-7 mediates signaling downstream of the Wnt pathway, and promotes the development of memory T cells(Jeannet et al., 2010; Zhao et al., 2010; Zhou et al., 2010). A common signaling event downstream of TCR, co-stimulation, and pro-inflammatory cytokines is the activation of Akt kinase(Finlay and Cantrell, 2011). Sustained Akt activation augments T-bet expression and drives T cell terminal differentiation, whereas Akt blockade increases the numbers of memory T cells(Hand et al., 2010; Kim et al., 2012; Macintyre et al., 2011). Indeed, Akt signaling regulates the expression of genes encoding TCF-7, IL-7Rα, CCR7, and L-selectin, molecules essential for memory CD8+ T cell differentiation, survival, and migration(Kim et al., 2012; Macintyre et al., 2011). In line with these studies, inhibition of one of the downstream Akt signaling targets, the mechanistic target of rapamycin (mTOR), promotes the generation of memory CD8+ T cells(Araki et al., 2009). Nevertheless, the precise mechanisms underlying the pleiotropic activities of Akt kinase in the control of effector and memory T cell differentiation remain largely uncharacterized.
The forkhead-box O (Foxo) family of transcription factors is a well-defined target of the Akt kinase. Akt phosphorylation at the three conserved sites of Foxo proteins triggers their nuclear exclusion and inactivation(Calnan and Brunet, 2008). Aside from their evolutionarily conserved functions in nutrient sensing and stress responses, Foxo proteins regulate the expression of target genes involved in the control of T cell homeostasis and tolerance(Hedrick et al., 2012; Ouyang and Li, 2011). For instance, both Foxo1 and Foxo3 proteins promote the commitment of developing thymocytes to the regulatory T cell lineage through the induction of Foxp3 expression(Kerdiles et al., 2010; Ouyang et al., 2010). Our recent study showed that Foxo1 is the predominant Foxo protein expressed in mature regulatory T cells, and is indispensable for regulatory T cell function in part via the inhibition of the pro-inflammatory cytokine IFNγ expression(Ouyang et al., 2012). Earlier studies have also revealed a critical role for Foxo1 in the control of naïve T cell homeostasis, which is in part dependent on the induction of IL-7Rα expression(Gubbels Bupp et al., 2009; Kerdiles et al., 2009; Ouyang et al., 2009). The function of Foxo proteins in the control of T cell responses to infection has not been well studied. In models of viral infection, Foxo3 deficiency results in enhanced effector and memory CD8+ T cell responses(Dejean et al., 2009; Sullivan et al., 2012a; Sullivan et al., 2012b)_ENREF_25. In a transfer model of in vitro-activated CD8+ T cells, Foxo1 deficiency leads to the diminished maintenance of CD8+ T cells in mice, which has been associated with the enhanced effector T cell responses(Rao et al., 2012). However, the precise functions of and mechanisms by which Foxo1 controls T cell responses to infection are unknown.
In this report, we developed a mouse model to abrogate Foxo1 expression specifically in antigen-experienced CD8+ T cells in mice infected with Listeria monocytogenes. We found that Foxo1 deficiency did not affect effector T cell expansion or function, but was essential for the generation of memory T cells and for the optimal protection of mice from Listeria monocytogenes re-infection. Mixed bone-marrow chimera and T cell transfer experiments further demonstrated a cell-intrinsic role for Foxo1 in promoting memory T cell differentiation, which was in line with enhanced Foxo1 expression in memory precursor effector T cells. Gene expression studies showed that a set of Foxo1-activated target genes including Il7r, Bcl2, Sell, Ccr7, and Tcf7 were differentially expressed between wild-type and Foxo1-deficient memory precursor cells. Importantly, genome-wide Foxo1 binding experiments revealed Ccr7 and Tcf7 as Foxo1-bound target genes in T cells. Together, these findings unveil an essential role for Foxo1 in the development of acquired immunity against an intracellular pathogen, and define the precise Foxo1-dependent transcriptional programs involved in the control of memory T cell differentiation and homeostasis.
Results
Conditional Deletion of Foxo1 in Activated CD8+ T Cells
Using a recently generated Foxo1-GFP reporter mouse strain, we found that Foxo1 was up-regulated in mature thymic CD8+ T cells, and peripheral CD8+ T cells maintained high Foxo1 expression(Ouyang et al., 2012) and data not shown). These observations are in line with the findings that among the three Foxo genes expressed in T cells, the transcript of Foxo1 is specifically induced during T cell maturation(Ouyang et al., 2010), and Foxo1 has an essential role in promoting naïve CD8+ T cell homeostasis in the peripheral lymphoid tissues(Gubbels Bupp et al., 2009; Kerdiles et al., 2009; Ouyang et al., 2009).
To study the function of Foxo1 in the control of effector and memory T cell responses to infection, we wished to delete Foxo1 specifically in antigen-experienced CD8+ T cells in mice infected with Listeria monocytogenes expressing the chicken ovalbumin as a model antigen (LM-OVA). Previous cell-fate mapping experiments revealed that both terminally differentiated effector T cells and memory precursor T cells express the effector molecule granzyme B in response to viral infection (Bannard et al., 2009). In addition, a transgenic mouse strain expressing the Cre recombinase under the control of the human granzyme B promoter (GzmB-cre) has been used to mark memory T cell populations in models of lymphocytic choriomeningitis virus infection (Jacob and Baltimore, 1999). To determine whether GzmB-cre targets the antigen-experienced CD8+ T cells in LM-OVA-infected mice, we crossed the GzmB-cre transgenic mice with Rosa26-flox-stop-flox-YFP mice that have a knock-in allele of floxed stop site upstream of the yellow fluorescent protein (YFP) reporter gene in the Rosa26 locus. Indeed, YFP fluorescence was detected in approximately 85% of Kb-ova+ T cells by 7 days after LM-OVA infection of GzmB-cre Rosa26-flox-stop-flox-YFP mice, whereas less than 2% of the CD44loCD8+ naïve T cells expressed YFP (Supplementary Figure 1A). To delete Foxo1 in activated CD8+ T cells, we crossed mice carrying floxed Foxo1 alleles (Foxo1fl/fl) to the GzmB-cre background. Foxo1 protein was barely detectable in Kb-ova+ T cells from LM-OVA-infected GzmB-cre Foxo1fl/fl mice, whereas naïve CD8+ T cells from these mice expressed comparable amounts of Foxo1 to wild-type T cells (Supplementary Figure 1B). Therefore, the GzmB-cre transgenic mice provide an ideal model to study Foxo1 function in antigen-experienced CD8+ T cells in response to LM-OVA infection.
Unchanged Effector CD8+ T Cell Responses in the Absence of Foxo1
Foxo1 nuclear localization is inhibited by Akt kinase-induced phosphorylation. Recent studies showed that ectopic expression of an Akt-insensitive Foxo1 mutant attenuates IFNγ and Granzyme-B expression in CD8+ T cells, and in vitro activated Foxo1-deficient T cells produce increased amounts of these effector molecules(Macintyre et al., 2011; Rao et al., 2012). However, whether the endogenous Foxo1 protein suppresses effector CD8+ T cell responses to infection was not investigated. To this end, we challenged wild-type and GzmB-cre Foxo1fl/fl mice with LM-OVA, and assessed OVA antigen-specific T cell responses in the spleen and liver, two major target organs of Listeria monocytogenes infection. The frequencies and numbers of Kb-ova+ T cells were comparable between wild-type and GzmB-cre Foxo1fl/fl mice at 7 days post infection (Figure 1A). Upon re-stimulation with the SIINFEKL peptide, wild-type and Foxo1- deficient Kb-ova+ T cells produced similar amounts of IFNγ (Figure 1B). In addition, Granzyme-B expression was unaffected in the absence of Foxo1 (Supplementary Figure 2A). To examine the in vivo killing capacity of effector T cells, we labeled control and SIINFEKL peptide-pulsed splenocytes with high and low doses of CFSE, mixed the cells at a 1:1 ratio, and transferred them to wild-type and GzmB-cre Foxo1fl/fl mice that had been infected with LM-OVA. The antigen-loaded target cells were eliminated to a similar extent in these mice (Figure 1C). In line with these observations, wild-type and GzmB-cre Foxo1fl/fl mice had comparable bacterial burdens during primary infection (Supplementary Figure 2B). These findings demonstrate that deletion of Foxo1 in activated T cells does not affect effector CD8+ T cell expansion or function in response to Listeria monocytogenes infection.
