Abstract
Long polar fimbriae (Lpf) are intestinal adhesins and important virulence factors of pathogenic Escherichia coli strains. We cloned and sequenced the lpf2-1 operon (lpf2ABCD) and its flanking regions of an intimin- and Shiga toxin-negative E. coli O157:H43 strain of bovine origin, and also sequenced the lpf2-1 operon of 6 additional atypical O157 bovine Escherichia coli strains of various serotypes. Nucleotide sequence comparison of these lpf operons showed sequence conservation as they contained only four polymorphic nucleotide positions. Investigation of these O157 strains as well as 13 Escherichia coli Reference Collection (ECOR) strains carrying the lpf2-1 allele revealed high degree of sequence conservation in the lpf2 flanking regions. The lpf2-1 allele is also present in a bovine Shiga toxin-producing E. coli STEC O136:H12 strain and in vitro adherence assays revealed that the absence of lpf2-1 in this strain did not affect its host cell-binding properties. Our data indicate that lpf2 loci is highly conserved in E. coli isolates, however, its role in adherence might be masked by other uncharacterized adhesins.
Keywords: Escherichia coli, O157:H43, atypical E. coli, pathogenic E. coli, long polar fimbriae, O136:H12
INTRODUCTION
Escherichia coli is an important member of the commensal intestinal microflora in mammals, but there are a large number of isolates, which have acquired a variety of virulence factors and are capable of causing serious diseases in humans and animals, including those classified as enterohemorrhagic E. coli (EHEC; Kaper et al., 2004). The frequent emergence of new isolates with new combinations of virulence genes is exemplified by the appearance of the strain responsible for the recent outbreak of hemolytic uremic syndrome (HUS) in Germany (Mellmann et al., 2011), and underlines the importance of the various possible lateral gene transfer mechanisms in the spread of virulence genes. Typical EHEC O157:H7/NM strains carry stx genes encoding Shiga-toxin and also harbour a pathogenicity island (PAI) known as the locus of enterocyte effacement (LEE), encoding the intimin adhesin, among other virulence factors (Kaper et al., 2004).
In addition to several extensively studied virulence factors carried by pathogenic E. coli, there are several additional factors such as the long polar fimbriae (Lpf), which represent a relatively recently described adhesin and virulence determinant in EHEC (Doughty et al., 2002). The exact mechanism by which Lpf contributes to the virulence of each pathogenic E. coli strain is currently under investigation, but there is well-documented evidence that Lpf promote adhesion of EHEC strains to the intestinal epithelium (Jordan et al., 2004; Fitzhenry et al., 2006; Torres et al., 2008) as well as Lpf interacts with extracellular matrix proteins (Farfan et al., 2011).
Initially, two genetic variants of Lpf (Lpf1 and Lpf2) were identified in E. coli. and with the availability of additional sequence data, more variants have been discovered, some of which show a degree of association with certain serotypes and/or pathogroups (Torres et al., 2009). All known lpf1 and lpf2 operons are encoded on genomic islands, termed O islands, integrated in specific chromosomal locations (Doughty et al., 2002). The Lpf variant encoded by the operon first named lpfAO113 (Ideses et al., 2005) and later termed as allele 1 of lpf2 (lpf2-1) (Torres et al., 2009) is the most prevalent genetic variant of Lpf according to our present knowledge, as it has been detected in several strains from various serotypes (Toma et al., 2004; Toma et al., 2006; Torres et al., 2009; Galli et al., 2010; Monaghan et al., 2011). In comparison, the integration site of the lpf2 operon is found between the genes coding for the L-glutamine:D-fructose-6-phosphate aminotransferase (glmS) and that of phosphate-binding periplasmic protein (pstS). Recently, seven E. coli strains of the O157 serogroup (including strain T22), isolated from healthy cattle and without key EHEC virulence factors were found to harbour the Lpf2 variant (Sváb & Tóth, 2012). Three isolates were from the serotype O157:H43 (Tóth et al., 2009), and some of these members have been in the focus of a recent study dealing with the evolution of the O157 serogroup (Iguchi et al., 2011).
In the current study we report the sequence of the lpf2 operon and its flanking regions in strain T22, a non-sorbitol-fermenting (NSF) O157:H43 with an atypical pathotype (stx-, eae), monitor the presence of the operon and its flanking regions in a collection of E. coli strains of various serotypes carrying the lpf2-1 allele, and investigate the possible function in adherence of Lpf2 of STEC O136:H12 in vitro, that does not possess intimin or other known adhesins found in bovine STEC strains.
