Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Mar 1.
Published in final edited form as: Mol Cancer Ther. 2013 Jun 19;12(9):10.1158/1535-7163.MCT-12-1007. doi: 10.1158/1535-7163.MCT-12-1007

An autocrine loop between TGF-β1 and the transcription factor Brachyury controls the transition of human carcinoma cells into a mesenchymal phenotype

Cecilia Larocca 1,2, Joseph R Cohen 1, Romaine I Fernando 1, Bruce Huang 1, Duane H Hamilton 1, Claudia Palena 1,§
PMCID: PMC3815539  NIHMSID: NIHMS496961  PMID: 23783250

Abstract

The epithelial-mesenchymal transition (EMT) is a process associated with the metastasis of solid tumors as well as with the acquisition of resistance to standard anti-cancer modalities. A major initiator of EMT in carcinoma cells is TGF-β, which has been shown to induce the expression of several transcription factors ultimately responsible for initiating and maintaining the EMT program. We have previously identified Brachyury, a T-box transcription factor, as an inducer of mesenchymal features in human carcinoma cells. In this study, a potential link between Brachyury and TGF-β signaling has been investigated. The results demonstrate for the first time that Brachyury expression is enhanced during TGF-β1-induced EMT in various human cancer cell lines, and that a positive feedback loop is established between Brachyury and TGF-β1 in mesenchymal-like tumor cells. In this context, Brachyury overexpression is shown to promote upregulation of TGF-β1 at the mRNA and protein levels, an effect mediated by activation of the TGF-β1 promoter in the presence of high levels of Brachyury. Furthermore, inhibition of TGF-β1 signaling by a small molecule inhibitor of TGF-β receptor type I decreases Brachyury expression, induces a mesenchymal-to-epithelial transition, and renders cancer cells more susceptible to chemotherapy. This study thus has implications for the future development of clinical trials using TGF-β inhibitors in combination with other anti-cancer agents.

Keywords: Brachyury, TGF-β, EMT, chemotherapy resistance, cytokine loops

Introduction

The epithelial-mesenchymal transition (EMT) is a reversible process that promotes the phenotypic transformation of epithelial cells into mesenchymal cells, a phenomenon characterized by loss of cell polarity and epithelial markers, along with increased expression of mesenchymal markers and gain of migratory and invasive capacities (1–4). While being crucial for normal gastrulation and organ development, EMT is also thought to contribute to the progression of carcinomas by promoting the dissemination of cancer cells and the establishment of metastasis (1–4). Numerous observations also indicate that EMT is involved in the acquisition of tumor resistance to chemo- or radio-therapeutic interventions (5, 6), as well as with the acquisition of a stem cell-like phenotype by carcinoma cells (7, 8), a phenotypic change linked to drug resistance (9). Thus, targeting and modulating the molecular machinery that regulates EMT may provide alternative strategies for improving therapeutic interventions against metastasis and drug resistance (10).

During embryogenesis and tumor development, the phenomenon of EMT is controlled by the expression of several transcription factors, including Twist (11), Snail (12), Slug (13), or ZEB1/2 (14, 15), among others. Our laboratory demonstrated that Brachyury (16–18), a molecule crucial for mesoderm differentiation, is over-expressed in a variety of human tumor tissues and cell lines but rarely found in normal adult tissues (19–21). Brachyury over-expression has been shown to drive EMT and to enhance the migratory and invasive features of human cancer cells in vitro, while promoting their metastatic dissemination in vivo (22, 23). By utilizing a 9-mer epitope of the Brachyury protein that specifically binds to the HLA-A2 molecule, Brachyury-specific CD8+ T cells were expanded from the blood of cancer patients that were able to lyse Brachyury-positive cancer cells in an MHC-restricted manner. These results formed the basis for the development of a recombinant yeast-Brachyury vaccine which is currently undergoing Phase I clinical testing in patients with advanced carcinomas (24).

TGF-β is a pleiotropic cytokine that regulates cellular proliferation, differentiation and survival (25–27). While functioning as a suppressor of cell growth and proliferation in most normal epithelial, endothelial and hematopoietic cells, TGF-β stimulates cancer cells to proliferate and to acquire a more aggressive, metastatic phenotype during the later stages of tumor development (28). Multiple studies have also demonstrated that TGF-β can induce EMT in normal and malignant cells, an effect first observed with cultures of normal mammary epithelial cells (MECs) that were induced into a fibroblast-like phenotype by exposure to TGF-β (29). TGF-β signaling relies on its binding to a heterotetrameric receptor composed of two TGF-β type I (TGF-βRI) and two TGF-β type II (TGF-βRII) molecules (30–32). Binding of TGF-β to TGF-βRII induces the recruitment and activation of TGF-βRI which, in turn, leads to the propagation of the signal through the phosphorylation of Smad2/3 proteins resulting in the activation or suppression of target genes (32).

Although numerous studies have demonstrated that Smad-dependent TGF-β induction of EMT in tumor cells results in the upregulation of various EMT transcription factors, including Snail, Slug and Twist (33), no previous study has shown the regulation of Brachyury by TGF-β in the context of a tumor cell. In the present study we sought to investigate the possible interaction between TGF-β and Brachyury. We report here for the first time that Brachyury is induced by TGF-β and that Brachyury and TGF-β partake in a positive feedback loop to sustain the mesenchymal characteristics of tumor cells that have undergone EMT. Furthermore, small molecule-targeted inhibition of TGF-β signaling decreased Brachyury expression while simultaneously reversing the mesenchymal phenotype of various human cancer cells. It is also shown here for the first time that this reversion of EMT mediated by TGF-β inhibition markedly enhances cancer cell susceptibility to chemotherapy. These findings suggest that combinatorial therapies with chemotherapy and TGF-β inhibition may provide alternative strategies to combat cancer in the clinical setting.

