Rapid and Simultaneous Detection of Genes Encoding Klebsiella pneumoniae Carbapenemase (bla_KPC) and New Delhi Metallo-β-Lactamase (bla_NDM) in Gram-Negative Bacilli

AUTHOR'S CORRECTION

Volume 51, no. 4, p. 1269–1271, 2013. Page 1270, Table 1, “Sequence” column, “Primer KPC160F” row: “5′ ATTGGCTAAAGGGAAACACGACC 3′” should read “5′ GCTAAAGGGAAACACGACC 3′.”

Page 1270, Table 1, “Sequence” column, “Probe KPC160fl” row: “5′ GAACCGCGGAGTGTATGGCACGG FITC 3′” should read “5′ GAACCTGCGGAGTGTATGGCACG FITC 3′.”

Page 1270, Table 1, “Sequence” column, “Probe KPC160iLC610” row: “5′ AAATGACTATGCCGTCGTCTGGCCCACT Red610 3′” should read “5′ Red610 AAATGACTATGCCGTCGTCTGGCCCACT PO4 3′.”