MATERIAL AND METHODS
Bacterial strains
E. coli strains used in this study are listed in Table 1. The ECOR strains were provided by Mónika Kerényi (Department of Medical Microbiology and Immunology, Medical School, University of Pécs, Hungary). Strains were grown in lysogeny broth (LB), as well as on LB and bromothymol-blue agar plates. For isolation of genomic and cosmid DNA, strains were grown in tryptic soy broth (TSB).
Table 1.
List of strains used in this study and results of the PCR scanning of the flanking regions of the lpf2 operon.
| Strain | Serotype | Phylogenetic group | bgIG-phoU | phoU-pstB | pstB-pstA | pstA-pstC | pstC-pstS | pstS-lpfD | lpfA-glmS | glmS-glmU | glmU-atpC | Reference |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| T16 | O157:H43 | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| T22 | O157:H43 | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| T34 | O157:H43 | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| T49 | O157(rough):H9 | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| T50 | O157(rough):H37r | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| B47 | O157:NM | B1c | + | + | + | + | + | + | + | + | + | (Tóth et al., 2009) |
| B54 | O157(rough):H12 | Ac | −a | + | −a | + | + | + | + | + | + | (Tóth et al., 2009) |
| ECOR7 | O85:HN | A | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR23 | O86:H43 | A | + | + | −a | + | − | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR26 | O104:H21 | B1 | + | + | + | + | + | + | − | + | + | (Ochman & Selander, 1984) |
| ECOR30 | O113:H21 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR32 | O7:H21 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR33 | O7:H21 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR34 | O88:NM | B1 | + | + | − | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR36 | O79:H25 | D | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR57 | ON:NM | B2 | −b | −b | + | + | −b | −b | −b | −b | −b | (Ochman & Selander, 1984) |
| ECOR58 | O112:H8 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR67 | O4:H43 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR69 | ON:NM | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| ECOR72 | O144:H8 | B1 | + | + | + | + | + | + | + | + | + | (Ochman & Selander, 1984) |
| 187/06 (22) | O136:H12 | B2 | + | + | −a | + | + | + | + | + | + | this study |
| C600 | K12 | A | − | + | + | + | − | + | + | + | + | (Appleyard, 1954) |
These strains yielded consistently longer product with the given primer pair.
Strain ECOR57 yielded unspecific or weak products in all these reactions.
The phylogenetic group of these strains was determined in Sváb & Tóth, 2012.
Abbreviations:
HN: H antigen non-typeable
NM: non-motile
ON: O antigen non-typeable
Cosmid clone library construction
Genomic DNA was isolated from strain T22 with the phenol-chlorophorm method (Sambrook et al., 1982) after growing overnight in TSB. The preparation of the cosmid clone library was performed with pWEB-TNC Cosmid Cloning Kit (Epicentre, Madison, WI, USA) according to the manufacturer’s instructions, with the modification that instead of mechanical shearing, genomic DNA was subjected to a partial digestion with restriction endonuclease MboI (Fermentas, Vilnius, Lithuania). Altogether, 1000 transformant colonies were kept as cosmid library.
PCR screening for the presence of lpf2 flanking regions
The cosmid library was screened by PCR for the presence of lpf2. The primers and annealing temperatures used in the reactions are listed in Table 2. The strains listed in Table 1 were screened for the presence of flanking regions.
Table 2.
Primers used for the amplification of regions flanking the lpf2 operon.
