Skip to main content
PMC home page
Genetic Testing and Molecular Biomarkers logoLink to Genetic Testing and Molecular Biomarkers
. 2013 Nov;17(11):844–848. doi: 10.1089/gtmb.2013.0264

Genetic Variability of Inflammatory Genes in the Brazilian Population

Marcelo dos Santos 1, Elaine Stur 1, Lucas Lima Maia 1, Lidiane Pignaton Agostini 1, Gabriela Tonini Peterle 1, Suzanny Oliveira Mendes 1, Eloiza Helena Tajara 2, Marcos Brasilino de Carvalho 3, Iúri Drumond Louro 4, Adriana Madeira Álvares Silva-Conforti 5,✉
PMCID: PMC3816776  PMID: 23909556

Abstract

Inflammatory gene variants have been associated with several diseases, including cancer, diabetes, vascular diseases, neurodegenerative diseases, arthritis, and others. Therefore, determining the population genetic composition of inflammation-related genes can be useful for the determination of general risk, prognostic and therapeutic strategies to prevent or cure specific diseases. We have aimed to identify polymorphism genotype frequencies in genes related to the inflammatory response in the Brazilian population, namely, IκBL −62AT, IκBL −262CT, tumor necrosis factors alpha (TNFa) −238GA, TNFa −308GA, lymphotoxin-alpha (LTa) +80AC, LTa +252AG, FAS −670AG, and FASL −844TC, considering the white, black, and Pardo ethnicities of the São Paulo State. Our results suggest that the Brazilian population is under a miscegenation process at the current time, since some genotypes are not in the Hardy–Weinberg equilibrium. In addition, we conclude that the Pardo ethnicity is derived from a complex mixture of ethnicities, including the native Indian population.

Introduction

The Brazilian population is a remarkably heterogeneous population. When Brazil was discovered by the Portuguese in 1500, there were ∼2 million native Indians living in the Brazilian territory. Since then, continuous migratory waves from different countries worldwide have brought together a wide variety of ethnicities that have ultimately composed the contemporary Brazilian population. Migratory waves included a constant influx of Portuguese, Africans, and Europeans who were brought to Brazil during the 19th and 20th centuries (Callegari-Jacques et al., 2003).

The new genetic pool greatly contributed to a high degree of variability, directly affecting most genetic polymorphic traits, such as genes related to the inflammatory response. Among these, we can attribute special importance to tumor necrosis factors alpha (TNFa) (Warren, 1990), lymphotoxin-alpha (LTa) (Ruddle and Homer, 1988), nuclear factor kappa-B inhibitor-like (NFκBIL1, also known as IκBL) (Castiblanco and Anaya, 2008), and FAS/FASL, also known as CD95/CD95L (Müllauer et al., 2001).

Polymorphic variants of inflammatory genes have been associated with several diseases, including cancer (Schwartsburd, 2003; Philip et al., 2004), diabetes (Willerson and Ridker, 2004), vascular diseases (Gan et al., 2004; Hansson, 2005), neurodegenerative diseases (Perry, 2004; Nagatsu and Sawada, 2005), arthritis (Arend and Gabay, 2004), and others. An accurate description of the population background of genes that are important to the inflammatory response can be useful for the determination of general risk, prognostic and therapeutic strategies to prevent or cure specific diseases.

The present study aims to identify single-nucleotide polymorphism (SNP) genotype frequencies in genes related to the inflammatory response in the Brazilian population (IκBL−62AT [rs2071592], IκBL −262CT [rs2071592], TNFa −238GA [rs361525], TNFa −308GA [rs1000629], LTa +80AC [rs2239704], LTa +252AG [rs909253], FAS −670AG [rs1800682], and FASL −844TC [rs763110]), considering the white, black, and Pardo (brown) ethnicities of the São Paulo State.

Materials and Methods

Ethics

This study was approved by the Committee of Ethics in Research of the Heliopolis Hospital on 10/06/2008 (CEP no. 622; 637) and an informed consent was obtained from all patients enrolled.

Samples

Samples were collected by the Head and Neck Genome Project (GENCAPO), a collaborative consortium created in 2002 with more than 50 researchers from nine institutions in São Paulo State, Brazil, whose aim is to develop clinical, genetic, and epidemiological analysis of head and neck squamous cell carcinomas. In this study, 252 DNA samples were obtained and used for polymorphism genotyping, from patients treated at the Heliópolis Hospital, São Paulo, Brazil, during the period of January 2001 to December 2009. Selected patients had no history of cancer, alcohol or tobacco addiction, occupational diseases, immunodeficiencies, mental disorders, or neurological diseases. Inability to answer the questionnaire was an exclusion criterion.