Figure 1. Foxo1 deficiency does not affect effector CD8+T cell responses to infection.
(A-C) Wild-type (WT) and GzmB-cre Foxo1fl/fl mice were infected with 5×103 CFUs of LM-OVA. CD8+ T cell responses were analyzed at day 7 post infection.
(A) The numbers of splenic and liver Kb-ova+ CD8+ T cells in WT and GzmB-cre Foxo1fl/fl mice (n = 4 per genotype).
(B) The numbers of splenic and liver IFNγ+ T cells in WT and GzmB-cre Foxo1fl/fl mice after T cells were re-stimulated with the SIINFEKL peptide (n = 3 per genotype).
(C) CFSE-labeled SIINFEKL peptide-pulsed target cells and control target cells were mixed at a 1:1 ratio and transferred into WT and GzmB-cre Foxo1fl/fl mice. Four hours post-transfer, the percentages of splenic and liver CFSElow peptide-pulsed target cells were used to calculate antigen-specific killing activity (n = 4-5 per genotype). Data are represented as mean +/− SEM. The p-values between the two groups are shown. See also Figures S1 and S2.
Defective Memory CD8+ T Cell Responses in Foxo1-deficient Mice
Following T cell clonal expansion, most antigen-experienced CD8+ T cells are depleted during the contraction phase of the immune response, whereas a small fraction of T cells persist and differentiate into memory T cells. To investigate the role of Foxo1 in the control of memory T cell differentiation, we assessed OVA antigen-specific T cells in the spleens of wild-type and GzmB-cre Foxo1fl/fl mice at 60 days post infection. We found that the frequencies of Kb-ova+ CD8+ T cells were decreased by more than 2 fold in Foxo1-deficient mice (Figure 2A). Moreover, whereas the numbers of OVA antigen-specific T cells were comparable between wild-type and GzmB-cre Foxo1fl/fl mice at 7 days post infection, Foxo1-deficient Kb-ova+ T cells underwent a higher rate of contraction, and were substantially depleted at day 60 (Figure 2B).
Figure 2. Foxo1 is essential for the generation of memory T cells.
(A) Wild-type (WT) and GzmB-cre Foxo1fl/fl mice were infected with 5×103 CFUs of LM-OVA. The frequencies of splenic Kb-ova+ CD8+ T cells at 60 days post infection are shown. Data are representative of three independent experiments.
(B) The numbers of splenic Kb-ova+ CD8+ T cells in WT and GzmB-cre Foxo1fl/fl mice at day 7, 28, and 60 post infection (n = 4 per genotype). Data are represented as mean +/− SEM. The p-values between the two groups of T cells are shown. Asterisk indicates a statistically significant difference.
To investigate whether compromised memory T cell differentiation in the absence of Foxo1 resulted in defective recall responses, we challenged wild-type and GzmB-cre Foxo1fl/fl mice with a higher dose of LM-OVA at day 60 following primary infection. As expected, wild-type mice mounted a robust recall response against the OVA antigen at day 3 (Figure 3A). However, the frequencies and the numbers of Kb-ova+ T cells were largely decreased in the spleens and livers of Foxo1-deficient mice (Figure 3A). In line with these observations, the numbers of IFNγ-producing CD8+ T cells were greatly diminished upon re-stimulation with the SIINFEKL peptide (Figure 3B). In addition, GzmB-cre Foxo1fl/fl mice had reduced cytolytic activity against OVA antigen-pulsed target cells in vivo(Figure 3C). To investigate whether the compromised recall response was associated with failed protective immunity, we determined the bacterial burden in wild-type and GzmB-cre Foxo1fl/fl mice 3 days post secondary infection. We found that Foxo1-deficient mice had more than 10-fold higher Listeria colony forming units than wild-type mice (Figure 3D). Thus, Foxo1 deficiency in antigen-experienced T cells results in compromised protective immunity against Listeria monocytogenes re-challenge, revealing a critical function for Foxo1 in promoting memory CD8+ T cell responses to infection.
Figure 3. Foxo1 deficiency results in defective recall responses.
(A-D) Wild-type (WT) and GzmB-cre Foxo1fl/fl mice were re-challenged with 1×105 CFUs of LM-OVA at day 60 post infection. T cell responses and bacterial burden were determined 3 days after the secondary infection. (A) The numbers of splenic and liver Kb-ova+ CD8+ T cells in WT and GzmB-cre Foxo1fl/fl mice (n = 3 per genotype). Data are representative of three independent experiments.
(B) The numbers of splenic and liver IFNγ+ T cells in WT and GzmB-cre Foxo1fl/fl mice after T cells were re-stimulated with the SIINFEKL peptide (n = 3 per genotype).
(C) CFSE-labeled SIINFEKL peptide-pulsed target cells and control target cells were mixed at a 1:1 ratio and transferred into WT and GzmB-cre Foxo1fl/fl mice. Four hours later, the percentages of splenic and liver CFSElow peptide-pulsed target cells were used to calculate antigen-specific killing activity (n = 4-6 per genotype).
(D) Bacterial burden in the spleens of WT and GzmB-cre Foxo1fl/fl mice (n = 7 per genotype). Data are represented as mean +/− SEM. The p-values between the two groups of measurements are shown. Asterisk indicates a statistically significant difference.
A Cell-intrinsic Role for Foxo1 in Promoting Memory CD8+ T Cell Responses
In addition to effector CD8+ T cells, GzmB-cre transgenic mice express the Cre recombinase in natural killer (NK) cells (data not shown). Recent studies have shown that NK cells can differentiate to memory cells and contribute to long-term protection against infection (Sun and Lanier, 2011), raising the question of whether the compromised memory CD8+ T cell response in GzmB-cre Foxo1fl/fl mice is caused by CD8+ T cell-intrinsic or -extrinsic mechanisms. To differentiate between these possibilities, we created mixed bone-marrow chimera mice by transferring bone marrow cells from congenically marked wild-type and GzmB-cre Foxo1fl/fl mice into lethally irradiated recipients. After 8 weeks of bone marrow reconstitution, we infected mice with LM-OVA and assessed the frequencies of Kb-ova+ T cells at 60 days post infection. We found that the frequencies of OVA antigen-specific CD8+ T cells originating from the GzmB-cre Foxo1fl/fl bone marrow were 2-fold lower than the wild-type counterparts in the same recipients (Figure 4A), supporting a cell-intrinsic function for Foxo1 in promoting memory CD8+ T cell differentiation.
Figure 4. Foxo1 promotes memory T cell generation through cell-intrinsic mechanisms.
(A) Bone marrow cells from wild-type (WT) and GzmB-cre Foxo1fl/fl mice were mixed at a 1:1 ratio, and transferred into lethally irradiated recipients. The frequencies of Kb-ova+ CD8+ cells originating from WT and GzmB-cre Foxo1fl/fl bone marrow cells at day 60 post LM-OVA infection are shown. Data are representative of two independent experiments (n = 2-3 mice per group).
(B) WT OT-I (CD45.1/CD45.1) and GzmB-cre Foxo1fl/fl OT-I (CD45.1/CD45.2) cells were mixed at a 1:1 ratio, and transferred into WT recipients (CD45.2/CD25.2). The frequencies of splenic WT OT-I and GzmB-cre Foxo1fl/fl OT-I cells were determined at day 7 and 60 post infection, or at day 7 following the recall response. The ratios of the frequencies of GzmB-cre Foxo1fl/fl OT-I to WT OT-I cells are shown (n = 3-4). Data are represented as mean +/− SEM.