Materials and Methods

Cell Culture

Cell lines were purchased from ATCC (Manassas, VA) between 2005 and 2012: H460, H520, H596, SK-Lu-1, H441, SW480, SW620, DU145, LNCaP, and PC3. Cells were banked and subsequently passaged in our laboratory for periods shorter than 6 months. The H460 cell line and its derivatives were tested and authenticated by short tandem repeat (STR) analysis on January 2013; other cell lines were not authenticated. The ONYCAP23 line was provided by Onyvax Ltd. and propagated in RPMI-1640 supplemented with 10% FBS, 2mM glutamine, 1x antibiotic/antimycotic, 1x sodium pyruvate, and 1x non-essential amino acids (Invitrogen, Carlsbad, CA).

Plasmids and transfections

A Brachyury-overexpressing vector (pBrachyury) and Brachyury-specific shRNA constructs were used for stable transfections as previously described (22).

Treatment with TGF-β1 or SD-208

Tumor cells were treated with indicated concentrations of human TGF-β1 (BD Biosciences, San Jose, CA) prepared in 0.1% BSA/1X PBS, or the TGF-β receptor type I (ALK5) kinase inhibitor SD-208 (Sigma-Aldrich) dissolved in DMSO.

Chemotherapy treatment

Cells were seeded in 96-well plates (5×102 cells per well in 100μl media), allowed to attach overnight and treated as indicated. Docetaxel (Sanofi-Aventis, Bridgewater, NJ), cisplatin (APP Pharmaceuticals, Schaumburg, IL), and vinorelbine (Bedford Laboratories, Bedford, OH) were added to the cultures for 6 hours, followed by media replacement. Cultures were maintained for designated time periods; cell survival was evaluated by the MTT assay. Survival for treated wells was calculated as a percentage of the values representing wells of untreated cells.

Real-time PCR

Total RNA was prepared with the RNeasy kit (QIAGEN, Valencia, CA), followed by reverse transcription with Advantage RT-for-PCR (Clontech, Mountain View, CA). Real-time PCR was performed as previously described (22, 23) utilizing 10–50 ng cDNA with Gene Expression Master Mix and the following TaqMan gene expression assays (Applied Biosystems, Carlsbad, CA): Brachyury (Hs00610080), Snail (Hs00195591), Slug (Hs00161904), E-cadherin (Hs01013959), Fibronectin (Hs00415006), Plakoglobin (Hs00158408), TGF-β1 (Hs00998133), and GAPDH (4326317E).

Western blot, immunofluorescence and immunohistochemistry

For western blot, cells were lysed in RIPA lysis buffer (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Proteins (25–35 μg) were resolved on SDS-PAGE, transferred onto nitrocellulose membranes, and probed with antibodies for Fibronectin, E-cadherin, ZO-1 (BD Biosciences), β-actin (Neomarkers), and Brachyury, Snail, Slug (Abcam, Cambridge, MA, USA) at 4°C overnight. Detection was performed with the Odyssey Infrared imaging system (LI-COR Biosciences, Lincoln, NE). A Phospho-Smad Antibody Sampler Kit was utilized (Cell Signaling, Danvers, MA), following the manufacturer’s instructions. Immunofluorescence analysis of tumor cells cultured on glass coverslips was performed as previously described (22). H460 control.shRNA and Brachyury.shRNA cells (4–7.5 x 106) were injected in the flank of nude mice. Fixed tumor tissues were analyzed by immunohistochemistry with anti-TGF-β1 (clone TGFB17, Abcam). All mice were housed and maintained in microisolator cages under pathogen-free conditions and in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) guidelines; experimental studies were carried out under approval of the NIH Intramural Animal Care and Use Committee.

Cell migration and invasion

Assays in Blind Well Chambers (Neuro Probe Inc., Gaithersburg, MD) were conducted as previously described (22). Chambers were incubated for 12–24 hours at 37°C. Filters were fixed and stained with Diff-Quik. Cells on the bottom side of the filters were counted in 5 random X100 microscope objective fields. Experiments were conducted in triplicate for each cell line.

ELISA

Briefly, 1 x 106 cells in 1 mL serum-free medium were plated in 6-well plates and incubated for 48 hours at 37°C. Culture supernatants were collected and assayed in triplicate with the human active TGF-β1 or TGF-β2 ELISA kits (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions.

RNA interference

ON-TARGETplus SMARTpool siRNA for Brachyury and a non-targeting control siRNA were purchased from Dharmacon (Lafayette, CO). DU145 cells were transfected following the manufacturers’ protocol. Six hours after transfection, cells were treated with 1ng/mL of TGF-β for 48 hours. Treated cells were either harvested for RNA extraction or evaluated in an invasion assay.

Promoter reporter assay

GoClone Reporter constructs of TGF-β1 (S721675) and GAPDH (721624) promoters and an empty vector (S790005, SwitchGear Genomics, Menlo Park, CA) were used. Cells (1 x 104) were plated on white 96-well plates, allowed to attach overnight and transfected using FuGENE HD (Promega, Madison, WI) at 3:1 ratio to DNA. Luciferase activity was assayed using LightSwitch Luciferase assay reagent (LS010, SwitchGear) according to the manufacture’s instruction.

Statistics

Data were analyzed using GraphPad Prism (version 4; GraphPad Software). Two-tailed, unpaired t test was used. One-way ANOVA test was used for comparison across multiple groups. Data points in graphs represent mean ± SEM and p< 0.05 is considered significant.

