Genetic Characterization and Emergence of the Metallo-β-Lactamase GIM-1 in Pseudomonas spp. and Enterobacteriaceae during a Long-Term Outbreak

Abstract

Since the first isolation in 2002, the metallo-β-lactamase GIM-1 has not been detected outside Germany. The data presented here, for 50 clinical bla_GIM-1-positive isolates, including Pseudomonas spp. and Enterobacteriaceae (Enterobacter cloacae, Klebsiella oxytoca, Serratia marcescens, Escherichia coli, and Citrobacter freundii), collected between 2007 and 2012 at the original site in an ongoing outbreak, demonstrate a diverse genetic background and dissemination of the gene conferring resistance to enteric bacteria.

TEXT

Metallo-β-lactamases (MBLs) hydrolyze all β-lactams (except monobactams), including the carbapenems, and thus are an important emerging obstacle to the treatment of Gram-negative bacterial nosocomial infections. To date, at least 11 subgroups have been described, with IMP, VIM, and NDM-1 being the most geographically widespread, while others, like GIM-1, have not become globally established (1–3). The prevalence of MBLs in Germany is low and mainly due to VIM types (4; http://ecdc.europa.eu/en/activities/surveillance/EARS-net/database/Pages/database.aspx). GIM-1 was initially discovered in a Pseudomonas aeruginosa clone isolated from the surgical intensive care unit (ICU) of the University Hospital of Düsseldorf (Germany) in 2002, in which the bla_GIM-1 gene was located on a small 22-kb nontransferable plasmid embedded in the class 1 integron In77 (5). Since then, GIM-1 has been described in only a few isolates of Enterobacter cloacae, Serratia marcescens, Acinetobacter pittii, and P. aeruginosa (6–9), nearly exclusively in the greater Düsseldorf region and never outside Germany.

A total of 230 clinical isolates collected between 2007 and 2012 in one hospital, fulfilling the criteria of nonsusceptibility to piperacillin-tazobactam or ceftazidime and imipenem/meropenem, were further screened for MBL by using MBL MIC test strips (Liofilchem, Roseto degli Abruzzi, Italy) and real-time in-house PCR targeting the bla_IMP-1, bla_VIM-1-type, bla_VIM-2-type, bla_GIM-1, and bla_NDM-1 genes (Table 1). The bla_GIM-1 gene was detected in 50 isolates (Pseudomonas aeruginosa [33], Enterobacter cloacae [7], Pseudomonas putida [5], Serratia marcescens [2], Escherichia coli [1], Klebsiella oxytoca [1], and Citrobacter freundii [1]). Other isolates contained bla_VIM-1 (2), bla_VIM-2 (2), or bla_NDM-1 (1). All bla_GIM-1-positive isolates except the single E. coli isolate (MIC, 8 mg/liter) were highly resistant to imipenem and meropenem (MIC, >32 mg/liter), and all bla_GIM-1-positive isolates were additionally resistant to quinolones and aminoglycosides. The genetic relatedness of the P. aeruginosa, P. putida, and E. cloacae isolates was investigated using DiversiLab repetitive-sequence-based PCR (repPCR) (bioMérieux, Nürtingen, Germany) according to the manufacturer's protocol. A similarity of >95% between isolates was defined as representing a genetic cluster. Pulsed-field gel electrophoresis (PFGE) was performed on all P. aeruginosa and Serratia marcescens isolates by using SpeI (Fermentas, ThermoFisher, Schwerte, Germany) as described previously (10) and interpreted according to the criteria of Tenover et al. (11). One isolate of the “original” P. aeruginosa clone, 73-5671 (5), was included. These fingerprinting data (Table 2) revealed one main PFGE cluster of 24 P. aeruginosa isolates (PSA-A), including isolates from 2002 to 2012, nearly all of which (19 of 24) were isolated from the surgical ICU, suggesting an ongoing clonal spread. The genetic relatedness of all species is shown in Table 2.

Table 1.

Carbapenemase multiplex primers and probes

Gene	Primer/probe	Sequence (5′→3′)a	Reference	Nucleotide positions	Size (bp)
blaGIM-1	GIM1-F	CGACACACCTTGGTCTGAAGAA	AJ620678	1232–1253	81
	GIM1-R	GATGCTAGCCATAACCTGGTATCC		1313–1290
	GIM1-P	HEX-ACACGAAGTTGTTATTATCCTGGGCGACTGAC-BHQ-1		1255–1286
blaVIM-1	VIM1-F	TGCGCTTCGGTCCAGTAGA	FJ172675	698–716	76
	VIM1-R	TGACGGGACGTATACAACCAGAT		774–752
	VIM-P	FAM-CTTCTATCCTGGTGCTGCGCATTCG-BHQ-1		720–744
blaVIM-2	VIM2-F	GCGCTTCGGTCCAGTAGAAC	AF191564	1810–1829	80
	VIM2-R	CTCGCAGACGGGACGTACA		1890–1872
	VIM-P	Same probe as for blaVIM-1		1831–1855
blaIMP-1	IMP1-F	GGGCGGAATAGAGTGGCTTA	AY168635	303–322	93
	IMP1-R	GGCTTGAACCTTACCGTCTTTTT		396–374
	IMP1-P	HEX-CGATCTATCCCCACGTATGCATCTGAATTAACA-BHQ-1		328–360
blaNDM-1	NDM1-F	CGGCATCACCGAGATTGC	FN396876	2547–2564	73
	NDM1-R	CACCGACATCGCTTTTGGT		2620–2602
	NDM1-P	FAM-GCGACTTGGCCTTGCTGTCCTTG-BHQ-1		2568–2590

^aHEX, hexachlorofluorescein; BHQ-1, black hole quencher 1; FAM, 6-carboxyfluorescein.