In these bone marrow chimera experiments, it is possible that a fraction of CD8+ T cells, especially T cells with strong tonic TCR signaling, undergo homeostatic proliferation in lymphopenic recipients, which might induce GzmB-cre expression to trigger Foxo1 deletion(Surh and Sprent, 2008; Zhang and Bevan, 2012). Because Foxo1 has an essential role in the control of naïve T cell homeostasis(Gubbels Bupp et al., 2009; Kerdiles et al., 2009; Ouyang et al., 2009), the TCR repertoire of OVA antigen-specific T cells could be altered in GzmB-cre Foxo1fl/fl CD8+ T cells before they encounter the cognate antigen. To control this variable in our analysis, we crossed GzmB-cre Foxo1fl/fl mice to the OT-I transgenic background in which CD8+ T cells expressed a SIINFEKL peptide-specific TCR. Congenically marked naïve wild-type OT-I cells and GzmB-cre Foxo1fl/fl OT-I cells were isolated, mixed at a 1:1 ratio, and co-transferred to wild-type recipient mice. Subsequently, these mice were infected with LM-OVA, and monitored for the differentiation of effector and memory T cells. In agreement with uncompromised effector T cell responses in GzmB-cre Foxo1fl/fl mice (Figure 1), the frequencies of splenic wild-type and GzmB-cre Foxo1fl/fl OT-I cells were comparable at 7 days post infection (Figure 4B). However, at 60 days post infection, the frequencies of GzmB-cre Foxo1fl/fl OT-I cells were approximately 2-fold lower than those of wild-type OT-I cells. Upon LM-OVA re-challenge, the ratios of Foxo1-deficient OT-I cells to wild-type OT-I cells were further decreased (Figure 4B). Taken together, these observations reveal a cell-intrinsic role for Foxo1 in promoting memory CD8+ T cell responses to Listeria monocytogenes infection.
Foxo1 Regulation of Memory Precursor Effector T Cell Generation
In response to infection, antigen-experienced T cells undergo clonal expansion and differentiate into heterogeneous populations of effector T cells including memory precursor effector T cells (MPECs) and short-lived effector T cells (SLECs). MPECs, defined by high expression of IL-7Rα and low expression of KLRG1, have increased potential to differentiate into memory T cells, whereas IL-7RαloKLRG1hi SLECs are largely depleted during the contraction phase of the T cell response(Joshi et al., 2007; Kaech et al., 2003; Sarkar et al., 2008; Schluns et al., 2000). To determine whether Foxo1 regulates memory CD8+ T cell generation via the control of memory precursor cells, we used the Foxo1-GFP reporter mouse strain to assess Foxo1 expression in MPECs and SLECs in mice at day 7 post-LM-OVA infection. We found that among the Kb-ova+ T cells, MPECs expressed higher amounts of Foxo1 than SLECs (Supplementary Figure 3A). Similar findings were made in LM-OVA-infected mice that received OT-I cells expressing the Foxo1-GFP reporter (Figure 5A). To investigate whether the increased Foxo1 expression in MPECs might be functionally relevant, we prepared RNA from MPECs and SLECs and performed gene-expressing profiling with Affymetrix oligonucleotide arrays. Intriguingly, among the transcripts differentially expressed between MPECs and SLECs were a subset of Foxo1 ‘signature’ genes that we had previously defined in naïve T cells(Ouyang et al., 2009) (Supplementary Figure 4 and Supplementary Table 1). These findings demonstrate that MPEC differentiation is associated with the enhanced Foxo1 expression, concomitant with the induction of Foxo1-dependent transcription in CD8+ T cells.
Figure 5. Reduced memory precursor effector T cell generation in the absence of Foxo1.
(A) OT-I cells expressing the Foxo1-GFP reporter were transferred to wild-type recipients. Foxo1-GFP expression in IL-7RαhiKLRG1lo memory precursor effector T cells (MPECs) and IL-7RαloKLRG1hi short-lived effector T cells (SLECs) at day 7 post LM-OVA infection was determined. CD8+ T cells from wild-type mice were used as a negative control for GFP expression.
(B-C) Wild-type (WT) OT-I and GzmB-cre Foxo1fl/fl OT-I cells were mixed at a 1:1 ratio and transferred into wild-type recipients. (B) Flow cytometric analysis of IL-7Rα and KLRG1 expression in WT OT-I and GzmB-cre Foxo1fl/fl OT-I cells at day 7 post infection. The frequencies of IL-7RαhiKLRG1lo MPECs are shown.
(C) Flow cytometric analysis of CD27 and KLRG1 expression in WT OT-I and GzmB-cre Foxo1fl/fl OT-I cells at day 7 post infection. The frequencies of CD27hiKLRG1lo MPECs are shown. Data are representative of two independent experiments (n = 2-3 mice per group). Data are represented as mean +/− SEM. The p-values between the two groups are shown. Asterisk indicates a statistically significant difference. See also Figures S3, S4, S5 and Table S1.
To investigate the role of Foxo1 in the control of MPECs, we examined MPEC frequencies at day 7 post-LM-OVA infection in mice that had received wild-type and GzmB-cre Foxo1fl/fl OT-I cells. Compared to wild-type OT-I cells, approximately 10-fold fewer Foxo1-deficient OT-I cells displayed the IL-7RαhiKLRG1lo MPEC cell surface phenotype (Figure 5B). In addition, reduced numbers of IL-7RαhiKLRG1lo Kb-ova+ polyclonal TCR T cells were observed in LM-OVA-infected GzmB-cre Foxo1fl/fl mice (Supplementary Figure 3B). Previous studies have established Il7r (encoding IL-7Rα) as a Foxo1 target gene in T cells (Kerdiles et al., 2009; Ouyang et al., 2009), raising the question of whether the diminished numbers of MPECs is due to compromised IL-7Rα expression or loss of the MPEC population. To differentiate these possibilities, we used the cell surface marker CD27, which is highly expressed in MPECs, and has an important function in the control of memory T cell responses(Hendriks et al., 2000). The frequencies of MPECs as defined by the CD27hiKLRG1lo cell surface phenotype were reduced in the absence of Foxo1 (Figure 5C and Supplementary Figure 3C), albeit to a lesser extent than that of IL-7RαhiKLRG1lo T cells (Figure 5B and Supplementary Figure 3B). These findings imply that enhanced Foxo1 expression in MPECs promotes their differentiation and/or homeostasis.
IL-7-dependent signaling is essential for the long-term maintenance of memory T cells (Kaech et al., 2003; Schluns et al., 2000). Compared to wild-type memory OT-I cells at day 60 post-LM-OVA infection, Foxo1-deficient memory T cells expressed lower amounts of IL-7Rα (Supplementary Figure 5A), raising the possibility that the defective memory T cell response in the absence of Foxo1 might be caused by reduced IL-7Rα expression. To test this hypothesis, we crossed GzmB-cre Foxo1fl/fl OT-I mice with IL-7Rα transgenic (IL-7RTg) mice (Park et al., 2004). Congenically marked naïve IL-7RTg OT-I cells and GzmB-cre Foxo1fl/fl IL-7RTg OT-I cells were isolated, mixed at a 1:1 ratio, and co-transferred to wild-type recipient mice. Subsequently, these mice were infected with LM-OVA, and monitored for the differentiation of effector and memory T cells. IL-7RTg largely restored IL-7Rα expression in Foxo1-deficient OT-I cells (Supplementary Figure 5B). As expected, the frequencies of wild-type and GzmB-cre Foxo1fl/fl IL-7RTg OT-I cells were comparable at 7 days post infection (Supplementary Figure 5C). Surprisingly, IL-7Rα over-expression failed to correct the defects of Foxo1-deficient OT-I memory cells at day 60 (Supplementary Figure 5C). These observations suggest that in addition to IL-7Rα, Foxo1 regulates the expression of other essential target genes involved in the control of memory T cell generation.