Among the 252 analyzed individuals, age varied from 29 to 91 years, with a mean of 54 years (SD±11 years), 220 (87.3%) were men and 32 (12.7%) women. Ethnicity was determined by a patient auto-description, which was 146 (57.9%) white, 77 (30.6%) Pardos, and 29 (11.5%) blacks.

Genotyping

Genomic DNA was extracted from peripheral blood samples of 252 individuals as previously described (Miller et al., 1988). Genotypes were determined by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). PCR conditions were 25 μL reaction mixture containing 200 ng of genomic DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 200 μM of each deoxyribonucleoside 5′ triphosphates, 1.5 mM MgCl2, 1 U Taq DNA polymerase (Life Technologies, Inc.®, Rockville, MD), and 25 pmol of each primer. Cycling conditions were 5′ at 94°C, 35 cycles of 1′ at 94°C, 1′ at annealing temperature (Table 1), and 1′ at 72°C. PCR products were digested overnight with restriction endonucleases described in Table 1, following the manufacturer's recommendations (New England Biolabs®, Berverly, MA). Restriction fragments were resolved on a 1%–3% agarose gel.

Table 1.

Single-Nucleotide Polymorphism Primer Sequences

SNP S Primers Annealing temperature (°C) Restriction enzyme
IκBL −62 F F 5′ CACAGTTCACTTCCGTCCTCCAGC 3′a 58 PvuII
rs2071592   R 5′ CCTGTGTTTAAGAAGCTCGG 3′    
IκBL −262 F F 5′ CCTCTCTCTGCCAAGTTAGAGGAGGCGCG 3′a 58 AciI
rs3219184   R 5′ GGGCCGTCTGAAACCAGAAGACTGG 3′    
TNFa −238 F F 5′ CACTCCCCATCCTCCCTGGTC 3′ 61 AvaII
rs361525   R 5′ GGTCCTACACACAAATCAGT 3′    
TNFa −308 F F 5′ AGGCAATAGGTTTTGAGGGCCAT 3′ 58 NcoI
rs1000629   R 5′ TCCTCCCTGCTCCGATCCCG 3′    
LTa +80 R F 5′ GAGAGACAGGAAGGGAACAGAG 3′ 60 BseYI
rs2239704   R 5′ GTGCTTCGTGCTTTGGACTACCGCTC 3′a    
LTa +252 R F 5′ GAGAGACAGGAAGGGAACAGAG 3′ 60 NcoI
rs909253   R 5′ GTGCTTCGTGCTTTGGACTACCGCTC 3′a    
FAS −670 R F 5′ CTACCTAAGAGCTATCTACCGTTC 3′ 54 MvaI
rs1800682   R 5′ GGCTGTCCATGTTGTGGCTGC 3′    
FASL −844 F F 5′ CAGCTACTCAGGAGGCCAAG 3′ 62 BsrDI
rs763110   R 5′ GCTCTGAGGGGAGAGACCAT 3′    
Open in a new tab
a

Modified primer sequence to create restriction site.

S, sense; F, forward; R, reverse; TNFa, tumor necrosis factors alpha; LTa, lymphotoxin-alpha; SNP, single-nucleotide polymorphism.

Statistical analysis

Genotypic frequencies were tested for Hardy–Weinberg equilibrium (HWE). The χ2 and Fisher exact tests were used for population difference analysis and confirmation was obtained by the Lilliefors test (significance considered when p<0.05). The F-statistic model was used to evaluate genetic differentiation among subpopulations. Statistical calculations were performed using Epi Info® v3.4.3, 2007 and Statsoft Statistica® v7.0.61.0 software.

Results

Except for IκBL −262TC and LTa +80AC, all polymorphisms analyzed were at HWE in the Brazilian population. HWE calculations were also applied to each ethnic group separately, showing a result similar to the population as a whole. However, the Pardo group showed disequilibrium at the LTa +80AC polymorphism and IκBL −262TC was at disequilibrium in the black group (Table 2). The genetic distance coefficient (Fst), a measure of population differentiation based on genetic polymorphisms, is described in Table 2.

Table 2.