Table 2.

Characteristics of bla_GIM-1-positive strains ordered by species and isolation date^a

Species and strain M no.	Date (yr or mo-yr)	First sample type	Ward	repPCR type	PFGE type	Integron type	Genetic location	Plasmid size(s) (kb)
Pseudomonas aeruginosa
0	2002	Respiratory tract	SICU	PSA-1	PSA-A	In77	C/P	22
19	Oct-07	Wound	SW1	PSA-4	PSA-B	In853	C
1	Dec-07	Respiratory tract	MICU2	PSA-5	PSA-C	In583*	C
2	Jan-08	Stool	MW3	PSA-6	PSA-D	In851*	C
4	Apr-08	Urine	MW2	PSA-1	PSA-A	In77*	C
3	Apr-08	Respiratory tract	SICU	PSA-1	PSA-A	In77	C
5	Jun-08	Respiratory tract	SICU	PSA-1	PSA-A	In77	C
7	Sep-08	Respiratory tract	MICU1	PSA-2	PSA-E	In770	C
8	Sep-08	Respiratory tract	MICU1	PSA-2	PSA-A	In770*	C
10	Oct-08	Stool	MICU1	PSA-2	PSA-F	In770	C
16	Feb-10	Respiratory tract	SICU	PSA-1	ND	In77	C
25	Feb-10	Urine	MW2	PSA-1	PSA-A	In77	C
28	May-10	Urine	MOP	PSA-7	PSA-G	In770	ND
29	May-10	Respiratory tract	SICU	PSA-8	PSA-H	In851	C
45	Nov-10	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
46	Dec-10	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
47	Dec-10	Urine	MW1	PSA-1	PSA-A	In77b	C
48	Mar-11	Wound	SICU	PSA-1	PSA-A	In77b	C
57	Apr-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
49	May-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
50	Jun-11	Urine	SICU	PSA-1	PSA-A	In77b	C
51	Jun-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
53	Jun-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
52	Jun-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
55	Jul-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
58	Sep-11	Wound	SICU	PSA-1	PSA-A	In77b	C and P	25
63	Dec-11	Respiratory tract	SICU	PSA-1	PSA-A	In77b*	C
64	Jan-12	Wound	SICU	PSA-1	PSA-A	In77b	C
67	Mar-12	Wound	SICU	PSA-1	PSA-A	In77b	C
68	Mar-12	Urine	MW1	PSA-3	PSA-A	In770	C
69	Apr-12	Wound	SICU	PSA-1	PSA-A	In851	C
70	May-12	Respiratory tract	SICU	PSA-1	PSA-A	In77b	C
71	May-12	Respiratory tract	MW4	PSA-3	PSA-D	In851	C
Enterobacter cloacae
14	Jun-09	Urine	MW4	ENT-1	ND	In770	C and two P	25 and 220
15	Jan-10	Blood culture	MICU1	ENT-1	ND	In770*	C and two P	25 and 220
21	Mar-10	Wound	MW2	ENT-2	ND	In770	C and two P	25 and 220
35	Jul-10	Urine	MW3	ENT-2	ND	In770	C and two P	25 and 220
44	Aug-10	Urine	MW3	ENT-2	ND	In770	C and two P	25 and 220
60	Dec-11	Wound	MW3	ENT-1	ND	In770	C and two P	25 and 220
65	Dec-11	Urine	MW3	ENT-2	ND	In770	C and two P	25 and 220
Pseudomonas putida
18	Sep-07	Urine	MW3	PUT-3	ND	In770*	C
6	Sep-08	Stool	MW3	PUT-1	ND	In853*	C
12	Dec-08	Urine	MW3	PUT-1	ND	In853	C
37	Aug-10	Urine	MW3	PUT-2	ND	In853	C
38	Aug-10	Urine	MW3	PUT-2	ND	In853	C
Serratia marcescens
9	Sep-08	Urine	MICU2	ND	SMA-A	In770*	P	140
11	Nov-08	Urine	SW2	ND	SMA-B	In770	C
Escherichia coli 17	Mar-07	Blood culture	MW5	ND	ND	In852*	C and two P	50 and 130
Klebsiella oxytoca 43	Oct-10	Urine	MW3	ND	ND	In770*	C
Citrobacter freundii 56	Jul-11	Wound	SICU	ND	ND	In851*	C

^aMBL-positive isolates were given consecutive numbers with the prefix M. DiversiLab repPCR cluster and PFGE types were given numbers and letters, respectively, with an acronym of the species. M0 (73-5671) was collected in 2002 and bla_GIM-1 was described by Castanheira et al. (5) on a 22-kb plasmid, while we detected it chromosomally. *, integron sequences were published in GenBank (JX566704 to JX566715) and given INTEGRALL numbers as shown (In77b being a variant of In77). SICU, surgical intensive care unit; MICU, medical intensive care unit; SW, surgical ward; MW, medical ward (numbers indicate different wards); ND, not determined (M28 and M16 strains lost for further analysis); C, chromosome; P, plasmid.