| Primer | Sequence (5′->3′) | Genes amplified | Genbank number | Position amplified | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|---|
| bgIGfw | CCCAAGCGCTCCTGCGCTAAA | bgIG-phoU | CU928160.2 | 3977599–3978492 | 60 | this study |
| phoUrev | TCTGGAGTCGCTGGGCCGTC | this study | ||||
| phoUfw | CGATCACGCGCTTCGCCAGA | phoU-pstB | CU928160.2 | 3978707–3979162 | 59 | this study |
| pstBrev | GGTATCGCCATTCGCCCGGA | this study | ||||
| pstBfw | GGACGGCCCGATAAACGCCG | pstB-pstA | CU928160.2 | 3979526–3979912 | 60 | this study |
| pstArev | CAGCCGATCGCCAACCTGCC | this study | ||||
| pstAfw | AGCCAGAACAGGCCGAAGGC | pstA-pstC | CU928160.2 | 3980508–3980919 | 59 | this study |
| pstCrev | ATCGGCGGCATCATGCTGGG | this study | ||||
| pstCfw | ACCGTAGATCGGCACCAGCG | pstC-pstS | CU928160.2 | 3981370–3981924 | 58 | this study |
| pstSrev | CCAGAAAGGCGAAGATGCATGGC | this study | ||||
| pstSfw | CAGACAGCGGCGCGTCAGAG | pstS-lpfD | CU928160.2 | 3982472–3983233 | 58 | this study |
| lpfDrev | TGCTACCGAACCCAATACGGACAA | this study | ||||
| lpfAfw | TGTCGACAATTTCACCGACGAAGTG | lpfA-glmS | CU928160.2 | 3987849–3988769 | 58 | this study |
| glmSrev | GCTGCCGAGCCGTATTGAGCA | this study | ||||
| glmSfw | CGTGTGTCGCCCAGCGAGTA | glmS-glmU | CU928160.2 | 3989854–3990519 | 58 | this study |
| glmUrev | GGCGATGCGGAAATTGGCGA | this study | ||||
| glmUfw | AGCAGATCGCCGCCGTGAC | glmU-atpC | CU928160.2 | 3991436–3992119 | 59 | this study |
| atpCrev | ACGAAGCGCGAGCCATGGAA | this study | ||||
| lpfA F | ACCGCTATCGATGCTGAAGG | lpfB-lpfA | AY057066 | 678–1349 | 63 | (Ideses et al., 2005) |
| lpfB R | GCGCAACATCTTCGGGAATA | |||||
| lpfC F2 | CGCCGGGTTAGAAATAGATA | lpfD-lpfC | AY057066 | 3658–4421 | 63 | (Ideses et al., 2005) |
| lpfD R2 | TGCCTGGTTTATTTTTGACGTA | |||||
| lpfA_inside_fwa | TCGACAGTAAATTGTGAATC | Part of lpfA | AY057066 | 233–790 | 50 | this study |
| lpfA_inside_reva | GAAGCGTAATATTATAGGCG |
Primers used in RT-PCR for the detection of lpfA expression.
Reverse Transcription-coupled PCR on lpfA of E. coli T22
RNA was isolated from cells of a 48 h culture of E. coli strain T22 with RNEasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, with the modification that cells were collected with centrifugation at 13,000 ×g for 1 minute. After discarding the supernatant, the bacterial pellet was processed according to the manufacturers’ instructions. RNA samples were treated with Sigma DNase I Amplification Grade (Sigma-Aldrich, St. Louis, MO, USA). The DNase treated samples were used as templates for reverse transcription using Fermentas Maxima Reverse Transcriptase (Fermentas, Vilnius, Lithuania) according to the manufacturer’s protocol. The product of this reaction was used as template in a regular PCR with the primers defined in Table 2.
Sequencing
A cosmid carrying the whole lpf operon was identified. DNA was isolated with the Sigma GenElute BAC DNA kit (Sigma-Aldrich, St. Louis, MO, USA), and was sequenced at Baygen Institute (Szeged, Hungary) using the combination of Life Tech’s SOLiD 4, IonTorrent sequencing and the dideoxynucleotide methods. The products of the RT-PCR were also sequenced with the dideoxynucleotide method. Nucleotide sequence analysis and searches for open reading frames (ORFs) and homologous DNA sequences in the EMBL and GenBank database libraries were performed with the tools available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov), with Vector NTI and the CLC Bio DNA Workbench.
Construction of an lpfA2-1 deletion mutant of STEC O136:H12
To generate an lpfA2-1 deletion mutant of strain 187/06 (22), the lpfA2-1 gene was replaced by a gene encoding kanamycin resistance using the lambda red recombinase system (Datsenko & Wanner, 2000). The long oligonucleotide primers used for introducing the mutation were those described earlier (Doughty et al., 2002). Each primer included 20 bp of sequence homologous to the kanamycin resistance gene, and 40 bp of sequence homologous to regions flanking the lpfA2-1 gene. The kanamycin resistance gene was amplified from pKD4 by PCR. The purified PCR product (1 μg DNA) was electroporated into 187/06 (22) strain which had previously been transformed with the lambda red recombinase expression vector, pKM201. Following electroporation, transformants of 187/06 (22) were recovered at 30°C for 2 h in LB broth and plated onto LB agar with kanamycin for overnight growth at 37°C to induce the loss of pKM201. Kanamycin-resistant colonies were then confirmed by PCR for replacement of lpfA2-1. The lpfA2-1 deletion mutant of 187/06 (22) was complemented in trans by introduction of the entire lpf2 operon on pWSK:lpf (kindly provided by Dr. E. Hartland).