Hardy–Weinberg Equilibrium Analysis

 
 HWEa
  
 
 Whole population
 White
 Pardo
 Black
  
SNP χ2 p χ2 p χ2 p χ2 p Fst
IκBL −62AT 0.298 0.584 2.345 0.125 0.913 0.339 0.247 0.619 0.038
IκBL −262TC 24.652 ≤0.05 16.871 ≤0.05 1.546 0.213 20.000 ≤0.05 0.034
TNFa −238GA 0.001 0.973 0.677 0.410 0.417 0.233 0.106 0.743 0.009
TNFa −308GA 2.407 0.120 1.381 0.239 0.973 0.323 0.106 0.743 0.065
LTa +80AC 15.296 ≤0.05 9.024 ≤0.05 6.428 ≤0.05 0.960 0.327 0.008
LTa +252AG 2.063 0.150 2.544 0.110 0.372 0.541 0.464 0.495 <0.001
FAS −670AG 0.554 0.456 0.659 0.416 2.164 0.141 2.666 0.102 0.031
FASL −844TC 0.268 0.604 0.164 0.685 0.048 0.825 0.158 0.690 0.030
Open in a new tab
a

Equilibrium was assumed when p>0.05.

χ2, chi-square; p, significance value; Fst, genetic distance coefficient; HWE, Hardy–Weinberg equilibrium.

Homozygous variants −238AA and −308AA of the TNFa gene were rarely found in the general population, the −238AA genotype was found only once (0.4%) and the −308GA genotype was not observed at all. Frequencies of 1%–10% were observed for IκBL −262CC (6.8%) and LTa +252GG (6.1%) homozygous variants. Frequencies higher than 10% were found for IκBL −62TT (13.4%), LTa +80CC (23.5%), FAS −670GG (26.9%), and FASL −844CC (28.3%, Table 3) homozygous variants.

Table 3.

Genotypic Distribution

 
 Population
  
  
  
 
 General
 White
 Pardo
 Black
 White vs. Pardo
 Pardo vs. Black
 Black vs. White
SNP genotype No. f No. f No. f No. f p p p
IκBL −62AT
 AA 80 0.428 49 0.454 20 0.345 11 0.524 0.197 0.299 0.411
 AT 82 0.439 42 0.389 31 0.534 9 0.429      
 TT 25 0.134 17 0.157 7 0.121 1 0.048      
 N/a 65                    
IκBL −262TC
 TT 126 0.783 75 0.806 33 0.688 18 0.900 0.191 0.046a 0.217
 TC 24 0.149 12 0.129 12 0.250 0 —      
 CC 11 0.068 6 0.065 3 0.063 2 0.100      
 N/a 91                    
TNFa −238GA
 GG 203 0.871 119 0.869 63 0.875 21 0.875 0.356 0.833 0.616
 GA 29 0.124 18 0.131 8 0.111 3 0.125      
 AA 1 0.004 0 — 1 0.014 0 —      
 N/a 19                    
TNFa −308GA
 GG 190 0.815 112 0.818 57 0.792 21 0.875 0.651 0.280 0.362
 GA 43 0.185 25 0.182 15 0.208 3 0.125      
 AA 0 0.000 0 — 0 — 0 —      
 N/a 19                    
LTa +80AC
 AA 14 0.106 9 0.123 2 0.057 3 0.125 0.520 0.586 0.668
 AC 87 0.659 49 0.671 24 0.686 14 0.583      
 CC 31 0.235 15 0.205 9 0.257 7 0.292      
 N/a 120                    
LTa +252AG
 AA 104 0.491 68 0.548 29 0.460 7 0.280 0.257 0.231 0.006a
 AG 95 0.448 52 0.419 29 0.460 14 0.560      
 GG 13 0.061 4 0.032 5 0.079 4 0.160      
 N/a 40                    
FAS −670AG
 AA 44 0.208 29 0.236 10 0.159 5 0.192 0.473 0.041a 0.016a
 AG 111 0.524 66 0.537 37 0.587 8 0.308      
 GG 57 0.269 28 0.228 16 0.254 13 0.500      
 N/a 40                    
FASL −844TC
 TT 50 0.236 28 0.228 12 0.190 10 0.385 0.781 0.048a 0.096
 TC 102 0.481 59 0.480 30 0.476 13 0.500      
 CC 60 0.283 36 0.293 21 0.333 3 0.115      
 N/a 40                    
Open in a new tab
a

Significant genotypic differences.

N/a, not available, not included in statistical calculations; f, frequency; p, significance value.