We determined the genetic environment of the bla_GIM-1 gene by targeting conserved sequences of class 1 integrons by PCR and using a walking sequencing strategy. In addition to detecting the three integron types described before (5, 6, 8, 9), we detected four new arrays (In77b, In851, In852, and In853) (Fig. 1). The bla_GIM-1 gene cassette was fused to aacA4 in all isolates, except in P. aeruginosa M1 (fused to aadB). Five integron arrays (In77, In77b, In770, In851, and In853) were related to each other, sharing identical elements (aacA4, aadA1, and bla_OXA-2). The integron found in E. coli M17 (In852) had a unique structure with different elements (ΔIS1600 and bla_OXA-10) suggesting an enhanced degree of mobility of the bla_GIM-1-aacA4 gene pair. All integron types (except In852) were found in P. aeruginosa, and the appearance of the same types, e.g., In851 and In770, in other Pseudomonas spp. and Enterobacteriaceae (Table 2) clearly demonstrates horizontal gene transfer of a large block of genetic information rather than an individual gene.

Fig 1.

Class 1 integron arrays associated with bla_GIM-1 found in this study. Open reading frames are represented by open boxes with arrows indicating the reading direction. IS1394 inserting into gene aadA1 is shown in gray.

S1 restriction and in-gel detection, performed as previously described (10), using a ³²P-radiolabeled bla_GIM-1 probe (product of primers 5.1.R2 [CCAAGCAGCAAGCGCGTTAC] and GIMR [ACTCATGACTCCTCACGAGG] [5]), demonstrated the chromosomal location of the gene in all isolates other than S. marcescens M9, in which it was found only on a 140-kb plasmid. In addition to being localized on the chromosome, the gene was present on two plasmids in all E. cloacae isolates (approximately 25 kb and 220 kb) and in E. coli M17 (approximately 50 kb and 130 kb). Interestingly, we were able to detect bla_GIM-1 on a plasmid (25 kb), similar in size to that originally described in 2004 (5), in only one P. aeruginosa isolate (M58, belonging to PFGE type PSA-A). S1 nuclease treatment, uncommon at the time of the first description of GIM-1, should detect plasmids of this small size, and thus we suggest that the plasmid originally described is probably unstable and has been lost during cultivation or storage. As there is a dominant chromosomal bla_GIM-1-mediated resistance in our isolates and as the bla_GIM-1 gene cassette has moved into plasmids of different sizes, transfer options besides plasmid-mediated transfer, such as transfer of transposons or integrative and conjugative elements (ICE) (12), must be considered. Horizontal gene transfer was demonstrated by conjugation experiments using the recipient E. coli rifampin-resistant C600 or sodium azide-resistant J53 strain on sheep blood agar at a recipient/donor ratio of 1:10 at three temperatures (18°C, 30°C, and 37°C) as previously described (13). Selective media contained 100 mg/liter ampicillin and either 100 mg/liter rifampin or 100 mg/liter sodium azide. Successful transfer was confirmed by real-time PCR targeting bla_GIM-1 and by use of random amplified polymorphic DNA (RAPD) with four primers: Eric1-R, ERIC2 (14), 272 (15), and 1254 (16). We were able to prove only horizontal gene transfer in vitro for the E. coli M17 isolate; the acquired resistance had no impact on carbapenem susceptibility in the transconjugant.

The emergence of metallo-β-lactamase genes, first recovered in nonfermenters and recently spread to Enterobacteriaceae, poses a serious threat, since these bacteria are a common cause of severe nosocomial infections. This is the first description of a large number of isolates expressing the bla_GIM-1 gene, including a much broader range of clinically relevant enteric bacteria than previously described. The originally described P. aeruginosa clone (5) may have acted as a genetic pool in the hospital environment over 10 years for the bacterial community, since it was the first described host of GIM-1. Although there is a considerable transfer of patients between hospitals in the greater Düsseldorf area, there does not seem to be an equivalent spread of our bla_GIM-1-carrying organisms, as there are only few isolates described elsewhere (6, 8, 9). Despite the data presented here, carbapenemase production in Gram-negative bacteria remains relatively uncommon in Düsseldorf, but these data may herald a rise in GIM-1-mediated carbapenem resistance in this region, which is of great concern.

Nucleotide sequence accession numbers.

Integron sequences are published in GenBank under accession numbers JX566704 to JX566715.