Bacterial adhesion
The potential adherence capacity of strain T22 was investigated on primary bovine kidney and testicle cells, which were kindly provided by Emília Szállás (Veterinary Diagnostic Directorate, National Food Chain Safety Office, Budapest, Hungary). The cells were grown to semi-confluency at 37°C in 5% CO2 in 24 well plates in Roswell Park Memorial Institute 1640 (RPMI 1640) medium without supplements. Prior to use, cells were washed once with PBS. Strain T22 was grown for 48 hours with shaking at 200 rpm, and the cell monolayers were incubated for 5 hours with ca. 1010 bacteria per well. The infected monolayers were washed two times with PBS, fixed with methanol and stained with Giemsa reagent and investigated by light microscopy.
The ability of E. coli O136:H12 lpfA2-1+ strain and its deletion mutant to adhere to Hep-2, Caco-2 and T84 cell lines was assessed as previously described (Doughty et al., 2002), with minor modifications. The cells were grown to semi-confluency at 37°C in 5% CO2 in 24 well plates (Falcon™ BD) in Dulbecco’s minimal essential medium (DMEM), DMEM/F12 (Gibco, Carlsbad, CA, USA) or MEM, depending of the cell line, with 10% or 20% (vol/vol) heat-inactivated fetal bovine serum, 2 mM L-glutamine, and 1% (vol/vol) of a mixture of antibiotics/antimycotics (Gibco). Before use, the cells were washed twice with phosphate-buffered saline (PBS, Gibco) and replenished with the corresponding medium with no supplements, as it was observed previously that mannose could inhibit Lpf mediated adherence (Farfan et al., 2011). The strains were grown static in LB broth overnight at 37°C, tissue culture cells were incubated with ca. 107 bacteria per well for 3 h at 37°C and 5% CO2. To quantify adherence, the infected monolayers were washed two times with PBS, and the adherent bacteria were recovered with 200 μl of 0.1% Triton X-100 in PBS and plated on LB agar plates containing the proper antibiotic. Data were expressed as the percentage of the bacterial inoculum recovered from triplicate wells and are the mean of at least two separate experiments. Statistical difference was expressed as the P value determined by a t test analysis. The in vitro competition assays were performed as described above except that cells were inoculated with 5 × 106 cells each of mutant and wild type bacteria (total number of bacteria/well 107 cells) and competition index (CI) was calculated.
Nucleotide sequence accession number
The sequences of the E. coli T22 lpf2 operon and its neighbouring regions have been deposited in the GenBank database under accession number AHZD01000104. The sequences of the lpf2 operons of E. coli O157 strains B47, B54, T16, T34, T49 and T50 (see Table 1) were deposited under accession numbers KC207119, KC207120, KC207121, KC207122, KC207123 and KC207124, respectively.
RESULTS AND DISCUSSION
Sequence characteristics of the lpf2 operon in the atypical bovine O157 strains
We cloned and sequenced a 15.3 kb region from the genome of E. coli O157:H43 strain T22, including the lpf2 operon. The sequence is deposited in GenBank under the accession number AHZD01000104. The schematic representation of the sequenced region is shown in Figure 1. According to our knowledge, this is the first time that the allelic variant lpf2-1 operon and its flanking regions were sequenced in a non-sorbitol fermenting (NSF) strain of the serotype O157:H43. The lpf2-1 operon itself has been detected earlier by PCR in other E. coli strains (Torres et al., 2009; Farfan et al., 2011).
Figure 1. Schematic representation of the genetic region from E. coli strain T22 containing lpf2.

The relative length of the arrows is proportional to the relative length of the genes. Arrows representing genes from the same functional cluster are filled with the same pattern. The pst cluster encodes a phosphate ABC transporter, phoU encodes a phosphate transport regulator, and the product of bgIG is a putative transcriptional regulator. The glm cluster encodes an N-acetyl glucosamine-1-phosphate uridyltransferase, and atpC encodes the epsilon subunit of ATP synthase.
In the lpf2-1 operons of T22 and six other atypical O157 strains, there are only 4 positions that show polymorphism (Figure S1, Supporting Material). One of them is a synonymous point mutation in the gene lpfC of strain T49, the others produce amino acid switches in the respective genes. The lpf2A gene is uniformly conserved in the investigated strains, and this is also true for the majority of the strains with whole genomes available in GenBank, an exception is the lpf2A gene of strain 55989 (Table 3), which contains an isoleucine instead of a leucine in position 116. The lpf2B has an alanine instead of serine in position 99 in all the atypical O157 strains as opposed to the strains from GenBank listed in Table 3.
Table 3.