Foxo1-dependant Transcriptional Programs in Memory Precursor Effector T Cells
To identify Foxo1-dependent transcriptional programs in MPECs, we purified wild-type and GzmB-cre Foxo1fl/fl CD27hiKLRG1lo OT-I cells from recipient mice at day 7 post- LM-OVA infection. We prepared RNA from these cells, and validated deletion of the floxed exon 1 of Foxo1 by quantitative PCR experiments (Figure 6B). With these samples, we performed gene-expression profiling with Affymetrix oligonucleotide arrays. 393 genes were differentially expressed by a difference of more than 1.5-fold between wild-type and Foxo1-deficient OT-I cells (Figure 6A and Supplementary Table 2). In line with the severe defect of IL-7Rα protein expression (Figure 5B), Il7r and the IL-7-regulated pro-survival Bcl2 gene were among the most highly down-regulated target genes in Foxo1-deficient MPECs (Figure 6A and 6B). In addition, expression of Sell and Ccr7, encoding the adhesion molecule L-selectin (CD62L) and the chemokine receptor CCR7 that are essential for the trafficking of central memory phenotype T cells in lymphoid tissues, were reduced in the absence of Foxo1 (Figure 6A and 6B). Furthermore, compared to wild-type MPECs, Foxo1-deficient MPECs expressed lower amounts of Tcf7, which encodes the transcription factor TCF-7 (Figure 6A and 6B). Intriguingly, TCF-7 has also been shown to be crucial for the differentiation of central memory T cells(Zhou et al., 2010), which reside in the lymphoid tissues, and mount robust recall responses against antigen re-challenge.
Figure 6. Foxo1-dependent gene expression in memory precursor effector T cells.
(A) Volcano plot of differentially expressed genes between wild-type (WT) CD27hiKLRG1lo OT-I and GzmB-cre Foxo1fl/fl (knockout, KO) CD27hiKLRG1lo OT-I cells at 7 days post infection. Data are generated from two independent experiments. Selected Foxo1 target genes are indicated.
(B) Differential Il7r, Bcl2, Sell, Ccr7, Tcf7 and Foxo1 gene expression between WT CD27hiKLRG1lo OT-I and KO CD27hiKLRG1lo OT-I cells at 7 days post infection was confirmed by quantitative PCR. Data are generated from two independent experiments with triplicates for each sample. The different Delta Ct of the two replicates were used to calculate the average values. Data are represented as mean +/− SEM. The p-values between the two groups are shown. Asterisk indicates a statistically significant difference. See also Figure S6 and Table S2.
To explore the role of Foxo1 in regulating central memory T cell generation, we further assessed memory cell populations in the lymph nodes and bone marrow of mice transferred with wild-type and Foxo1-deficient OT-I cells. Strikingly, the frequencies of lymph node GzmB-cre Foxo1fl/fl OT-I cells were approximately 20-fold lower than those of wild-type OT-I cells at 60 days post infection in the absence or presence of IL-7Rα over-expression (Supplementary Figures 5D and 6A), and such difference was maintained during the recall response (Supplementary Figure 6A). In contrast, Foxo1- deficient memory OT-I cells were more abundant than the wild-type counterpart in the bone marrow of the same mouse (Supplementary Figure 6A). However, upon LM-OVA re-challenge, the relative frequencies of Foxo1-deficient OT-I cells to wild-type OT-I cells were reduced (Supplementary Figure 6A). The defects of recall responses were associated with the reduced numbers of CD44hiCD62Lhi central memory T cells in the bone marrow (Supplementary Figures 6B). In addition, the central memory T cell defects in the bone marrow were still present under the condition of IL-7Rα overexpression (Supplementary Figures 5E). Taken together, these observations suggest a specific function for Foxo1 in promoting the expression of target genes involved in the survival, as well as the trafficking and transcriptional regulation of central memory T cells.
Previous studies have established Il7r as a Foxo1-bound target gene in naïve T cells(Kerdiles et al., 2009; Ouyang et al., 2009). To investigate whether Foxo1 binds to the Il7r enhancer element in activated T cells, we utilized a previously described differentiation protocol of memory-like effector T cells (Manjunath et al., 2001). OT-I cells differentiated in the presence of the common g-chain cytokine IL-15 adopted a CD44hiCD62LhiIL-7RαhiCCR7hiTCF-7hi central memory T cell phenotype, whereas IL-2-stimulated T cells were CD44hiCD62LloIL-7RαloCCR7loTCF-7lo, resembling terminally differentiated effector T cells (Supplementary Figure 7A and 7B). Chromatin immunoprecipitation coupled to quantitative PCR (ChIP-qPCR) experiments revealed that Foxo1 was recruited to the Il7r enhancer element in IL-15-treated OT-I cells (Supplementary Figure 7C), supporting Il7r as a direct Foxo1 target gene in MPECs (Figure 5B and Supplementary Figure 3B).
In contrast to Il7r, Foxo1 regulation of Sell and Ccr7 expression has been attributed to Foxo1 induction of the transcription factor Klf-2(Kerdiles et al., 2009). However, Klf2 mRNA was not differentially expressed between wild-type and Foxo1-deficient MPECs (Supplementary Table 2), raising the possibility that these target genes may also be directly regulated by Foxo1. To test this hypothesis, we defined the genome-wide Foxo1 binding sites in CD8+ T cells by performing chromatin immunoprecipitation coupled to high throughput sequencing (ChIP-seq) experiments using either Foxo1 antibody precipitation of chromatin purified from CD8+ T cells from C57BL/6 mice, or streptavidin pull-down of chromatin from T cells from mice expressing a biontinylated form of Foxo1 as previously described (Ouyang et al., 2012). ChIP DNA libraries were prepared from these samples, and were used for sequencing single-end 36 base pair reads. To reduce the noise of peak detection, we focused on the genomic loci that were shared between the antibody and the biotinylated Foxo1 samples. These studies identified Ccr7 as a Foxo1-bound target gene in T cells. Foxo1 bound to two previously undefined conserved non-coding sequences in the Ccr7 locus that have canonical forkhead-binding motifs (Figure 7A and 7B). Foxo1 binding to these sites was further validated by ChIP-qPCR experiments (Figure 7C and Supplementary Figure 7C). In addition, CCR7 protein expression in memory T cells was profoundly diminished in the absence of Foxo1 (Figure 7D), supporting an important function for Foxo1 in promoting memory T cell migration and homeostasis in vivo.
Figure 7. Ccr7 and Tcf7 are Foxo1-bound target genes in CD8+T cells.
(A-D) Ccr7 as a putative Foxo1 direct target gene in CD8+ T cells. (A) Foxo1-bound regions in the Ccr7 locus. Arrowheads depict Foxo1 binding detected in both antibody-and biotin-based ChIP-seq experiments. Gene structure, chromosomal location, and sequence homology are shown.
(B) Alignment of the conserved Foxo1-binding sites in mouse and human Ccr7 gene loci. The consensus Foxo1-binding sequences are marked in red. Asterisks show the conserved nucleotides.
(C) Foxo1 binding to the ChIP-seq peaks upstream or downstream of the Ccr7 gene (Ccr7-1 or Ccr7-2) was confirmed by ChIP-quantitative (q)PCR. Results are presented relative to enrichment by immunoprecipitation with isotype-matched control antibody. Data are represented as mean +/− SEM.
(D) Expression of CCR7 protein in wild-type OT-I and GzmB-cre Foxo1fl/fl OT-I cells at day 60 post LM-OVA infection.
(E-H) Tcf7 as a putative Foxo1 direct target gene in CD8+ T cells. (E) A Foxo1-bound region in the Tcf7 locus. Arrowhead depicts Foxo1 binding detected in both antibody-and biotin-based ChIP-seq experiments. Gene structure, chromosomal location, and sequence homology are shown.
(F) Alignment of the conserved Foxo1-binding sites in mouse and human Tcf7 gene loci. The consensus Foxo1-binding sequences are marked in red. Asterisks show the conserved nucleotides.
(G) Foxo1 binding to the ChIP-seq peak of the Tcf7 promoter region was confirmed by ChIP-qPCR. Results are presented relative to enrichment by immunoprecipitation with isotype-matched control antibody. Data are represented as mean +/− SEM.
(H) Expression of TCF-7 protein in wild-type OT-I and GzmB-cre Foxo1fl/fl OT-I CD27hiKLRG1lo T cells at day 7 post LM-OVA infection. β-actin was used as a loading control. See also Figure S7.