Results

Upregulation of Brachyury in human carcinoma cells undergoing TGF-β1-induced EMT

To investigate whether TGF-β controls Brachyury expression in human carcinomas, tumor cell lines with an epithelial phenotype and low levels of Brachyury were treated with a range of concentrations of human TGF-β1. DU145 prostate carcinoma cells assumed a mesenchymal-like phenotype characterized by a spindle-like morphology (Fig. 1A), decreased expression of epithelial E-cadherin and increased expression of mesenchymal Fibronectin, both at the mRNA (Fig. 1B) and protein levels (Fig. 1C), after treatment with various concentrations of TGF-β1. The expression of Brachyury mRNA (Fig. 1D) and protein (Fig. 1E) showed a bell-shaped response curve with maximum upregulation in response to 1 ng/mL TGF-β1, while the effect was lost or diminished with 10 ng/mL TGF-β1. Additional prostate (Fig. 1F) and lung (Fig. 1G) carcinoma cell lines were evaluated; five out of seven lines also showed a significant enhancement of Brachyury expression after treatment with 1 ng/mL (but not 10 ng/mL) TGF-β1. All further experiments were conducted with 1 ng/mL TGF-β1, unless indicated.

Figure 1. TGF-β1 induces Brachyury and EMT in human carcinoma cells.

Figure 1

(A) Bright-field images of DU145 cells left untreated or treated for 72 hours with increasing concentrations of TGF-β1. Expression of E-cadherin and Fibronectin in DU145 cells treated with TGF-β1 for 72 hours by (B) real-time PCR or (C) western blot. (D) Brachyury expression in DU145 cells treated with TGF-β1 by real-time PCR or (E) western blot. Real-time PCR analysis of Brachyury expression in human prostate (F) and lung cancer (G) cell lines treated with indicated concentrations of TGF-β1 for 72 hours. Error bars indicate SEM for triplicate measurements; *p < 0.05, **p< 0.005, ***p< 0.001.

Upregulation of Brachyury protein in response to TGF-β1 was predominantly observed in the nuclei of DU145 cells, as expected for a transcription factor, although weak cytosolic staining was also detected (Fig. 2A). Functionally, treatment of DU145 cells with TGF-β1 also resulted in a significant enhancement of the migratory and invasive capacity of these cells in vitro (Fig. 2B). In light of these results, we investigated the contribution of Brachyury to the invasive phenotype of TGF-β1-treated tumor cells. DU145 cells were left untreated or transfected with a pool of Brachyury-specific vs. a non-targeting pool of siRNAs and subsequently incubated with TGF-β1 for 48 hours. As shown in Figure 2C, Brachyury upregulation in response to TGF-β1 was efficiently prevented by transfection with Brachyury siRNA which, in turn, simultaneously inhibited the emergence of an invasive phenotype in response to TGF-β1 (Fig. 2D). Control siRNA–treated cells showed an increase of Brachyury mRNA in response to TGF-β1, as compared to untransfected DU145 cells (Fig. 2C). Although the reason for this enhancement is unknown, we speculate it could be due to generic effects of siRNA transfection including, for example, enhanced secretion of interferon-alpha and interleukin-8 (34), the latter known to be an inducer of Brachyury in tumor cells (23).

Figure 2. TGF-β1-mediated Brachyury upregulation is relevant to tumor invasiveness.

Figure 2

(A) Immunofluorescent analysis of Brachyury expression in DU145 cells treated as indicated for 72 hours. Green corresponds to Brachyury expression; blue indicates DAPI stained nuclei (magnification, X40). (B) DU145 cells treated as indicated for 48 hours were evaluated for cell migration and invasion. (C) DU145 cells were left untransfected or transfected with control- vs. Brachyury-specific siRNA for 24 hours and subsequently left untreated or treated for 48 hours with TGF-β1. At the end of the cytokine treatment, cells were harvested for Brachyury mRNA analysis or (D) invasion assays. (E) Real-time PCR analysis of Brachyury, Snail and Slug in DU145 cells treated for 72 hours as indicated. Expression of Snail and Slug by real-time PCR (F) or western blot (G) in DU145 cells untransfected vs. cells transfected with control- vs. Brachyury-specific siRNA and subsequently incubated with TGF-β1 for 48 hours. Error bars indicate SEM for triplicate measurements. *p < 0.05, **p< 0.005, ***p< 0.001, ****p< 0.0001.

Consistent with the idea that a variety of transcription factors may act in concert to elicit the changes distinctive of EMT (8), we further investigated whether TGF-β1 treatment of carcinoma cells simultaneously upregulates the expression of Brachyury, Snail and Slug and whether Brachyury overexpression is required for Snail and/or Slug upregulation to take place. Both Snail and Slug were upregulated in response to TGF-β1 treatment (Fig. 2E). Silencing of Brachyury prior to TGF-β1 treatment reduced Snail expression by 46 and 43% compared to the levels in control siRNA treated cells, at the mRNA (Fig. 2F) and protein levels (Fig. 2G), respectively, while decreasing Slug to a lesser extent than Snail (19% at the protein level, Fig. 2G).

Brachyury and TGF-β1 participate in a positive feedback loop

Our findings that TGF-β1 induces the expression of Brachyury in human carcinoma cells led us to investigate whether Brachyury, in turn, is able to induce TGF-β1 expression. Stable over-expression of Brachyury in DU145 cells significantly increased the levels of secreted TGF-β1 protein, compared with control vector-transfected cells (Fig. 3A). Likewise, stable silencing of Brachyury caused a consistent and significant decrease in TGF-β1 levels in culture supernatants from SW620 and H460 cells, compared with control cells (Fig. 3B). A rescue experiment was also performed with H460 Brachyury.shRNA cells transfected with an empty vector vs. a vector encoding Brachyury (pBrachyury). As shown in Figure 3C, single reconstitution of Brachyury expression was able to restore secretion of TGF-β1, therefore indicating that TGF-β1 and Brachyury participate in a positive feedback loop in tumor cells undergoing EMT.