Escherichia coli strains with whole genomes in GenBank containing continuous lpf2 operons with high homology to the lpf2-1 of strain T22.
| Strain | Serotype | Pathotype | SNPs in the Lpf operon | Genbank number | Reference |
|---|---|---|---|---|---|
| SE11 | commensal | 6 | AP009240.1 | (Oshima et al., 2008) | |
| 11128 | O111:NM | EHEC | 7 | AP010960.1 | (Ogura et al., 2009) |
| 55989 | EAEC | 8 | CU928145.2 | (Touchon et al., 2009) | |
| KO11 | commensal | 9 | CP002516.1 | unpublished, JGI Project ID: 4085738 | |
| W | commensal | 9 | CP002185.1 | (Archer et al., 2011) | |
| 11368 | O26:H11 | EHEC | 9 | AP010953.1 | (Ogura et al., 2009) |
| IAI1 | commensal | 10 | CU928160.2 | (Touchon et al., 2009) | |
| E24377A | ETEC | 11 | CP000800.1 | (Rasko et al., 2008) |
The lpf2C gene proved to be uniform in all the sequenced strains with the exception of T49, which has a cysteine in position 809 instead of tryptophane – the second polymorphism within the lpf operons of the atypical O157 strains. The majority of strains with sequenced genomes in Table 3 have identical lpfC to that of T22, however, three of them have polymorphisms in lpfC. Strain SE11 has a leucine in position 224 instead of an isoleucine, strain 11368 has a serine instead of a proline in position 739, and E24377A has a leucine instead of proline in position 122.
In the case of lpf2D gene, strain T22 has serine instead of alanine in position 341, this switch is shared with strains SE11, 55989 and 11368, and is the third polymorphism within the sequenced atypical strains. The fourth polymorphism can be observed in strains T49 and T50, which encode a leucine instead of a methionine in position 313. The nucleotide sequence comparison of the lpf genes of the atypical O157 bovine strains is shown in Figure S1.
The existence of these polymorphisms indicate a similar level of variation in the otherwise conserved lpf2 sequences. However, currently there is no data available on the potential or actual effect of these differences on the expression and/or function of Lpf2. The GC content of the sequenced lpf operons was 44%, while that of the flanking regions in T22 was 52%, close to the average GC content in the E. coli genome (McLean et al., 1998). This fact, together with the generally conserved sequence of lpf2 in strains of various sero-and pathotypes (Table 3) is in harmony with previous findings that lpf2 operon is located on a genomic island (Doughty et al., 2002).
Dissemination and characteristics of the flanking regions of lpf2
The results of the PCR scanning of previously characterized strains carrying allele lpf2-1 are listed in Table 1. The fact that the lpf2-1 operon is flanked by the same set of genes in the majority of the strains sequenced so far (Table 3) is further demonstrated by the results of our PCR scanning. This uniformity indicates that the site between the pstS and glmS genes served as an integration hotspot at some point during the evolution of these strains. The genetic analysis of this region was performed in an earlier study, in which the authors designed primers specific for the flanking regions, and investigated whether the site between pstS and glmS is intact or interrupted by the lpf2 operon (Toma et al., 2006). It must be noted however, that in the case of prototypic enteroaggregative strain E. coli (EAEC) strain 042 (O44:H18), a Tn21 transposon sequence is inserted between lpfA and glmS genes. This transposon element harbors transposases and genes encoding antibiotic resistance among other features (Chaudhuri et al., 2010). Interestingly, four out of five strains which have the closest homologues to the lpf2-1 operon of strain T22, are commensal isolates (Table 3).
Expression of Lpf2
The RT-PCR specific for the lpfA genes from T22 yielded positive results confirming transcription of Lpf2 in 48-hour cultures. In an earlier study with EHEC strain EDL933, one of the authors of the current manuscript found that the H-NS protein has a silencer role, while the regulatory protein Ler acts as an anti-silencer during the expression of Lpf1 (Torres et al., 2008). Our findings, as well as the lack of LEE (which includes the ler gene) in strain T22 suggest a different regulatory mechanism controlling Lpf2 expression relative to Lpf1.