TCF-7, an HMG-box family transcription factor, is predominantly expressed in the T cell lineage and has crucial functions in thymic T cell development (Weber et al., 2011). Recent studies have shown that TCF-7 is down-regulated during effector T cell differentiation, but is re-expressed in memory T cells to promote their differentiation and homeostasis (Sarkar et al., 2008; Zhou et al., 2010). We found that Foxo1 binds to the promoter region of Tcf7, which contains a highly conserved forkhead-binding motif (Figure 7E, 7F, 7G, and Supplementary Figure 7C). Importantly, in accordance with the diminished Tcf7 transcript levels (Figure 6), TCF-7 protein expression was reduced by more than three-fold in Foxo1-deficient MPECs (Figure 7H). Taken together, these findings suggest that in addition to the previously defined function of Foxo1 in promoting T cell homeostasis via IL-7Rα, Foxo1 directly controls a genetic program essential for T cell migration via CCR7 and transcriptional responses via TCF-7, which may collectively ensure the establishment of immunological memory.
Discussion
Foxo transcription factors have well-established functions in regulating T cell homeostasis and tolerance(Hedrick et al., 2012; Ouyang and Li, 2011). In this report, we have identified an additional important function for the Foxo1 protein in promoting memory CD8+ T cell responses to infection. To circumvent the impact of Foxo1 deletion in naïve T cells, we developed a mouse model to abrogate Foxo1 expression in antigen-experienced CD8+ T cells in response to LM-OVA infection. We found that these mice developed comparable effector T cell responses, but failed to mount long-term protective immunity against bacterial re-challenge as a consequence of cell-intrinsic defects of memory T cell generation. Using a Foxo1-GFP reporter mouse strain, we found that MPECs expressed higher amounts of Foxo1 than SLECs. Indeed, Foxo1 deficiency resulted in reduced numbers of MPECs. Gene expression profiling studies of MPECs uncovered a subset of Foxo1 target genes including Tcf7, Il7r, and Ccr7 that have well-defined roles associated with memory T cells. In addition, ChIP-seq experiments revealed Tcf7 and Ccr7 as Foxo1-bound target genes in T cells. Together, these findings unravel a Foxo1-dependent genetic program that coordinates the transcriptional responses as well as the homeostatic and migratory properties of memory T cells.
Based on their anatomical location and proliferative capacity, two broad subsets of memory T cells have been characterized. Effector memory T cells are located in the non-lymphoid organs and immediately respond to antigen encounter, whereas central memory T cells circulate in the secondary lymphoid organs and mount robust recall responses(Lefrancois, 2006; Sallusto et al., 2004). Both subsets of memory T cells are required to elicit optimal protective immunity against pathogen re-invasion. Using the OT-I cell transfer model, we found that Foxo1 deficiency led to reduced numbers of memory T cells in the spleen and lymph nodes, but not in the bone marrow or liver (data not shown). Upon LM-OVA re-infection, Foxo1-deficient T cells expanded to a lesser extent than wild-type T cells, and failed to repopulate even in the liver. Although the molecular and cellular properties of memory T cells generated in the absence of Foxo1 remain to be fully characterized, these observations support a crucial role for Foxo1 in promoting the differentiation and/or homeostasis of central memory T cells.
In models of infection, CD8+ T cells with excessive effector activities are typically short-lived, and lack memory cell potential. A recent study showed that in response to antigen and IL-12 stimulation, Foxo1-deficient CD8+ T cells produce increased amounts of the effector molecules IFNγ and Granzyme-B in vitro, which was associated with their diminished maintenance in vivo(Rao et al., 2012). Here we found that in response to LM-OVA infection, T cell expression of IFNγ and Granzyme-B was unaffected in the absence of Foxo1 at day 7 post infection. In addition, Foxo1-deficient T cells had comparable cytolytic activity to that of wild-type T cells. The cause of these different findings is unclear. Because Foxo1 nuclear localization is regulated by the Akt kinase, it is possible that T cell stimulation during LM-OVA infection results in stronger Akt activation than T cell stimulation in vitro, which may prevent Foxo1 from inhibiting effector T cell responses. In support of this hypothesis, our recent study revealed that Foxo1 inhibition of IFNγ expression in regulatory T cells is associated with reduced Akt activation in response to T cell receptor stimulation (Ouyang et al., 2012). In addition, ectopic expression of an Akt-insensitive Foxo1 mutant attenuates IFNγ expression in CD8+ T cells (Macintyre et al., 2011; Rao et al., 2012). Although a potential role for endogenous Foxo1 in suppressing effector CD8+ T cell responses is open for future investigation in other disease models, our findings suggest that in response to infection, Foxo1 promotes the generation of memory T cells via mechanisms independent of repressing effector T cell activities at the peak of effector responses.
During an acute infection, antigen-experienced CD8+ T cells differentiate into heterogeneous populations of effector cells including MPECs and SLECs that have varying degrees of long-term survival potential. We found that Foxo1 deficiency resulted in reduced numbers of MPECs at day 7, with a further reduction of memory T cells at day 60. These observations suggest that Foxo1 has a more crucial function in regulating the maintenance rather than the differentiation of MPECs. Indeed, microarray studies of MPECs showed that Foxo1 promoted the expression of target genes involved in the control of T cell survival including Il7r and Bcl2, as well as T cell trafficking such as Sell and Ccr7. CCR7 is one of the defining cell surface markers of central memory T cells in mouse and human, and is required for cell extravasation through high endothelial venules and migration to T cell areas of secondary lymphoid organs(Forster et al., 2008). Defective CCR7 expression in Foxo1-deficient T cells further supports a critical role for Foxo1 in promoting the generation of central memory T cells. ChIP-seq experiments revealed Ccr7 as a Foxo1-bound target gene in T cells. Interestingly, the forkhead-binding motifs present in the Ccr7 locus are highly conserved between human and mouse, suggesting an evolutionarily conserved function for Foxo1 in promoting Ccr7 gene transcription. The precise functions of these regulatory elements in the control of Ccr7 gene expression warrant further investigation.
In addition to Ccr7, Tcf7 was identified as another Foxo1-bound target gene in MPECs. TCF-7 participates in the transcriptional responses downstream of the Wnt-β-catenin signaling pathway, and has an essential function in promoting central memory T cell generation(Zhou et al., 2010). Furthermore, genetic ablation of genes encoding β-catenin and γ-catenin impairs memory T cell development, whereas ectopic expression of TCF-7 and a stabilized form of β-catenin enhances memory T cell formation(Jeannet et al., 2010; Zhao et al., 2010). These findings imply an intriguing crosstalk between Foxo1 and the Wnt signaling pathway in the control of memory T cell differentiation. Nevertheless, the precise contribution of reduced TCF-7 expression to the differentiation and homeostasis defects of Foxo1-deficient memory T cells remains to be determined. It is noteworthy that all three differentially expressed Foxo1-bound target genes (Il7r, Ccr7, and Tcf7) in MPECs appear to be induced by Foxo1. These observations suggest that Foxo1 promotes memory T cell generation via its function as a transcriptional activator rather than through transcriptional repression of effector T cell differentiation.
The crucial function of Foxo1 in MPECs is associated with its high expression in these cells. How differential Foxo1 expression between MPECs and SLECs is achieved remains to be determined. Studies using adoptive transfer of a single T cell or barcode-labeling of individual T cells demonstrated that a single naïve T cell can give rise to both effector and memory T cells(Stemberger et al., 2007; van Heijst et al., 2009). Therefore, it is unlikely that the differential Foxo1 expression in antigen-experienced T cells is caused by varying Foxo1 expression in precursor T cells. The choice between short-lived effector and long-lived memory CD8+ T cells is in part determined by the strength of T cell stimulation via antigen, co-stimulation, and pro-inflammatory cytokines. It is interesting to note that all three signals activate the Akt kinase, and that the magnitude of Akt activation regulates the differentiation of MPECs and SLECs. Persistent Akt activation results in profound defects of MPEC generation that is associated with the enhanced Foxo1 phosphorylation, whereas Akt inhibition rescues SLECs from deletion and increases the number of memory T cells(Hand et al., 2010; Kim et al., 2012). Indeed, Foxo1 phosphorylation has been proposed to trigger Foxo1 degradation following its cytosolic translocation(Huang and Tindall, 2011). Future studies will determine whether the differential Foxo1 expression between MPECs and SLECs is caused by differences in Foxo1 stability as a consequence of Akt-induced phosphorylation.