Figure 3. Brachyury induces TGF-β secretion.

Figure 3

ELISA for TGF-β1 in culture supernatants of human cancer cell pairs obtained by (A) Brachyury over-expression in DU145 cells (pBrachyury) or (B) via stable silencing with a Brachyury-specific shRNA (Brac.shRNA) in SW620 and H460 cells. (C) Levels of TGF-β1 secreted by H460 cells silenced for Brachyury expression and subsequently transfected with an empty vector (pcDNA) or a pBrachyury vector. (D) Immunohistochemistry analysis of TGF-β1 in xenografts of H460 control.shRNA vs. H460 Brachyury.shRNA cells. Brown corresponds to TGF-β1 expression; slides were counterstained with haematoxylin. (Magnification X20). (E). Secretion of TGF-β2 in culture supernatants of indicated tumor cells. Error bars indicate SEM for triplicate measurements. *p< 0.05, **p< 0.005, ***p< 0.001.

The correlation between Brachyury and TGF-β1 expression in the H460 cell pair was further analyzed in vivo with xenografts grown subcutaneously in immune deficient mice. While TGF-β1 was almost undetectable in H460 Brachyury.shRNA tumors, positive TGF-β1 staining was detected in tumors formed by H460 control.shRNA cells, reinforcing the positive association between Brachyury and TGF-β1 (Fig. 3D). We have previously shown that silencing of Brachyury in H460 cells does not affect primary tumor growth, but instead suppresses the tumor cells’ ability to disseminate from the subcutaneous site to the lungs (22), an observation that could partly be due to decreased TGF-β1 secretion in Brachyury-silenced cells, as demonstrated in this study.

Due to the tight association between Brachyury and TGF-β1 secretion, LNCaP and H520 cells with high basal levels of Brachyury (Fig. 1F, G) were evaluated for cytokine secretion. Both cell lines secreted TGF-β1 in the ng/mL range (Supp. Fig. 1A), however, addition of exogenous TGF-β1 to LNCaP cells upregulated Fibronectin and decreased E-cadherin (Supp. Fig. 1B), indicating that TGF-β signaling remains functional in these cells.

As the role of TGF-β2 in cancer progression is now recognized (35), we have also evaluated whether Brachyury expression correlates with TGF-β2 secretion. As shown in Figure 3E, a direct association was observed between Brachyury and TGF-β2 in H460 cell lines with a range of Brachyury levels. Further experiments will be conducted to elucidate the potential role of TGF-β2 on the acquisition and maintenance of EMT features in Brachyury-high carcinoma cells.

Brachyury induces transcriptional activation of the TGF-β1 promoter

To further characterize the mechanism involved in the upregulation of TGF-β1 in Brachyury-high tumor cells, mRNA analysis was conducted. As shown in Figures 4A and 4B, TGF-β1 mRNA expression positively correlated with the level of Brachyury in carcinoma cells, indicating a potential regulatory mechanism mediated by Brachyury at the transcriptional level. Additionally, a promoter reporter assay utilizing a vector encoding the luciferase gene under the control of a 910bp fragment of the TGF-β1 promoter transfected into H460 control.shRNA vs. H460 Brachyury.shRNA cells showed that Brachyury silencing results in almost complete abolishment of TGF-β1 promoter activity (Fig. 4C).

Figure 4. Brachyury activates TGF-β1 promoter transcription.

Figure 4

(A, B) Real-time PCR analysis of TGF-β1 in tumor cells with various levels of Brachyury. (C) TGF-β1 promoter reporter activity normalized to GAPDH promoter in H460 control.shRNA vs. Brachyury.shRNA. Error bars indicate SEM for triplicate measurements. *p< 0.05, **p< 0.005

Inhibition of TGF-β signaling decreases Brachyury and reverses EMT

We hypothesized that the high levels of Brachyury expression observed in some human carcinoma cells may partially result from the autocrine activity of TGF-β1 produced by the same tumor cells. Thus, it may be possible to reduce Brachyury expression by small molecule-targeted inhibition of TGF-βRI. To evaluate this hypothesis, DU145 cells were treated with various concentrations of SD-208 (Fig. 5A), a small-molecule inhibitor of the kinase activity of TGF-βRI, prior to treatment with TGF-β1. Blockade of TGF-β1 signaling attenuated the phenotypic changes characteristic of EMT and blocked the upregulation of Brachyury in response to cytokine treatment (Fig. 5B). As expected, SD-208 completely abolished Smad-2 phosphorylation (Fig. 5C) and prevented the migratory and invasive behavior induced by TGF-β1 in DU145 cells (Fig. 5D). Utilizing tumor cell models with high basal levels of Brachyury and TGF-β1 we demonstrated that treatment with SD-208 increases expression of the epithelial markers ZO-1 and Plakoglobin (Fig. 5E, F) while greatly reducing the expression of mesenchymal Fibronectin. Functionally, restriction of TGF-β signaling significantly impaired the ability of H460 tumor cells to migrate and to invade the extracellular matrix, in a dose-dependent manner (Fig. 5G).

Figure 5. SD-208 reverses TGF-β1–induced EMT.