Contribution of LpfA2-1 to adherence of STEC O136:H12 in vitro
The wide distribution of this particular allele of Lpf in pathogenic E. coli strains, especially in LEE-negative strains (Doughty et al., 2002) underlines its potential role as an important adhesin. There is both in vitro (Doughty et al., 2002; Newton et al., 2004; Torres et al., 2008; Farfan et al., 2011) and in vivo (Jordan et al., 2004) experimental evidence that Lpf enhances the adherence of intimin-positive and negative strains. Construction of an lpf2 mutant in strain T22 resulted more challenging than expected; therefore, we created an lpf2-1 mutant in STEC O136:H12 strain 187/06 (22), a bovine isolate that possesses the same lpf2-1 allele as strain T22 (data not shown) and flanked with the same genes (Table 3). The role of Lpf2 in adherence of strain 187/06 (22) was evaluated using different tissue cultured cells lines; however, no clear differences could be observed in the quantitative adherence assays between O136:H12 and its corresponding lpfA2-1 mutant. The strain 187/06 (22) did not show a significant reduction in the adherence neither to Hep-2 (P=0.10), nor to Caco-2 (P=0.42) cell lines when compared to its deletion mutant, but exhibited a significant reduction in adherence to T84 cell line (P<0.0002) (Figure 2). However, when competition adhesion assays were performed using the wild type and its corresponding lpfA2-1 deletion mutant, the mean CI (3.27 ± 1.35) was significantly greater than 1 (P=0.043). This finding, where the mutant strain is adhering more than the wild type suggested that the strain lacking Lpf might produce additional adhesion factors that provided a subtle advantage in the in vitro adherence assay.
Figure 2. Comparative chart of in vitro bacterial adhesion assays to Caco-2, Hep-2 and T84 cell lines.
The results are expressed as the percentage of cell-associated bacteria from the original inoculum [(final CFU/ml/initial CFU/ml) × 100] and are the means ± the standard error of at least two independent experiments in triplicate wells.
In the case of strain T22, no specific adhesion could be observed in bovine testicle and kidney cell cultures (data not shown), which is in harmony with the finding that strains possessing Lpf2 are not defective in expression, although further analysis is needed to define the role of this fimbriae or other adhesion factors in these subset of strains.
In summary, we cloned and sequenced for the first time the long polar fimbriae-encoding operon and its flanking regions in an atypical, NSF O157:H43 E. coli strain. The Lpf operon itself is nearly identical to those of several other pathogenic and non-pathogenic strains from various serotypes and pathogroups, and represents the genetic variant termed allele 1 of lpf2. The integration site of the operon also shows high similarity to that on the aforementioned strains. Characteristic flanking regions were also found in other O157 non H7 strains carrying the same operon. Given the experimental evidence for the role of Lpf in adherence of E. coli O157:H7 and other pathogenic E. coli strains, it is plausible to propose that the Lpf2-1 fimbriae are important factors mediating adherence of our bovine E. coli strains. However, we did not observe any difference in the adherence profile of STEC 187/06 (22). Based on recently published report, we speculate that in the absence of an adhesin such as Lpf, the strains synthesized alternate surface structure as a compensatory mechanism for colonization (Lloyd et al., 2012). Further, the complete regulatory mechanisms of lpf2 still need to be fully elucidated. Finally, the highly conserved sequence and integration site of the lpf2 operon suggests that lpf2 loci belongs to a conserved genomic island, and an interesting future task will be to elucidate the mechanism of genetic acquisition of this operon in pathogenic and commensal E. coli strains.
Supplementary Material
The yellow arrows indicate the ORFs of the individual lpf genes. Point mutations are marked in red. The sequences of the lpf2 operons were deposited under the following accession numbers: E. coli B47 (O157:NM) KC207119, E. coli B54 (O157:H12) KC207120, E. coli T16 (O157:H43) KC207121, E. coli T34 (O157:H9) KC207122, E. coli T49 (O157:H37) KC207123, E. coli T50 (O157:H43) KC207124
Acknowledgments
The support of the Hungarian Research Fund (OTKA, grant number K 81252) is acknowledged. This work was also partially supported by NIH/NIAID AI079154 to AGT. LG was supported by a fellowship from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET). The contents of this work are solely the responsibility of the authors and do not necessarily represent the official views of the NIAID or NIH.
References
- Appleyard RK. Segregation of New Lysogenic Types during Growth of a Doubly Lysogenic Strain Derived from Escherichia coli K12. Genetics. 1954;39:440–452. doi: 10.1093/genetics/39.4.440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Archer CT, Kim JF, Jeong H, Park JH, Vickers CE, Lee SY, Nielsen LK. The genome sequence of E. coli W (ATCC 9637): comparative genome analysis and an improved genome-scale reconstruction of E. coli. BMC Genomics. 2011;12:9. doi: 10.1186/1471-2164-12-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chaudhuri RR, Sebaihia M, Hobman JL, Webber MA, Leyton DL, Goldberg MD, Cunningham AF, Scott-Tucker A, Ferguson PR, Thomas CM, Frankel G, Tang CM, Dudley EG, Roberts IS, Rasko DA, Pallen MJ, Parkhill J, Nataro JP, Thomson NR, Henderson IR. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One. 2010;5:e8801. doi: 10.1371/journal.pone.0008801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000;97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doughty S, Sloan J, Bennett-Wood V, Robertson M, Robins-Browne RM, Hartland EL. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacement-negative strains of enterohemorrhagic Escherichia coli. Infect Immun. 2002;70:6761–6769. doi: 10.1128/IAI.70.12.6761-6769.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Farfan MJ, Cantero L, Vidal R, Botkin DJ, Torres AG. Long Polar Fimbriae of Enterohemorrhagic Escherichia coli O157:H7 Bind to Extracellular Matrix Proteins. Infect Immun. 2011;79:3744–3750. doi: 10.1128/IAI.05317-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fitzhenry R, Dahan S, Torres AG, Chong Y, Heuschkel R, Murch SH, Thomson M, Kaper JB, Frankel G, Phillips AD. Long polar fimbriae and tissue tropism in Escherichia coli O157:H7. Microbes Infect. 2006;8:1741–1749. doi: 10.1016/j.micinf.2006.02.012. [DOI] [PubMed] [Google Scholar]
- Galli L, Torres AG, Rivas M. Identification of the long polar fimbriae gene variants in the locus of enterocyte effacement-negative Shiga toxin-producing Escherichia coli strains isolated from humans and cattle in Argentina. FEMS Microbiol Lett. 2010;308:123–129. doi: 10.1111/j.1574-6968.2010.01996.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 2001;8:11–22. doi: 10.1093/dnares/8.1.11. [DOI] [PubMed] [Google Scholar]
- Ideses D, Biran D, Gophna U, Levy-Nissenbaum O, Ron EZ. The lpf operon of invasive Escherichia coli. Int J Med Microbiol. 2005;295:227–236. doi: 10.1016/j.ijmm.2005.04.009. [DOI] [PubMed] [Google Scholar]
- Iguchi A, Shirai H, Seto K, Ooka T, Ogura Y, Hayashi T, Osawa K, Osawa R. Wide Distribution of O157-Antigen Biosynthesis Gene Clusters in Escherichia coli. PLoS One. 2011;6:e23250. doi: 10.1371/journal.pone.0023250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jordan DM, Cornick N, Torres AG, Dean-Nystrom EA, Kaper JB, Moon HW. Long polar fimbriae contribute to colonization by Escherichia coli O157:H7 in vivo. Infect Immun. 2004;72:6168–6171. doi: 10.1128/IAI.72.10.6168-6171.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaper JB, Nataro JP, Mobley HL. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004;2:123–140. doi: 10.1038/nrmicro818. [DOI] [PubMed] [Google Scholar]
- Lloyd S, Ritchie J, Torres AG. Fimbriation and curliation in Escherichia coli O157:H7: A paradigm of intestinal and environmental colonization. Gut Microbes. 2012;3:272–6. doi: 10.4161/gmic.20661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McLean MJ, Wolfe KH, Devine KM. Base composition skews, replication orientation, and gene orientation in 12 prokaryote genomes. J Mol Evol. 1998;47:691–696. doi: 10.1007/pl00006428. [DOI] [PubMed] [Google Scholar]
- Mellmann A, Harmsen D, Cummings CA, Zentz EB, Leopold SR, Rico A, Prior K, Szczepanowski R, Ji Y, Zhang W, McLaughlin SF, Henkhaus JK, Leopold B, Bielaszewska M, Prager R, Brzoska PM, Moore RL, Guenther S, Rothberg JM, Karch H. Prospective genomic characterization of the German enterohemorrhagic Escherichia coli O104:H4 outbreak by rapid next generation sequencing technology. PLoS One. 2011;6:e22751. doi: 10.1371/journal.pone.0022751. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Monaghan A, Byrne B, Fanning S, Sweeney T, McDowell D, Bolton DJ. Serotypes and Virulence Profiles of non-O157 Shiga-Toxin Producing Escherichia coli (STEC) from Bovine farms. Appl Environ Microbiol. 2011;77:8662–8668. doi: 10.1128/AEM.06190-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Newton HJ, Sloan J, Bennett-Wood V, Adams LM, Robins-Browne RM, Hartland EL. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect Immun. 2004;72:1230–1239. doi: 10.1128/IAI.72.3.1230-1239.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ochman H, Selander RK. Standard reference strains of Escherichia coli from natural populations. J Bacteriol. 1984;157:690–693. doi: 10.1128/jb.157.2.690-693.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogura Y, Ooka T, Iguchi A, Toh H, Asadulghani M, Oshima K, Kodama T, Abe H, Nakayama K, Kurokawa K, Tobe T, Hattori M, Hayashi T. Comparative genomics reveal the mechanism of the parallel evolution of O157 and non-O157 enterohemorrhagic Escherichia coli. Proc Natl Acad Sci U S A. 2009;106:17939–17944. doi: 10.1073/pnas.0903585106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Oshima K, Toh H, Ogura Y, Sasamoto H, Morita H, Park S, Ooka T, Iyoda S, Taylor TD, Hayashi T, Itoh K, Hattori M. Complete genome sequence and comparative analysis of the wild-type commensal Escherichia coli strain SE11 isolated from a healthy adult. DNA Res. 2008;15:375–386. doi: 10.1093/dnares/dsn026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rasko DA, Rosovitz MJ, Myers GSA, Mongodin EF, Fricke WF, Gajer P, Crabtree J, Sebaihia M, Thomson NR, Chaudhuri R, Henderson IR, Sperandio V, Ravel J. The pangenome structure of Escherichia coli: comparative genomic analysis of E. coli commensal and pathogenic isolates. J Bacteriol. 2008;190:6881–6893. doi: 10.1128/JB.00619-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; New York: 1982. [Google Scholar]
- Sváb D, Tóth I. Allelic types of long polar fimbriae in human and bovine Escherichia coli O157 strains. Acta Vet Hung. 2012;60:1–15. doi: 10.1556/AVet.2012.001. [DOI] [PubMed] [Google Scholar]
- Toma C, Higa N, Iyoda S, Rivas M, Iwanaga M. The long polar fimbriae genes identified in Shiga toxin-producing Escherichia coli are present in other diarrheagenic E. coli and in the standard E. coli collection of reference (ECOR) strains. Res Microbiol. 2006;157:153–161. doi: 10.1016/j.resmic.2005.06.009. [DOI] [PubMed] [Google Scholar]
- Toma C, Martínez Espinosa E, Song T, Miliwebsky E, Chinen I, Iyoda S, Iwanaga M, Rivas M. Distribution of Putative Adhesins in Different Seropathotypes of Shiga Toxin-Producing Escherichia coli. J Clin Microb. 2004;42:4937–4946. doi: 10.1128/JCM.42.11.4937-4946.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Torres AG, Blanco M, Valenzuela P, Slater TM, Patel SD, Dahbi G, López C, Barriga XF, Blanco JE, Gomes TAT, Vidal R, Blanco J. Genes related to long polar fimbriae of pathogenic Escherichia coli strains as reliable markers to identify virulent isolates. J Clin Microbiol. 2009;47:2442–2451. doi: 10.1128/JCM.00566-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Torres AG, Slater TM, Patel SD, Popov VL, Arenas-Hernández MMP. Contribution of the Ler- and H-NS-regulated long polar fimbriae of Escherichia coli O157:H7 during binding to tissue-cultured cells. Infect Immun. 2008;76:5062–5071. doi: 10.1128/IAI.00654-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Touchon M, Hoede C, Tenaillon O, Barbe V, Baeriswyl S, Bidet P, Bingen E, Bonacorsi S, Bouchier C, Bouvet O, Calteau A, Chiapello H, Clermont O, Cruveiller S, Danchin A, Diard M, Dossat C, Karoui ME, Frapy E, Garry L, Ghigo JM, Gilles AM, Johnson J, Le Bouguénec C, Lescat M, Mangenot S, Martinez-Jéhanne V, Matic I, Nassif X, Oztas S, Petit MA, Pichon C, Rouy Z, Ruf CS, Schneider D, Tourret J, Vacherie B, Vallenet D, Médigue C, Rocha EPC, Denamur E. Organised genome dynamics in the Escherichia coli species results in highly diverse adaptive paths. PLoS Genet. 2009;5:e1000344. doi: 10.1371/journal.pgen.1000344. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tóth I, Schmidt H, Kardos G, Lancz Z, Creuzburg K, Damjanova I, Pászti J, Beutin L, Nagy B. Virulence genes and molecular typing of different groups of Escherichia coli O157 strains in cattle. Appl Environ Microbiol. 2009;75:6282–6291. doi: 10.1128/AEM.00873-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
The yellow arrows indicate the ORFs of the individual lpf genes. Point mutations are marked in red. The sequences of the lpf2 operons were deposited under the following accession numbers: E. coli B47 (O157:NM) KC207119, E. coli B54 (O157:H12) KC207120, E. coli T16 (O157:H43) KC207121, E. coli T34 (O157:H9) KC207122, E. coli T49 (O157:H37) KC207123, E. coli T50 (O157:H43) KC207124