In conclusion, in this report we have uncovered a crucial function for Foxo1 in the control of memory T cell responses to infection. This effect was mediated in part by Foxo1-dependent transcriptional regulation of critical target genes involved in memory T cell maintenance, migration, and downstream transcriptional responses. Manipulation of the Foxo1 pathway may provide new strategies for effective vaccines against infectious diseases.
Experimental Procedures
Mice
Mice containing floxed Foxo1 (Foxo1fl/fl), a GFP-tagged Foxo1 (Foxo1tag), bira, Gzmb-cre, and Il7rtg alleles were previously described(Jacob and Baltimore, 1999; Ouyang et al., 2009; Ouyang et al., 2012; Park et al., 2004), and were all backcrossed to the C57BL/6 background. C57BL/6, Rosa26-flox-stop-flox-YFP and OT-I mice were purchased from the Jackson Laboratory. To determine the cell populations that express the Cre recombinase, GzmB-cre mice were bred with the Rosa26-flox-stop-flox-YFP mice. Mice with effector T cell-specific deletion of Foxo1 were generated by crossing Foxo1 floxed mice with GzmB-cre mice. GzmB-cre Foxo1fl/fl, Foxo1tag, or IL-7RTg mice were further bred with OT-I mice for the isolation of ovalbumin antigen-specific T cells. To label Foxo1 with biotin, Foxo1tag mice were bred with bira-transgenic mice. All mice were maintained under specific pathogen-free conditions, and animal experiments were conducted in accordance with institutional guidelines.
Listeria monocytogenes infection
To study primary immune response, mice were intravenously infected with 5×103 colony-forming units (CFUs) of Listeria monocytogenes expressing the chicken ovalbumin (LM-OVA). Mice that had received OT-I cells were intravenously infected with 1×105 CFUs of LM-OVA one day after the adoptive T cell transfer. To analyze secondary immune response, mice were re-challenged with 1×105 CFUs of LM-OVA at 60 days post primary infection. The recall responses were determined 3 days after the secondary infection.
Colony-forming unit assay
Single cell suspensions were made from the spleens of wild-type and GzmB-cre Foxo1fl/fl mice in phosphate buffered saline (PBS) containing 0.01% triton X-100. The supernatants were inoculated on brain heart infusion agar plates, and incubated for 24 hrs at 37 °C. Bacterial colonies were enumerated and used to calculate the colony-forming units.
In vivo cytolytic T cell assay
SIINFEKL peptide-pulsed target cells and control target cells were labeled with different doses of CFSE, mixed at a 1:1 ratio, and transferred into wild-type and GzmB-cre Foxo1fl/fl mice. 4 hrs later, the percentages of splenic and liver CFSElow peptide-pulsed target cells to those of CFSEhi control target cells were determined, and used to calculate antigen-specific killing activity.
Antibodies and immunoblotting
Anti-Foxo1 (C29H4) and anti-TCF-7 (C63D9) were purchased from Cell Signaling. Anti-β-actin (AC-15) was obtained from Sigma. To verify Foxo1 deletion in antigen-experienced CD8+ T cells, naïve and Kb-ova+ CD8+ T cells were isolated by FACS-sorting from the spleens of wild-type and GzmB-cre Foxo1fl/fl mice at day 7 post-LM-OVA infection. To determine whether Foxo1 controls TCF-7 expression in memory precursor cells, wild-type and GzmB-cre Foxo1fl/fl KLRG1lo OT-I cells were isolated at day 7 post-LM-OVA infection from mice that received OT-I cells. Total protein extracts were prepared and dissolved in SDS sample buffer. Protein extracts were separated on 8% SDS-PAGE gels, and transferred to polyvinylidene difluoride membrane (Millipore). The membranes were probed with antibodies and visualized with the Immobilon Western Chemiluminescent HRP Substrate (Millipore).
Generation of bone marrow chimeras
Bone marrow cells were depleted of T cells and antigen-presenting cells by complement-mediated cell lysis. Wild-type and GzmB-cre Foxo1fl/fl bone marrow cells (2×106) were co-transferred into lethally irradiated recipients (1200 rads). The congenic markers CD45.1 and CD45.2 were used to distinguish cells from the different donors and recipients. After complete bone marrow reconstitution, the chimeric mice were infected with 5×103 CFUs of LM-OVA. The frequencies of wild-type and GzmB-cre Foxo1fl/fl Kb-ova+ memory T cells were determined at 60 days post infection.
Cell isolation and adoptive transfer
Wild-type OT-I and GzmB-cre Foxo1fl/fl OT-I cells were purified by FACS sorting, mixed at 1:1 ratio, and transferred to the congenically marked recipients. One day after the transfer, mice were infected with 1×105 CFUs of LM-OVA, and used for the analysis of primary and secondary CD8+ T cell responses. For the study of Foxo1 expression, Foxo1tag OT-I cells were used in the transfer experiments. T cells were analyzed 7 days post infection.
In vitro memory T cell differentiation
Splenic and lymph node OT-I cells were stimulated with 10 ng/ml SIINFEKL peptide for 1 hr at 37 °C, and cultured in T cell media for 2 days. Subsequently, antigen-presenting cells were removed by Ficoll-Paque (GE Healthcare) gradient centrifugation, and T cells were cultured in the presence of 200 U/ml of rIL-2 (NCI) or 20 ng/ml of rmIL-15 (BioLegend) for 5 days.
Flow cytometry
Fluorescent-dye-labeled antibodies against cell surface markers TCRβ, CD4, CD8, CD44, CD62L, CCR7, CD45.1, CD45.2, IL-7Rα, CD27, and KLRG1 were purchased from eBiosciences. PE-conjugated Kb-ova+ tetramer was obtained from the Tetramer Core Facility at Memorial Sloan-Kettering Cancer Center. Cells were incubated with specific antibodies for 30 min on ice in the presence of 2.4G2 mAb to block FcγR binding. To determine granzyme B expression, cells were incubated with cell surface antibodies, fixed and permeablized, and stained with APC-conjugated anti-granzyme B (Invitrogen). Intracellular staining of TCF-7 was performed with anti-TCF-7 (C63D9, Cell Signaling) followed by staining with Alexa Flour 488 goat anti-rabbit IgG (Invitrogen). To determine IFNγ expression, lymphocytes were stimulated with 10 nM SIINFEKL peptide in the presence of the GolgiStop (BD Biosciences) for 5 hrs at 37 °C. After stimulation, cells were incubated with cell surface antibodies, fixed and permeablized, and stained with anti-IFNγ (eBiosciences). All samples were acquired and analyzed with LSR II flow cytometer (Becton Dickinson) and FlowJo software (TreeStar).
Gene expression profiling
Wild-type IL-7RαhiKLRG1lo OT-I and IL-7RαloKLRG1hi OT-I cells, or wild-type and GzmB-cre Foxo1fl/fl CD27hiKLRG1lo OT-I cells were isolated by FACS sorting at 7 days post LM-OVA infection. RNA was prepared with the miRNeasy kit according to the manufacturer's instructions (Qiagen). RNA amplification, labeling and hybridization to Mouse 430 2.0 Array chips (Affymetrix) were carried out at the Genomics Core Facility of Memorial Sloan-Kettering Cancer Center.
Heatmap
To effectively visualize Foxo1-dependent gene expression between IL-7RαhiKLRG1lo MPECs and IL-7RαloKLRG1hi SLECs, we used relative expression values of MPECs versus SLECs. The log2-fold-change between MPECs and SLECs was used to define a MPEC value equal to ½log2-fold-change and a SLEC value equal to -½log2-fold-change.