Figure 5

(A) Chemical structure of SD-208. (B) Expression of E-cadherin, Fibronectin, and Brachyury mRNA in DU145 cells untreated (−) or pre-treated with SD-208 for 30 minutes followed by treatment with TGF-β1 for 72 hours. (C) Western blot analysis of total Smad-2, phospho-Smad-2 and β-actin in protein lysates from DU145 cells pre-treated with or without SD-208 for 30 minutes in the presence or absence of TGF-β1 for an additional 30 minutes. (D) Cell migration and ECM invasion assay with DU145 cells treated with TGF-β1 for 48 hours in the absence or presence of indicated doses of SD-208. Results from a representative experiment are shown. (E) Western blot analysis for ZO-1, Fibronectin and β-actin in H460 cells treated for 72 hours as indicated. (F) Immunofluorescent analysis of Plakoglobin and Fibronectin (green) in H460 cells; blue corresponds to nuclei stained with DAPI (original magnification, X40). (G) Cell migration and ECM invasion assay with H460 cells treated as indicated for 48 hours. Error bars indicate SEM for triplicate measurements; *p< 0.05, ***p< 0.001, ****p<0.0001.

In relation to the effect of TGF-β1 signaling blockade on the expression of Brachyury, treatment of H460 cells with SD-208 decreased Brachyury expression by approximately 50% at all concentrations tested (Fig. 6A). Additional carcinoma cell lines, SW480 and SW620, also showed a significant decrease of Brachyury in response to SD-208 treatment (Supp. Fig. 2). These results indicated that SD-208 is able to induce phenotypic changes commonly attributed to a mesenchymal-epithelial transition (MET).

Figure 6. SD-208 decreases Brachyury expression and enhances chemotherapy sensitivity of human carcinoma cells.

Figure 6

H460 cells were treated with increasing concentrations of SD-208 for 72 hours and evaluated for Brachyury and β-actin expression by western blot. Bottom graph shows Brachyury levels normalized to β-actin. (B) Chemical structure of chemotherapeutics used. (C) H460 cells were left untreated (0) or pre-treated for 48 hours with indicated concentrations of SD-208 and subsequently exposed to chemotherapeutics (165/0.12 ng/mL cisplatin/vinorelbine, 165 ng/mL cisplatin, 0.12 ng/mL vinorelbine and 0.07 ng/mL docetaxel). Survival was evaluated after 4 days by the MTT assay. (D) Expression of Brachyury and GAPDH in indicated tumor cells incubated for 48 hours with increasing doses of SD-208. (E) Survival of H460 control.shRNA and Brachyury.shRNA cells pre-treated with indicated doses of SD-208 and subsequently treated as above with cisplatin/vinorelbine.

Inhibition of TGF-β1 signaling enhances susceptibility to chemotherapy

Acquisition of a mesenchymal phenotype by carcinoma cells is believed to be associated with tumor resistance to a variety of anti-cancer modalities. As the treatment of human carcinoma cells with a TGF-βRI inhibitor is able to induce a more epithelial phenotype, we hypothesized that cancer cells treated with SD-208 will be rendered more susceptible to chemotherapy. To prove this hypothesis, H460 cells were pre-treated with SD-208 and subsequently treated with various chemotherapeutic agents (Fig. 6B). As shown in Figure 6C, pre-treatment of H460 cells with SD-208 enhanced, in a dose-dependent manner, the cytotoxic effect of all chemotherapies tested. In order to evaluate the role of Brachyury in this phenomenon, additional experiments were conducted with the H460 tumor cell pair. As shown in Figure 6D, treatment of H460 control.shRNA cells with various concentrations of SD-208 reduced the expression of Brachyury to an extent similar to that observed with parental H460 cells, while H460 Brachyury.shRNA cells had low levels of Brachyury expression that remained unchanged after incubation with SD-208. When exposed to chemotherapy, H460 Brachyury.shRNA cells demonstrated reduced survival (~ 25% reduction) compared to H460 control.shRNA cells (Fig. 6E), indicating a direct role for Brachyury in tumor resistance to chemotherapy. Pre-treatment of both cell lines with SD-208 significantly improved the cytotoxic response to chemotherapy, an effect that was more pronounced in Brachyury-silenced cells compared to Brachyury-high H460 cells.

Discussion

The findings presented here show for the first time the existence of a positive feedback loop between the EMT regulator Brachyury and TGF-β1 signaling in human cancer cells. This stems from the observation that treatment of various human carcinoma cell lines with TGF-β1 induces Brachyury and, conversely, modulation of Brachyury expression in tumor cells directly affects, in a positive correlative fashion, the secretion of TGF-β1. We also demonstrate that treatment with an inhibitor of TGF-βRI is sufficient to downregulate Brachyury in various human cancer cells, and to simultaneously revert their mesenchymal features, including resistance to chemotherapy treatment.