Genotypic frequencies were also calculated for each ethnical group separately. Nonsignificant differences were observed for IκBL −62AT; white and black ethnicities showed a higher frequency of the −62AA genotype, whereas the Pardo group showed a higher frequency of the −62AT heterozygote variant. Additionally, the black group presented the lowest frequency of the −62TT variant. Polymorphism IκBL −262TC showed similar frequencies among all groups. Nonetheless, a statistically significant difference was observed between the Pardo and black groups (p=0.046), 90% of the blacks were of the −262TT genotype. This difference was not observed between the black and white groups (Table 3).

Polymorphisms TNFa −238GA, TNFa −308GA, and LTa +80AC showed no differences among the three groups (Table 3). In contrast LTa +252AG presented a significant difference between the black and white groups. White individuals showed 55% frequency of the +252AA genotype, as compared to 28% of blacks. In comparison, 16% of blacks presented the +252GG variant, which was detected in only 3% of whites (Table 3).

FAS −670AG genotypic frequencies were similar between individual groups and the general population. However, 50% of blacks presented the −670GG genotype, whereas 30% showed the −670AG genotype. The same genotypes were observed at 25% and 55% frequencies in white and Pardo populations. The different frequencies observed in blacks were statistically significant when compared to whites (p=0.016) and Pardos (p=0.041, Table 3).

FASL −844TC polymorphism showed significant differences between Pardos and blacks (p=0.048). This difference was not observed between the whites and blacks or between the whites and Pardos (Table 3).

Variants of IκBL −62AT, IκBL −262TC, TNFa −238GA, TNFa −308GA, LTa +80AC, and FASL −844TC were found at higher frequencies in the Pardo group. However, the variants LTa +252AG and FAS −670AG were more frequent in the black population (Table 4).

Table 4.

Allelic Frequencies According to Ethnicity

SNP allele White Pardo Black
IκBL −62AT
 A 0.648 0.612 0.738
 T 0.352 0.388 0.262
IκBL −262TC
 T 0.871 0.813 0.900
 C 0.129 0.188 0.100
TNFa −238GA
 G 0.934 0.931 0.938
 A 0.066 0.069 0.063
TNFa −308GA
 G 0.909 0.896 0.938
 A 0.091 0.104 0.063
LTa +80AC
 A 0.459 0.400 0.417
 C 0.541 0.600 0.583
LTa +252AG
 A 0.758 0.690 0.560
 G 0.242 0.310 0.440
FAS −670AG
 A 0.504 0.452 0.346
 G 0.496 0.548 0.654
FASL −844TC
 T 0.467 0.429 0.635
 C 0.533 0.571 0.365
Open in a new tab

Discussion

The genetic differences among the three Brazilian ethnicities were detected in this study. As expected, the white and black groups presented statistically significant genotypic differences. In addition, significant differences were observed between Pardos and blacks, but not between Pardos and whites. Our initial hypothesis was that the Pardo group was a link between the other two groups, basically an intermixed group composed of white and black background. However, our results suggest that the Pardo ethnicity, in addition, is most probably also derived from native Indian.

Our results showed a greater similarity between the Pardo and white groups than between Pardo and black groups, thus again suggesting the participation of the Indian population in the formation of the Pardo group. Another hypothesis to explain this observation would be that the first Brazilian native Indians were descendants of the Asian hunters, a group with genetic similarities with white Europeans (Ministério da Justiça, 2012). Cavalli-Sforza (1998) described an unexpected high amount of miscegenation in the Brazilian population and determined that physical traits are superficial and imprecise in the characterization of ethnical groups and genetic origin. The Fst values demonstrate that the genetic distance between the three populations is not statistically significant, with values <0.05, suggesting a high admixture of the three populations in question.

Other evidence suggested that 27% of Brazilian blacks did not descend from Africans as previously thought. The same study showed that 87% of the current Brazilian population has 10% genetic similarity with the African population (Pena and Bortolini, 2004). Moreover, the fact that IκBL −62AT, IκBL −262TC, TNFa −238GA, TNFa −308GA, LTa +80AC e FASL −844TC polymorphisms were found at greater rates in the Pardo group than in blacks and whites is also an evidence for an Indian contribution in the formation of the Pardo ethnicity.

HWE results showed that the population as a whole is not at equilibrium. HWE equilibrium depends directly on the lack of selection, random mating, and the large population size (Ridley, 2004). Our results suggest that the Brazilian population is under a miscegenation process at the current time, since some genotypes are not equally distributed. In addition, we conclude that the Pardo ethnicity derived from a complex mixture of ethnicities, including the native Indian population.