ChIP-sequencing
ChIP-sequencing was performed as previously described(Ouyang et al., 2012). Briefly, CD8+ T cells were purified from C57BL/6 mice by MACS beads purification, and were used to isolate Foxo1–bound chromatin by immune-precipitation with anti-Foxo1 (#ab393670, Abcam). CD8+ T cells were also purified from Foxo1tag/tag bira mice, and were used to isolate Foxo1-bound chromatin with streptavidin. The libraries of Foxo1-bound chromatin were prepared and used for sequencing. SR-36 sequencing was done at the Genome Center of Cold Spring Harbor Laboratory.
Accession number
The microarray data and ChIP-seq data are available in the Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo) under the accession number GSE46944.
Quantitative PCR
mRNA amounts of Foxo1, Il7r, Ccr7, Sell, Bcl2, Tcf7 and Actb, and the chromatin amounts of Foxo1 binding sites in the Il7r, Ccr7 and Tcf7 loci were determined by quantitative PCR. The mRNA amounts were normalized to those of β-actin.
| Targets | Forward primers | Reverse primers | Templates |
| Actb | TTGCTGACAGGATGCAGAAG | ACATCTGCTGGAAGGTGGAC | cDNA |
| Bcl2 | ATAACCGGGAGATCGTGATG | CAGGCTGGAAGGAGAAGATG | cDNA |
| Ccr7 | AAAGCACAGCCTTCCTGTGT | GACCTCATCTTGGCAGAAGC | cDNA |
| Ccr7-1 | TACTGCAGTTCCCACAATGC | GAGGGGCTGAGGAAGCTACT | ChIP DNA |
| Ccr7-2 | CACAGCTGCTGAGAAAGACG | GGGGATGTTTCAAACCTGTG | ChIP DNA |
| Foxo1 | CCGGAGTTTAACCAGTCCAA | TGCTCATAAAGTCGGTGCTG | cDNA |
| Il7r | TGGCTCTGGGTAGAGCTTTC | GTGGCACCAGAAGGAGTGAT | cDNA |
| Il7r | CAATCAAAATGATGGTCCACTT | TCAGCCTTTCATGGGCTATC | ChIP DNA |
| Sell | CTCGAGGAACATCCTGAAGC | AGCATTTTCCCAGTTCATGG | cDNA |
| Tcf7 | CAATCTGCTCATGCCCTACC | CTTGCTTCTGGCTGATGTCC | cDNA |
| Tcf7 | CACCTGTTTCCTCCAACACA | GGGGTAGGGTTAGGTGAAGG | ChIP DNA |
Statistical analysis
P values were determined by two-tailed unpaired Student's t-test. P value<0.05 were considered statistically significant. All error bars represent standard error (s.e.m.)
Supplementary Material
Highlights.
Foxo1 controls memory CD8+ T cell responses to infection
MPECs express higher amounts of Foxo1 than SLECs
Foxo1 regulates the differentiation and homeostasis of MPECs
Memory T cell-promoting molecules Tcf7 and Ccr7 are Foxo1-bound target genes
Acknowledgments
We thank J. Jacob for the Gzmb-cre mouse strain, E. Pamer and I. Leiner for the LM-OVA bacterium strain. This work was supported by the Starr Cancer Consortium (13-A123 to M.O.L. and M.Q.Z.), the Rita Allen Foundation (M.O.L.), NBRPC (2012CB316503 to M.Q.Z), and NIH (HG001696 to M.Q.Z.).
Footnotes
Competing Interest Statement: The authors declare that they have no competing financial interests
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Ahmed R, Gray D. Immunological memory and protective immunity: understanding their relation. Science. 1996;272:54–60. doi: 10.1126/science.272.5258.54. [DOI] [PubMed] [Google Scholar]
- Araki K, Turner AP, Shaffer VO, Gangappa S, Keller SA, Bachmann MF, Larsen CP, Ahmed R. mTOR regulates memory CD8 T-cell differentiation. Nature. 2009;460:108–112. doi: 10.1038/nature08155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arens R, Schoenberger SP. Plasticity in programming of effector and memory CD8 T-cell formation. Immunol Rev. 2010;235:190–205. doi: 10.1111/j.0105-2896.2010.00899.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Badovinac VP, Messingham KA, Jabbari A, Haring JS, Harty JT. Accelerated CD8+ T-cell memory and prime-boost response after dendritic-cell vaccination. Nat Med. 2005;11:748–756. doi: 10.1038/nm1257. [DOI] [PubMed] [Google Scholar]
- Badovinac VP, Porter BB, Harty JT. CD8+ T cell contraction is controlled by early inflammation. Nat Immunol. 2004;5:809–817. doi: 10.1038/ni1098. [DOI] [PubMed] [Google Scholar]
- Bannard O, Kraman M, Fearon DT. Secondary replicative function of CD8+ T cells that had developed an effector phenotype. Science. 2009;323:505–509. doi: 10.1126/science.1166831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bevan MJ. Understand memory, design better vaccines. Nat Immunol. 2011;12:463–465. doi: 10.1038/ni.2041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calnan DR, Brunet A. The FoxO code. Oncogene. 2008;27:2276–2288. doi: 10.1038/onc.2008.21. [DOI] [PubMed] [Google Scholar]
- Dejean AS, Beisner DR, Ch'en IL, Kerdiles YM, Babour A, Arden KC, Castrillon DH, DePinho RA, Hedrick SM. Transcription factor Foxo3 controls the magnitude of T cell immune responses by modulating the function of dendritic cells. Nat Immunol. 2009;10:504–513. doi: 10.1038/ni.1729. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Finlay D, Cantrell DA. Metabolism, migration and memory in cytotoxic T cells. Nat Rev Immunol. 2011;11:109–117. doi: 10.1038/nri2888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Forster R, Davalos-Misslitz AC, Rot A. CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol. 2008;8:362–371. doi: 10.1038/nri2297. [DOI] [PubMed] [Google Scholar]
- Gubbels Bupp MR, Edwards B, Guo C, Wei D, Chen G, Wong B, Masteller E, Peng SL. T cells require Foxo1 to populate the peripheral lymphoid organs. Eur J Immunol. 2009;39:2991–2999. doi: 10.1002/eji.200939427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hand TW, Cui W, Jung YW, Sefik E, Joshi NS, Chandele A, Liu Y, Kaech SM. Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc Natl Acad Sci U S A. 2010;107:16601–16606. doi: 10.1073/pnas.1003457107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harty JT, Badovinac VP. Shaping and reshaping CD8+ T-cell memory. Nat Rev Immunol. 2008;8:107–119. doi: 10.1038/nri2251. [DOI] [PubMed] [Google Scholar]
- Hedrick SM, Hess Michelini R, Doedens AL, Goldrath AW, Stone EL. FOXO transcription factors throughout T cell biology. Nat Rev Immunol. 2012;12:649–661. doi: 10.1038/nri3278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendriks J, Gravestein LA, Tesselaar K, van Lier RA, Schumacher TN, Borst J. CD27 is required for generation and long-term maintenance of T cell immunity. Nat Immunol. 2000;1:433–440. doi: 10.1038/80877. [DOI] [PubMed] [Google Scholar]
- Huang H, Tindall DJ. Regulation of FOXO protein stability via ubiquitination and proteasome degradation. Biochim Biophys Acta. 2011;1813:1961–1964. doi: 10.1016/j.bbamcr.2011.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jacob J, Baltimore D. Modelling T-cell memory by genetic marking of memory T cells in vivo. Nature. 1999;399:593–597. doi: 10.1038/21208. [DOI] [PubMed] [Google Scholar]
- Jameson SC, Masopust D. Diversity in T cell memory: an embarrassment of riches. Immunity. 2009;31:859–871. doi: 10.1016/j.immuni.2009.11.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jeannet G, Boudousquie C, Gardiol N, Kang J, Huelsken J, Held W. Essential role of the Wnt pathway effector Tcf-1 for the establishment of functional CD8 T cell memory. Proc Natl Acad Sci U S A. 2010;107:9777–9782. doi: 10.1073/pnas.0914127107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Joshi NS, Cui W, Chandele A, Lee HK, Urso DR, Hagman J, Gapin L, Kaech SM. Inflammation directs memory precursor and short-lived effector CD8(+) T cell fates via the graded expression of T-bet transcription factor. Immunity. 2007;27:281–295. doi: 10.1016/j.immuni.2007.07.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaech SM, Cui W. Transcriptional control of effector and memory CD8(+) T cell differentiation. Nat Rev Immunol. 2012;12:749–761. doi: 10.1038/nri3307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaech SM, Tan JT, Wherry EJ, Konieczny BT, Surh CD, Ahmed R. Selective expression of the interleukin 7 receptor identifies effector CD8 T cells that give rise to long-lived memory cells. Nat Immunol. 2003;4:1191–1198. doi: 10.1038/ni1009. [DOI] [PubMed] [Google Scholar]