Numerous studies have demonstrated a dual role for TGF-β in cancer development (27, 32). While suppressing tumor growth at early phases, TGF-β can stimulate tumor invasion, metastasis and angiogenesis, and suppress anti-tumor immune responses at later tumor stages (28, 36–38). As a result, targeted inhibition of TGF-β signaling has been the focus of intense investigation for therapeutic interventions in cancer (39, 40). Regarding its role on tumor progression, TGF-β is able to regulate the transcriptional EMT program directly and through interactions with a variety of signaling networks, including Notch, Wnt, and others (37, 41). Once EMT is induced, it has also been shown that secretion of TGF-β and the expression of molecules involved in TGF-β signaling pathways are induced (42, 43). In agreement with those studies, we have shown here that treatment of human cancer cells with TGF-β1 induces the expression of Brachyury, a T-box protein that regulates EMT in human carcinoma cells (22, 23). Although the mechanism by which TGF-β1 upregulates Brachyury mRNA and protein expression was not studied here, the relevance of Brachyury expression during TGF-β1-induced EMT was demonstrated by silencing Brachyury prior to cytokine treatment, a manipulation that abolished the acquisition of tumor invasiveness and prevented upregulation of Snail in response to TGF-β1. These results suggested that Brachyury is not just a bystander gene upregulated during EMT but rather a gene of relevance to the phenotypic changes associated with epithelial cell plasticity. We have shown in previous reports (22, 23) that overexpression of Brachyury drives upregulation of Snail in a variety of carcinoma cell lines. The results shown here indicate that Brachyury may also participate in the regulation of Snail expression in response to TGF-β1, and that both proteins are required for the acquisition of tumor invasiveness. As no DNA-binding site for Brachyury was observed within the promoter region of Snail, the positive influence of Brachyury on Snail expression appears to be indirect.

Expression of Brachyury in response to various doses of TGF-β1 followed a bell-shaped pattern of expression, with Brachyury being upregulated at low (but not high) concentrations of TGF-β1. These results are in agreement with previous reports demonstrating that low concentrations of activin, a member of the TGF-β superfamily, activate Brachyury expression during Xenopus development, an effect that is lost with high concentrations (44, 45). This biphasic phenomenon has been attributed to the ability of high concentrations of activin to activate expression of Goosecoid that, in turn, represses the Brachyury promoter. We hypothesize that a similar regulatory phenomenon could mediate the differential regulation of Brachyury in carcinoma cells in response to treatment with low vs. high doses of TGF-β1, where high doses of the cytokine may induce additional transcriptional regulators that could, in turn, repress Brachyury.

In multiple tumor cell models it has been shown that TGF-β has the ability to function in an autocrine fashion to maintain the EMT phenotype (46, 47). We have shown here for the first time the existence of a feed-forward loop between Brachyury and TGF-β1, as high levels of Brachyury associated with high expression of TGF-β1 mRNA and protein, while silencing of Brachyury in lung carcinoma cells almost completely abolished the activity of a reporter of TGF-β1 promoter. The analysis of the TGF-β1 promoter sequence failed to identify the palindromic consensus element AATTTCACACCTAGGTGTGAAATT or its half-site (TCACACCT) known to be required for Brachyury-binding to DNA. We hypothesized that Brachyury may indirectly promote TGF-β1 transcription either by inducing and/or repressing other transcriptional regulators that could directly control the activity of the TGF-β1 promoter, or by modifying their ability to efficiently bind and regulate transcription of TGF-β1.

A variety of TGF-β signaling inhibitors are currently undergoing pre-clinical development (40). A dual TGF-βRI and TGF-βRII small molecule inhibitor (LY2109761), for example, was previously shown to induce MET in a subpopulation of breast cancer cells with mesenchymal and stem cell-like properties (48). In the present study we have demonstrated that mesenchymal-like tumor cells naturally high for Brachyury can be converted into an epithelial phenotype by single blockade of TGF-β signaling with SD-208. The phenomenon of EMT has been previously associated with the acquisition of resistance to chemotherapy and radiation (8). Tumor cells undergoing EMT via over-expression of Brachyury have been shown to be more resistant to the cytotoxic effects of various chemotherapies and radiation (Huang et al; unpublished observations). In the present study we showed that reversion of EMT via treatment with SD-208 is able not only to reduce the levels of Brachyury but also to enhance in vitro tumor susceptibility to cisplatin, vinorelbine and docetaxel. By utilizing tumor cells silenced for the expression of Brachyury, we have also shown that Brachyury plays a direct role in chemotherapy resistance of H460 cells and that inhibition of TGF-β1 signaling further alleviates tumor resistance by mechanisms other than the downregulation of Brachyury.

The results presented here suggest that combinatorial approaches of conventional therapeutics and TGF-β signaling inhibition may provide a more effective strategy in the treatment of metastatic disease. Additionally, our laboratory has developed a Brachyury-based cancer vaccine that is currently undergoing Phase I clinical trial in patients with carcinomas. Ongoing studies are also exploring the potential benefit of using a TGF-βR inhibitor combined with anti-Brachyury based immunotherapies for the treatment of metastatic carcinomas.

Supplementary Material

1
2

Acknowledgments

The authors thank Dr. Jeffrey Schlom for his intellectual contributions, critical discussions and support. The authors also thank Margie Duberstein for technical assistance and Debra Weingarten for editorial assistance.

Grant support: The research was funded by the Intramural Research Program of the Center for Cancer Research, National Cancer Institute, NIH.

Financial support: All authors received funding from the Intramural Research Program of the Center for Cancer Research, National Cancer Institute, NIH.