Acknowledgments

The GENCAPO group acknowledges the financial support from Fundação de Amparo à Pesquisa do Estado de São Paulo/FAPESP (Grants 04/12054-9), and Fundação de Amparo à Pesquisa do Estado do Espírito Santo (FAPES), and the researcher fellowships from Conselho Nacional de Pesquisas (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP; grants no. 04/12054-9), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Fundação de Amparo à Pesquisa do Estado do Espírito Santo (FAPES).

Author Disclosure Statement

No competing financial interests exist.

References

  1. Arend WP. Gabay C. Cytokines in the rheumatic diseases. Rheum Dis Clin North Am. 2004;30:41–67. doi: 10.1016/S0889-857X(03)00115-7. [DOI] [PubMed] [Google Scholar]
  2. Callegari-Jacques SM. Grattapaglia D. Salzano FM, et al. Historical genetics: spatiotemporal analysis of the formation of the Brazilian population. Am J Hum Biol. 2003;15:824–834. doi: 10.1002/ajhb.10217. [DOI] [PubMed] [Google Scholar]
  3. Castiblanco J. Anaya JM. The IkBL gene polymorphism influences risk of acquiring systemic lupus erythematosus and Sjögren's syndrome. Hum Immunol. 2008;69:45–51. doi: 10.1016/j.humimm.2007.11.008. [DOI] [PubMed] [Google Scholar]
  4. Cavalli-Sforza LL. The DNA revolution in population genetics. Trends Genet. 1998;14:60–65. doi: 10.1016/s0168-9525(97)01327-9. [DOI] [PubMed] [Google Scholar]
  5. Gan WQ. Man SF. Senthilselvan A. Sin DD. Association between chronic obstructive pulmonary disease and systemic inflammation: a systematic review and a meta-analysis. Thorax. 2004;59:574–580. doi: 10.1136/thx.2003.019588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med. 2005;352:1685–1695. doi: 10.1056/NEJMra043430. [DOI] [PubMed] [Google Scholar]
  7. Miller SA. Dykes DD. Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215. doi: 10.1093/nar/16.3.1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ministério da Justiça. Fundação nacional do Índio; 2012. [Aug 28;2012 ]. Índios do Brasil. [Google Scholar]
  9. Müllauer L. Gruber P. Sebinger D, et al. Mutations in apoptosis genes: a pathogenic factor for human disease. Mut Res. 2001;488:211–231. doi: 10.1016/s1383-5742(01)00057-6. [DOI] [PubMed] [Google Scholar]
  10. Nagatsu T. Sawada M. Inflammatory process in Parkinson's disease: role for cytokines. Curr Pharm Des. 2005;11:999–1016. doi: 10.2174/1381612053381620. [DOI] [PubMed] [Google Scholar]
  11. Pena SDJ. Bortolini MC. Pode a genética definir quem deve se beneficiar das cotas universitárias e demais ações afirmativas? Estud Av. 2004;9:359–366. [Google Scholar]
  12. Perry VH. The influence of systemic inflammation on inflammation in the brain: implications for chronic neurodegenerative disease. Brain Behav Immun. 2004;18:407–413. doi: 10.1016/j.bbi.2004.01.004. [DOI] [PubMed] [Google Scholar]
  13. Philip M. Rowley DA. Schreiber H. Inflammation as a tumor promoter in cancer induction. Semin Cancer Biol. 2004;14:433–439. doi: 10.1016/j.semcancer.2004.06.006. [DOI] [PubMed] [Google Scholar]
  14. Ridley M. Evolution. Blackwell Publishing Ltd.; Oxford: 2004. [Google Scholar]
  15. Ruddle NH. Homer R. The role of lymphotoxin in inflammation. Prog Allergy. 1988;40:162–182. [PubMed] [Google Scholar]
  16. Schwartsburd PM. Chronic inflammation as inductor of procancer microenvironment: pathogenesis of dysregulated feedback control. Cancer Metastasis Rev. 2003;22:95–102. doi: 10.1023/a:1022220219975. [DOI] [PubMed] [Google Scholar]
  17. Warren JS. Interleukins and tumor necrosis factor in inflammation. Crit Rev Clin Lab Sci. 1990;28:37–59. doi: 10.3109/10408369009105897. [DOI] [PubMed] [Google Scholar]
  18. Willerson JT. Ridker PM. Inflammation as a cardiovascular risk factor. Circulation. 2004;109:II2–II10. doi: 10.1161/01.CIR.0000129535.04194.38. [DOI] [PubMed] [Google Scholar]

Articles from Genetic Testing and Molecular Biomarkers are provided here courtesy of Mary Ann Liebert, Inc.

RESOURCES