- Kerdiles YM, Beisner DR, Tinoco R, Dejean AS, Castrillon DH, DePinho RA, Hedrick SM. Foxo1 links homing and survival of naive T cells by regulating L-selectin, CCR7 and interleukin 7 receptor. Nat Immunol. 2009;10:176–184. doi: 10.1038/ni.1689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kerdiles YM, Stone EL, Beisner DR, McGargill MA, Ch'en IL, Stockmann C, Katayama CD, Hedrick SM. Foxo transcription factors control regulatory T cell development and function. Immunity. 2010;33:890–904. doi: 10.1016/j.immuni.2010.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kim EH, Sullivan JA, Plisch EH, Tejera MM, Jatzek A, Choi KY, Suresh M. Signal integration by Akt regulates CD8 T cell effector and memory differentiation. J Immunol. 2012;188:4305–4314. doi: 10.4049/jimmunol.1103568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lefrancois L. Development, trafficking, and function of memory T-cell subsets. Immunol Rev. 2006;211:93–103. doi: 10.1111/j.0105-2896.2006.00393.x. [DOI] [PubMed] [Google Scholar]
- Macintyre AN, Finlay D, Preston G, Sinclair LV, Waugh CM, Tamas P, Feijoo C, Okkenhaug K, Cantrell DA. Protein kinase B controls transcriptional programs that direct cytotoxic T cell fate but is dispensable for T cell metabolism. Immunity. 2011;34:224–236. doi: 10.1016/j.immuni.2011.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Manjunath N, Shankar P, Wan J, Weninger W, Crowley MA, Hieshima K, Springer TA, Fan X, Shen H, Lieberman J, von Andrian UH. Effector differentiation is not prerequisite for generation of memory cytotoxic T lymphocytes. J Clin Invest. 2001;108:871–878. doi: 10.1172/JCI13296. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ouyang W, Beckett O, Flavell RA, Li MO. An essential role of the Forkhead-box transcription factor Foxo1 in control of T cell homeostasis and tolerance. Immunity. 2009;30:358–371. doi: 10.1016/j.immuni.2009.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ouyang W, Beckett O, Ma Q, Paik JH, Depinho RA, Li MO. Foxo proteins cooperatively control the differentiation of Foxp3(+) regulatory T cells. Nat Immunol. 2010 doi: 10.1038/ni.1884. [DOI] [PubMed] [Google Scholar]
- Ouyang W, Li MO. Foxo: in command of T lymphocyte homeostasis and tolerance. Trends Immunol. 2011;32:26–33. doi: 10.1016/j.it.2010.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ouyang W, Liao W, Luo CT, Yin N, Huse M, Kim MV, Peng M, Chan P, Ma Q, Mo Y, et al. Novel Foxo1-dependent transcriptional programs control T(reg) cell function. Nature. 2012;491:554–559. doi: 10.1038/nature11581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Park JH, Yu Q, Erman B, Appelbaum JS, Montoya-Durango D, Grimes HL, Singer A. Suppression of IL7Ralpha transcription by IL-7 and other prosurvival cytokines: a novel mechanism for maximizing IL-7-dependent T cell survival. Immunity. 2004;21:289–302. doi: 10.1016/j.immuni.2004.07.016. [DOI] [PubMed] [Google Scholar]
- Rao RR, Li Q, Gubbels Bupp MR, Shrikant PA. Transcription factor Foxo1 represses T-bet-mediated effector functions and promotes memory CD8(+) T cell differentiation. Immunity. 2012;36:374–387. doi: 10.1016/j.immuni.2012.01.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sallusto F, Geginat J, Lanzavecchia A. Central memory and effector memory T cell subsets: function, generation, and maintenance. Annu Rev Immunol. 2004;22:745–763. doi: 10.1146/annurev.immunol.22.012703.104702. [DOI] [PubMed] [Google Scholar]
- Sarkar S, Kalia V, Haining WN, Konieczny BT, Subramaniam S, Ahmed R. Functional and genomic profiling of effector CD8 T cell subsets with distinct memory fates. J Exp Med. 2008;205:625–640. doi: 10.1084/jem.20071641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schluns KS, Kieper WC, Jameson SC, Lefrancois L. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat Immunol. 2000;1:426–432. doi: 10.1038/80868. [DOI] [PubMed] [Google Scholar]
- Stemberger C, Huster KM, Koffler M, Anderl F, Schiemann M, Wagner H, Busch DH. A single naive CD8+ T cell precursor can develop into diverse effector and memory subsets. Immunity. 2007;27:985–997. doi: 10.1016/j.immuni.2007.10.012. [DOI] [PubMed] [Google Scholar]
- Sullivan JA, Kim EH, Plisch EH, Peng SL, Suresh M. FOXO3 regulates CD8 T cell memory by T cell-intrinsic mechanisms. PLoS Pathog. 2012a;8:e1002533. doi: 10.1371/journal.ppat.1002533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sullivan JA, Kim EH, Plisch EH, Suresh M. FOXO3 regulates the CD8 T cell response to a chronic viral infection. J Virol. 2012b;86:9025–9034. doi: 10.1128/JVI.00942-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun JC, Lanier LL. NK cell development, homeostasis and function: parallels with CD8(+) T cells. Nat Rev Immunol. 2011;11:645–657. doi: 10.1038/nri3044. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Surh CD, Sprent J. Homeostasis of naive and memory T cells. Immunity. 2008;29:848–862. doi: 10.1016/j.immuni.2008.11.002. [DOI] [PubMed] [Google Scholar]
- van Heijst JW, Gerlach C, Swart E, Sie D, Nunes-Alves C, Kerkhoven RM, Arens R, Correia-Neves M, Schepers K, Schumacher TN. Recruitment of antigen-specific CD8+ T cells in response to infection is markedly efficient. Science. 2009;325:1265–1269. doi: 10.1126/science.1175455. [DOI] [PubMed] [Google Scholar]
- Weber BN, Chi AW, Chavez A, Yashiro-Ohtani Y, Yang Q, Shestova O, Bhandoola A. A critical role for TCF-1 in T-lineage specification and differentiation. Nature. 2011;476:63–68. doi: 10.1038/nature10279. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Williams MA, Bevan MJ. Effector and memory CTL differentiation. Annu Rev Immunol. 2007;25:171–192. doi: 10.1146/annurev.immunol.25.022106.141548. [DOI] [PubMed] [Google Scholar]
- Zhang N, Bevan MJ. TGF-beta signaling to T cells inhibits autoimmunity during lymphopenia-driven proliferation. Nat Immunol. 2012;13:667–673. doi: 10.1038/ni.2319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao DM, Yu S, Zhou X, Haring JS, Held W, Badovinac VP, Harty JT, Xue HH. Constitutive activation of Wnt signaling favors generation of memory CD8 T cells. J Immunol. 2010;184:1191–1199. doi: 10.4049/jimmunol.0901199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou X, Yu S, Zhao DM, Harty JT, Badovinac VP, Xue HH. Differentiation and persistence of memory CD8(+) T cells depend on T cell factor 1. Immunity. 2010;33:229–240. doi: 10.1016/j.immuni.2010.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.