Footnotes

Conflict of interest: the authors have no conflicts to declare

References

  • 1.Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2:442–54. doi: 10.1038/nrc822. [DOI] [PubMed] [Google Scholar]
  • 2.Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119:1420–8. doi: 10.1172/JCI39104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Acloque H, Adams MS, Fishwick K, Bronner-Fraser M, Nieto MA. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J Clin Invest. 2009;119:1438–49. doi: 10.1172/JCI38019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nieto MA. The ins and outs of the epithelial to mesenchymal transition in health and disease. Annu Rev Cell Dev Biol. 2011;27:347–76. doi: 10.1146/annurev-cellbio-092910-154036. [DOI] [PubMed] [Google Scholar]
  • 5.Kajiyama H, Shibata K, Terauchi M, Yamashita M, Ino K, Nawa A, et al. Chemoresistance to paclitaxel induces epithelial-mesenchymal transition and enhances metastatic potential for epithelial ovarian carcinoma cells. Int J Oncol. 2007;31:277–83. [PubMed] [Google Scholar]
  • 6.Kurrey NK, Jalgaonkar SP, Joglekar AV, Ghanate AD, Chaskar PD, Doiphode RY, et al. Snail and slug mediate radioresistance and chemoresistance by antagonizing p53-mediated apoptosis and acquiring a stem-like phenotype in ovarian cancer cells. Stem Cells. 2009;27:2059–68. doi: 10.1002/stem.154. [DOI] [PubMed] [Google Scholar]
  • 7.Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 2008;133:704–15. doi: 10.1016/j.cell.2008.03.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Polyak K, Weinberg RA. Transitions between epithelial and mesenchymal states: acquisition of malignant and stem cell traits. Nat Rev Cancer. 2009;9:265–73. doi: 10.1038/nrc2620. [DOI] [PubMed] [Google Scholar]
  • 9.Singh A, Settleman J. EMT, cancer stem cells and drug resistance: an emerging axis of evil in the war on cancer. Oncogene. 2010;29:4741–51. doi: 10.1038/onc.2010.215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Palena C, Fernando RI, Litzinger MT, Hamilton DH, Huang B, Schlom J. Strategies to target molecules that control the acquisition of a mesenchymal-like phenotype by carcinoma cells. Exp Biol Med (Maywood) 2011;236:537–45. doi: 10.1258/ebm.2011.010367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, et al. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 2004;117:927–39. doi: 10.1016/j.cell.2004.06.006. [DOI] [PubMed] [Google Scholar]
  • 12.Carver EA, Jiang R, Lan Y, Oram KF, Gridley T. The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol. 2001;21:8184–8. doi: 10.1128/MCB.21.23.8184-8188.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nieto MA, Sargent MG, Wilkinson DG, Cooke J. Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science. 1994;264:835–9. doi: 10.1126/science.7513443. [DOI] [PubMed] [Google Scholar]
  • 14.Guaita S, Puig I, Franci C, Garrido M, Dominguez D, Batlle E, et al. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem. 2002;277:39209–16. doi: 10.1074/jbc.M206400200. [DOI] [PubMed] [Google Scholar]
  • 15.Vandewalle C, Comijn J, De Craene B, Vermassen P, Bruyneel E, Andersen H, et al. SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res. 2005;33:6566–78. doi: 10.1093/nar/gki965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H. Cloning of the T gene required in mesoderm formation in the mouse. Nature. 1990;343:617–22. doi: 10.1038/343617a0. [DOI] [PubMed] [Google Scholar]
  • 17.Kispert A, Hermann BG. The Brachyury gene encodes a novel DNA binding protein. EMBO J. 1993;12:4898–9. doi: 10.1002/j.1460-2075.1993.tb05990.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Edwards YH, Putt W, Lekoape KM, Stott D, Fox M, Hopkinson DA, et al. The human homolog T of the mouse T(Brachyury) gene; gene structure, cDNA sequence, and assignment to chromosome 6q27. Genome Res. 1996;6:226–33. doi: 10.1101/gr.6.3.226. [DOI] [PubMed] [Google Scholar]
  • 19.Palena C, Polev DE, Tsang KY, Fernando RI, Litzinger M, Krukovskaya LL, et al. The human T-box mesodermal transcription factor Brachyury is a candidate target for T-cell-mediated cancer immunotherapy. Clin Cancer Res. 2007;13:2471–8. doi: 10.1158/1078-0432.CCR-06-2353. [DOI] [PubMed] [Google Scholar]
  • 20.Hamilton DH, Litzinger MT, Fernando RI, Huang B, Palena C. Cancer vaccines targeting the epithelial-mesenchymal transition: tissue distribution of brachyury and other drivers of the mesenchymal-like phenotype of carcinomas. Semin Oncol. 2012;39:358–66. doi: 10.1053/j.seminoncol.2012.02.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Roselli M, Fernando RI, Guadagni F, Spila A, Alessandroni J, Palmirotta R, et al. Brachyury, a Driver of the Epithelial-Mesenchymal Transition, Is Overexpressed in Human Lung Tumors: An Opportunity for Novel Interventions against Lung Cancer. Clin Cancer Res. 2012;18:3868–79. doi: 10.1158/1078-0432.CCR-11-3211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fernando RI, Litzinger M, Trono P, Hamilton DH, Schlom J, Palena C. The T-box transcription factor Brachyury promotes epithelial-mesenchymal transition in human tumor cells. J Clin Invest. 2010;120:533–44. doi: 10.1172/JCI38379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fernando RI, Castillo MD, Litzinger M, Hamilton DH, Palena C. IL-8 signaling plays a critical role in the epithelial-mesenchymal transition of human carcinoma cells. Cancer Res. 2011;71:5296–306. doi: 10.1158/0008-5472.CAN-11-0156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Open Label Study to Evaluate the Safety and Tolerability of GI-6301 a Vaccine Consisting of Whole Heat-Killed Recombitant Yeast Genetically Modified to Express Brachyury Protein in Adults With Solid Tumors. www.clinicaltrials.gov/ct2/show/NCT01519817.
  • 25.Roberts AB, Wakefield LM. The two faces of transforming growth factor beta in carcinogenesis. Proc Natl Acad Sci U S A. 2003;100:8621–3. doi: 10.1073/pnas.1633291100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control, cancer, and heritable disorders. Cell. 2000;103:295–309. doi: 10.1016/s0092-8674(00)00121-5. [DOI] [PubMed] [Google Scholar]
  • 27.Derynck R, Akhurst RJ. Differentiation plasticity regulated by TGF-beta family proteins in development and disease. Nat Cell Biol. 2007;9:1000–4. doi: 10.1038/ncb434. [DOI] [PubMed] [Google Scholar]
  • 28.Bierie B, Moses HL. Tumour microenvironment: TGFbeta: the molecular Jekyll and Hyde of cancer. Nat Rev Cancer. 2006;6:506–20. doi: 10.1038/nrc1926. [DOI] [PubMed] [Google Scholar]
  • 29.Miettinen PJ, Ebner R, Lopez AR, Derynck R. TGF-beta induced transdifferentiation of mammary epithelial cells to mesenchymal cells: involvement of type I receptors. J Cell Biol. 1994;127:2021–36. doi: 10.1083/jcb.127.6.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tang B, Vu M, Booker T, Santner SJ, Miller FR, Anver MR, et al. TGF-beta switches from tumor suppressor to prometastatic factor in a model of breast cancer progression. J Clin Invest. 2003;112:1116–24. doi: 10.1172/JCI18899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell. 2003;113:685–700. doi: 10.1016/s0092-8674(03)00432-x. [DOI] [PubMed] [Google Scholar]
  • 32.Massague J. TGFbeta in Cancer. Cell. 2008;134:215–30. doi: 10.1016/j.cell.2008.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Thuault S, Valcourt U, Petersen M, Manfioletti G, Heldin CH, Moustakas A. Transforming growth factor-beta employs HMGA2 to elicit epithelial-mesenchymal transition. J Cell Biol. 2006;174:175–83. doi: 10.1083/jcb.200512110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sledz CA, Holko M, de Veer MJ, Silverman RH, Williams BR. Activation of the interferon system by short-interfering RNAs. Nat Cell Biol. 2003;5:834–9. doi: 10.1038/ncb1038. [DOI] [PubMed] [Google Scholar]
  • 35.Hilbig A, Oettle H. Transforming growth factor beta in pancreatic cancer. Curr Pharm Biotechnol. 2011;12:2158–64. doi: 10.2174/138920111798808356. [DOI] [PubMed] [Google Scholar]
  • 36.Padua D, Massague J. Roles of TGFbeta in metastasis. Cell Res. 2009;19:89–102. doi: 10.1038/cr.2008.316. [DOI] [PubMed] [Google Scholar]
  • 37.Wendt MK, Tian M, Schiemann WP. Deconstructing the mechanisms and consequences of TGF-beta-induced EMT during cancer progression. Cell Tissue Res. 2012;347:85–101. doi: 10.1007/s00441-011-1199-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Park HY, Wakefield LM, Mamura M. Regulation of tumor immune surveillance and tumor immune subversion by tgf-Beta. Immune Netw. 2009;9:122–6. doi: 10.4110/in.2009.9.4.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Pennison M, Pasche B. Targeting transforming growth factor-beta signaling. Curr Opin Oncol. 2007;19:579–85. doi: 10.1097/CCO.0b013e3282f0ad0e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Korpal M, Kang Y. Targeting the transforming growth factor-beta signalling pathway in metastatic cancer. Eur J Cancer. 2010;46:1232–40. doi: 10.1016/j.ejca.2010.02.040. [DOI] [PubMed] [Google Scholar]
  • 41.Javelaud D, Pierrat MJ, Mauviel A. Crosstalk between TGF-beta and hedgehog signaling in cancer. FEBS Lett. 2012;586:2016–25. doi: 10.1016/j.febslet.2012.05.011. [DOI] [PubMed] [Google Scholar]
  • 42.Taube JH, Herschkowitz JI, Komurov K, Zhou AY, Gupta S, Yang J, et al. Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proc Natl Acad Sci U S A. 2010;107:15449–54. doi: 10.1073/pnas.1004900107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Dhasarathy A, Phadke D, Mav D, Shah RR, Wade PA. The transcription factors Snail and Slug activate the transforming growth factor-beta signaling pathway in breast cancer. PLoS One. 2011;6:e26514. doi: 10.1371/journal.pone.0026514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Latinkic BV, Umbhauer M, Neal KA, Lerchner W, Smith JC, Cunliffe V. The Xenopus Brachyury promoter is activated by FGF and low concentrations of activin and suppressed by high concentrations of activin and by paired-type homeodomain proteins. Genes Dev. 1997;11:3265–76. doi: 10.1101/gad.11.23.3265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Dyson S, Gurdon JB. The interpretation of position in a morphogen gradient as revealed by occupancy of activin receptors. Cell. 1998;93:557–68. doi: 10.1016/s0092-8674(00)81185-x. [DOI] [PubMed] [Google Scholar]
  • 46.Scheel C, Eaton EN, Li SH, Chaffer CL, Reinhardt F, Kah KJ, et al. Paracrine and autocrine signals induce and maintain mesenchymal and stem cell states in the breast. Cell. 2011;145:926–40. doi: 10.1016/j.cell.2011.04.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gregory PA, Bracken CP, Smith E, Bert AG, Wright JA, Roslan S, et al. An autocrine TGF-beta/ZEB/miR-200 signaling network regulates establishment and maintenance of epithelial-mesenchymal transition. Mol Biol Cell. 2011;22:1686–98. doi: 10.1091/mbc.E11-02-0103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Shipitsin M, Campbell LL, Argani P, Weremowicz S, Bloushtain-Qimron N, Yao J, et al. Molecular definition of breast tumor heterogeneity. Cancer Cell. 2007;11:259–73. doi: 10.1016/j.ccr.2007.01.013. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES