Skip to main content
NCBI home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2013 Nov 12.
Published in final edited form as: J Affect Disord. 2012 Jul 25;145(1):10.1016/j.jad.2012.05.032. doi: 10.1016/j.jad.2012.05.032

Interaction between specific forms of childhood maltreatment and the serotonin transporter gene (5-HTT) in recurrent depressive disorder

Helen L Fisher a,*, Sarah Cohen-Woods a, Georgina M Hosang a, Ania Korszun b, Mike Owen c, Nick Craddock c, Ian W Craig a, Anne E Farmer a, Peter McGuffin a, Rudolf Uher a
PMCID: PMC3825663  EMSID: EMS55429  PMID: 22840631

Abstract

Background

There is inconsistent evidence of interaction between stressful events and a serotonin transporter promoter polymorphism (5-HTTLPR) in depression. Recent studies have indicated that the moderating effect of 5-HTTLPR may be strongest when adverse experiences have occurred in childhood and the depressive symptoms persist over time. However, it is unknown whether this gene-environment interaction is present for recurrent depressive disorder and different forms of maltreatment. Therefore, patients with recurrent clinically diagnosed depression and controls screened for absence of depression were utilised to examine the moderating effect of 5-HTTLPR on associations between specific forms of childhood adversity and recurrent depression.

Method

A sample of 227 recurrent unipolar depression cases and 228 never psychiatrically ill controls completed the Childhood Trauma Questionnaire to assess exposure to sexual, physical and emotional abuse, physical and emotional neglect in childhood. DNA extracted from blood or cheek swabs was genotyped for the short (s) and long (l) alleles of 5-HTTLPR.

Results

All forms of childhood maltreatment were reported as more severe by cases than controls. There was no direct association between 5-HTTLPR and depression. Significant interactions with additive and recessive 5-HTTLPR genetic models were found for overall severity of maltreatment, sexual abuse and to a lesser degree for physical neglect, but not other maltreatment types.

Limitations

The cross-sectional design limits causal inference. Retrospective report of childhood adversity may have reduced the accuracy of the findings.

Conclusions

This study provides support for the role of interplay between 5-HTTLPR and a specific early environmental risk in recurrent depressive disorder.

Keywords: Childhood maltreatment, unipolar depression, recurrent, serotonin transporter gene, gene-environment interaction, 5-HTTLPR

Introduction

The potential aetiological role of an interaction between stressful experiences and a functional insertion/deletion polymorphism in the promoter region of the serotonin transporter gene (5-HTTTLR) in depression has sparked a great deal of debate and an array of inconsistent findings (Caspi et al., 2010; Munafò et al., 2009; Risch et al., 2009; Uher and McGuffin, 2010). However, stressful events occurring in childhood have been shown more consistently than those limited to adulthood to interact with the 5-HTTLPR to predict the presence of depression (Brown and Harris, 2008; Karg et al., 2011; Uher and McGuffin, 2008, 2010). This makes more biological sense as serotonin is thought to impact upon the neural circuits underlying affective regulation which mature during childhood and adolescence (Kobiella et al., 2011; Lenroot and Giedd, 2006). Therefore, these networks are likely to be more vulnerable to disruption from stressful events early in life (Sibille and Lewis, 2006).

Furthermore, interactions between early adversity and the 5-HTTLPR have been hypothesised to be stronger amongst individuals suffering from chronic or recurrent clinical depression (Brown and Harris, 2008) as a stronger direct effect has been found between childhood maltreatment and persistence rather than onset of depression (Brown et al., 1994; Brown et al., 2008; Brown & Moran, 1994). Indeed, recent studies have supported this proposition. Uher et al. (2011) reported a significant interaction between childhood maltreatment and the 5-HTTLPR in predicting persistent depression but not single depressive episodes using two different longitudinal cohorts. This study was unable though to determine whether persistent depression involved chronic and/or recurrent episodes. Subsequently, the 5-HTTLPR has been shown to moderate the association between adverse childhood experiences and any chronic episode of depression (Brown et al., under review). However, it remains unknown whether this gene-environment interaction is also involved in recurrent depression. Moreover, whereas these two studies did not differentiate between types of maltreatment, previous findings for sub-clinical depressive symptoms (Aguilera et al., 2009; Cicchetti et al., 2007) suggest that interactions with the 5-HTTLPR may be stronger for childhood sexual abuse than other forms of childhood adversity.

Therefore, we sought to investigate the interaction between specific forms of childhood maltreatment and the 5-HTTLPR, utilising a well-characterised sample of individuals who had experienced at least two episodes of moderate to severe unipolar depression and controls purposely selected for having no personal or family history of psychiatric disorder. To ensure complete transparency, we also analysed all three genetic models (additive, dominant and recessive) in interaction with each form of maltreatment as there is no consensus concerning whether one or two 5-HTTLPR short alleles confer risk or indeed if there is a cumulative impact (Uher and McGuffin, 2008). We hypothesised that the short allele of the 5-HTTLPR would moderate the effect of childhood maltreatment in predicting recurrent depression and that this interaction would be stronger for sexual abuse than other maltreatment types.

Method

Participants

Individuals with recurrent unipolar depression and healthy controls were drawn from the Cardiff and London sites of the Depression Case-Control (DeCC) multi-centre study (see Cohen-Woods et al., 2009). This study was approved by the local University and NHS Ethics Committees at each site and all participants provided written informed consent.

All participants were Caucasian, with parents and grandparents of white European origin, and aged 18 years or over. Patients were identified through psychiatric clinics, hospitals, general medical practitioner surgeries, and media advertisements. Patients must have experienced at least 2 episodes of unipolar depression of at least moderate severity and separated by 2 or more months of remission, as defined by DSM-IV (American Psychiatric Association, 1994) and/or ICD-10 (World Health Organisation, 1993). Exclusion criteria were history of mania or hypomania, mood-incongruent psychosis, and a first or second-degree relative with bipolar or psychotic disorder. Controls were recruited through UK general medical practices and excluded if they had a personal or first-degree relative with a history of any psychiatric disorder.

Measures

Diagnosis

Cases were interviewed in person using the Schedules for Clinical Assessment in Neuropsychiatry (SCAN; Wing et al., 1990). SCAN items were rated for the 4-6 week period of peak intensity within the two most severe episodes of depression. The CATEGO5 scoring program provided DSM-IV or ICD-10 diagnoses.

Childhood maltreatment

Self-reported emotional (EA), physical (PA), sexual (SA) abuse, emotional (EN) and physical (PN) neglect during childhood were recorded using the Childhood Trauma Questionnaire (CTQ; Bernstein et al., 2003). The CTQ is widely used in clinical and general population samples and has good psychometric properties (Bernstein et al., 2003; Scher et al., 2004). Subscale scores were coded as none (0), mild (1), moderate (2) and severe (3) in accordance with the manual (Bernstein et al., 2003). An overall maltreatment score was also derived using a rounded average of the scores of all five subtypes. Prior to analysis the moderate (2) and severe (3) categories for each maltreatment type were combined due to the small numbers of participants in the latter category for some forms of maltreatment.

Current mood

Cases and controls completed the Beck Depression Inventory Second Edition (BDI-II; Beck et al., 1996) to ascertain their mood state at the time of completing the CTQ. A total score was obtained by summing all of the items, with higher scores indicating greater severity of depression. Controls that scored 10 or more on the BDI-II were excluded. Cases scoring 29 or more were classified as severely depressed (Beck et al., 1996).

Genotyping

A 25ml sample of whole blood was collected from cases at the time of interview and six cheek swabs were obtained from controls by mail. Polymerase chain reaction (PCR) was performed on the samples to amplify a 419 base-pair product for the l-allele (16-repeat) and a 375 base-pair product for the s-allele (14-repeat) of the 5-HTTLPR (Gelernter et al., 1997). The primer sequences were ATGCCAGCACCTAACCCCTAATGT (forward) and GGACCGCAAGGTGGGCGGGA (reverse). The products were run on 2.5-3% agarose gel at 100mV for one hour. In excess of 100 randomly selected samples were re-genotyped with an extremely low genotyping error rate being observed (0.26%); such individuals were excluded from further analyses. Genotyping was conducted blind to depression status and childhood maltreatment history and the 5-HTTLPR genotypes (l/l [2 long alleles]: 33%; s/l [1 short and 1 long allele]: 48%; s/s [2 short alleles]: 19%) were in Hardy-Weinberg equilibrium (X2=0.192, p=0.662).

Analysis

Analyses were conducted using Stata version 11.0. Cuzick’s non-parametric trend test was employed to investigate the effect of genotype (l/l, s/l, s/s) on depression case status and maltreatment severity. The main effects and interaction between childhood maltreatment and 5-HTTLPR on the presence/absence of recurrent unipolar depression was examined using a generalised linear model with the binomial distribution and identity link function specified (Wacholder, 1986) to estimate risk differences (RD) and 95% confidence intervals (CI). These analyses were adjusted for gender. All three possible genetic models were tested – additive (0=l/l, 1=s/1, 2=s/s), dominant (0=l/l, 1=s/l or s/s) and recessive (0=l/l or s/l, 1= s/s).

Results

Data were available on 227 recurrent unipolar depression cases and 228 screened controls. The majority of cases were women (n=163, 71.8%), their mean age at interview was 45.4 years (SD=12.7; 20-82 years), and they had an average onset of depression at 23.2 years (SD=11.0). Controls also tended to be women (n=137, 60.1%) and their mean age at interview was 47.2 years (SD=9.1; 25-62 years).

There was no difference in the distribution of genotypes between depressed cases and controls (z=−0.15, p=0.880) and no main effects of the 5-HTTLPR genetic models on recurrent depression (additive: Adj.RD=−0.011, 95% CI −0.75-0.054, p=0.749; recessive: Adj.RD=−0.112, 95% CI −0.228-0.003, p=0.056; dominant: Adj.RD=0.055, 95% CI −0.42-0.151, p=0.267). There was also no significant difference in the overall severity of maltreatment reported by genotype amongst cases (z=1.41, p=0.158) or controls (z=0.08, p=0.935).

Table 1 presents the main effects of each form of maltreatment and their interactions with 5-HTTLPR on presence of recurrent unipolar depression. All forms of childhood maltreatment were significantly associated with greater risk of recurrent depression even after adjustment for gender. These differences remained when the unipolar cases with severe levels of depression at the time of reporting (BDI-II score >=29: n=72, 31.7%) were excluded (overall: Adj.RD=0.271, 95% CI 0.206-0.336, p<0.001; EA: Adj.RD=0.251, 95% CI 0.194-0.307, p<0.001; PA: Adj.RD=0.136, 95% CI 0.040-0.231, p=0.005; SA: Adj.RD=0.105, 95% CI 0.025-0.185, p=0.010; EN: Adj.RD=0.187, 95% CI 0.126-0.249, p<0.001; PN: Adj.RD=0.264, 95% CI 0.205-0.323, p<0.001) suggesting that current mood did not substantially bias reports of childhood maltreatment. The proportion of participants with recurrent depression for each level of childhood maltreatment severity by 5-HTTLPR genotype is visually displayed in Figure 1. Significant interactions were found for overall maltreatment severity, sexual abuse and physical neglect with both additive and recessive 5-HTTLPR genetic models. However, only interactions with sexual abuse remained significant when a Bonferroni correction for multiple testing was applied (p=0.05/18=0.003). No interactions were demonstrated for the other forms of maltreatment.

Table 1. Main effect of different forms of childhood maltreatment and their interactions with each 5-HTTLPR genetic model on presence of recurrent unipolar depression.

Type of maltreatment Depressed

cases		 Unaffected

controls		 Adjusted

RDa 		95% CI p
n (%) n (%) Lower Upper
Overall Maltreatment (OM) 0.273 0.227 0.319 <0.001
  None 94 (41.4) 191 (83.8)
  Mild 87 (38.3) 30 (13.2)
  Moderate/severe 46 (20.3) 7 (3.0)
 Additive model × OM 0.072 0.024 0.120 0.003
 Recessive model × OM 0.098 0.022 0.175 0.012
 Dominant model × OM 0.053 −0.058 0.164 0.347
Emotional Abuse (EA) 0.247 0.202 0.292 <0.001
  None 99 (43.6) 192 (84.2)
  Mild 47 (20.7) 21 (9.2)
  Moderate/severe 81 (35.7) 15 (6.6)
 Additive model × EA 0.034 −0.031 0.098 0.305
 Recessive model × EA 0.023 −0.102 0.149 0.714
 Dominant model × EA 0.070 −0.032 0.172 0.180
Physical Abuse (PA) 0.180 0.117 0.242 <0.001
  None 174 (76.7) 213 (93.4)
  Mild 23 (10.1) 7 (3.1)
  Moderate/severe 30 (13.2) 8 (3.5)
 Additive model × PA 0.049 −0.029 0.128 0.220
 Recessive model × PA 0.083 −0.062 0.228 0.263
 Dominant model × PA 0.090 −0.051 0.231 0.211
Sexual Abuse (SA) 0.134 0.073 0.195 <0.001
  None 171 (75.3) 205 (89.9)
  Mild 13 (5.7) 8 (3.5)
  Moderate/severe 43 (19.0) 15 (6.6)
 Additive model × SA 0.119 0.063 0.175 <0.001
 Recessive model × SA 0.218 0.130 0.306 <0.001
 Dominant model × SA 0.091 −0.041 0.224 0.117
Emotional Neglect (EN) 0.219 0.170 0.268 <0.001
  None 85 (37.4) 148 (64.9)
  Mild 58 (25.6) 61 (26.8)
  Moderate/severe 84 (37.0) 19 (8.3)
 Additive model × EN −0.012 −0.082 0.058 0.729
 Recessive model × EN −0.036 −0.169 0.097 0.594
 Dominant model × EN −0.005 −0.111 0.100 0.919
Physical Neglect (PN) 0.256 0.209 0.303 <0.001
  None 88 (38.8) 184 (80.7)
  Mild 84 (37.0) 30 (13.2)
  Moderate/severe 55 (24.2) 14 (6.1)
 Additive model × PN 0.052 0.001 0.103 0.049
 Recessive model × PN 0.102 0.001 0.203 0.048
 Dominant model × PN 0.030 −0.073 0.134 0.566
Open in a new tab
a

Adjusted for gender. 5-HTTLPR, polymorphism in promoter region of serotonin transporter gene. CI, confidence interval. p, probability of result being due to chance. RD, risk difference.

Fig. 1. Proportion of individuals with recurrent depression by severity of different types of childhood maltreatment and serotonin transporter (5-HTTLPR) genotype.

Fig. 1

Open in a new tab

The y axis shows the probability of reporting recurrent depressive episodes by severity of childhood maltreatment and 5-HTTLPR genotype (LL, SL, and SS). Maltreatment severity is based on the Childhood Trauma Questionnaire (0 = None, 1 = Mild, 2 = Moderate or Severe), with a rounded average score of all domains for overall maltreatment (panel A), and individual domain scores for emotional abuse (panel B), physical abuse (panel C), sexual abuse (panel D), emotional neglect (panel E) and physical neglect (panel F). The number of individuals included in each subgroup is given above each bar.

Discussion

This sample of well-characterised individuals with recurrent unipolar depression and controls selected for lifetime absence of psychiatric disorder provided preliminary evidence of interaction between severity of childhood maltreatment and the 5-HTTLPR in relation to recurrent depression. Specifically, the strongest interactions were found between sexual abuse and 5-HTTLPR, under both additive and recessive genetic models. Weaker interactions were demonstrated for physical neglect but these did not remain statistically significant after correction for multiple testing. These findings extend previous reports of interactions between 5-HTTLPR and undifferentiated childhood maltreatment on persistent depression (Brown et al., under review; Uher et al., 2011).

Given that a previous analysis of this sample found no interactions between adult stressful life events and the 5-HTTLPR (Fisher et al., 2012), the current findings are also in keeping with the proposition that the 5-HTTLPR specifically moderates the effects of adversity that occurs in childhood (Karg et al., 2011; Uher and McGuffin, 2008, 2010). The greater aetiological importance of an early gene-environment interaction seems biologically plausible as the neural circuits involved in affective regulation, and that are impacted upon by the 5-HTTLPR, mature during childhood and adolescence (Kobiella et al., 2011; Lenroot and Giedd, 2006). Additionally, the specificity of the gene-environment interaction found is consistent with previous reports for depressive symptoms, which suggest a stronger interactive effect of sexual abuse and the 5-HTTLPR than for other forms of maltreatment (Aguilera et al., 2009; Cicchetti et al., 2007) and may point to excessively heightened stress levels following exposure to this type of maltreatment. Furthermore, the greater moderating effect of the s/s genotype, suggested by the significant additive and recessive 5-HTTLPR interactions, was also reported by Uher et al. (2011) in relation to persistent depression. However, it is also possible that exposure to stressful events in both childhood and adulthood may interact with the 5-HTTLPR to further increase the risk of experiencing recurrent depression. Unfortunately we did not have sufficient power in this sample to investigate this potential three-way interaction but it should be considered in future larger studies.

One limitation is the relatively small sample size which may have reduced our power to detect significant interactions for other forms of maltreatment. It is also possible that we did not find any other interactions due to exclusion of controls that had a first-degree relative with a psychiatric disorder. Parents with mental health problems are more likely to maltreat their children (Taylor et al., 1991) and thus our study design may have resulted in under-detection of the more commonly parent-perpetrated forms of maltreatment amongst controls and potentially reduced our power to detect significant interactions. Another limitation is that we relied on retrospective self-reports of depression and childhood maltreatment. However, severe depressive episodes are arguably the most memorable (Kendler et al., 1993) and self-report agrees well with contemporary hospital records (McGuffin et al., 1986). Furthermore, depressive symptoms do not result in exaggeration of retrospectively recalled stressful events (Brewin et al., 1993; Fisher et al., 2011) and when severely depressed cases were removed from our analysis the greater severity of childhood maltreatment in the depression group remained. Therefore, the use of retrospective self-reports is likely to have had only a minimal impact on these results.

Although patients in the current study were not systematically recruited, they are broadly comparable to more systematically collected series (Kessler et al., 1993) and it seems unlikely that cases with an unusually high severity of childhood maltreatment would have been recruited. We were also unable to include a group who had experienced only a single depressive episode and thus could not test whether the interaction between childhood maltreatment and 5-HTTLPR was stronger for recurrent versus single episode depression. There were also too few participants to stratify analysis by gender and this warrants future investigation as some previous studies on depression onset have reported interactions only amongst women (Eley et al., 2004; Hammen et al., 2010). Additionally, to be consistent with the prior studies of persistent depression we did not take into account the single nucleotide polymorphism (SNP) rs25531 within the repeats region of the 5-HTTLPR. As this SNP has a low minor allele frequency, excluding it is unlikely to have substantially affected our results. However, future studies might usefully take into account the functional second intron (STin2) SNP (Huezo-Diaz et al., 2009).

In conclusion, this study extended findings of interactions between childhood maltreatment and the 5-HTTLPR to clinically diagnosed recurrent depression and demonstrated a particularly strong interaction for sexual abuse. These results require replication in larger, similarly well-characterised samples, ideally with prospective assessments of maltreatment.

References

  1. Aguilera M, Arias B, Wichers M, Barrantes-Vidal N, Moya J, Villa H, van Os J, Ibanez MI, Ruiperez MA, Ortet G, Fananas L. Early adversity and 5-HTT/BDNF genes: new evidence of gene-environment interactions on depressive symptoms in a general population. Psychol. Med. 2009;39:1425–1432. doi: 10.1017/S0033291709005248. [DOI] [PubMed] [Google Scholar]
  2. American Psychiatric Association . Diagnostic and Statistical Manual of Mental Disorders 4th edition (DSM-IV) American Psychiatric Press; Washington DC: 1994. [Google Scholar]
  3. Beck AT, Steer RA, Brown GK. Beck Depression Inventory – Second Edition Manual. The Psychological Corporation; San Antonio, TX: 1996. [Google Scholar]
  4. Bernstein DP, Stein JA, Newcomb MD, Walker E, Pogge D, Ahluvalia T, Stokes J, Handelsman L, Medrano M, Desmond D, Zule W. Development and validation of a brief screening version of the Childhood Trauma Questionnaire. Child Abuse Negl. 2003;27:169–190. doi: 10.1016/s0145-2134(02)00541-0. [DOI] [PubMed] [Google Scholar]
  5. Brewin C, Andrews B, Gotlib IH. Psychopathology and early experience: a reappraisal of retrospective reports. Psychol. Bull. 1993;113:82–98. doi: 10.1037/0033-2909.113.1.82. [DOI] [PubMed] [Google Scholar]
  6. Brown GW, Ban M, Craig TKJ, Harris TO, Herbert J, Uher R. Serotonin transporter length polymorphism, childhood maltreatment and chronic depression: a gene-environment interaction. Depress Anxiety. 2013;30(1):5–13. doi: 10.1002/da.21982. [DOI] [PubMed] [Google Scholar]
  7. Brown GW, Craig TK, Harris TO. Parental maltreatment and proximal risk factors using the Childhood Experience of Care & Abuse (CECA) instrument: a life-course study of adult chronic depression - 5. J Affect. Disord. 2008;110:222–233. doi: 10.1016/j.jad.2008.01.016. [DOI] [PubMed] [Google Scholar]
  8. Brown GW, Harris TO. Depression and the serotonin transporter 5-HTTLPR polymorphism: a review and a hypothesis concerning gene-environment interaction. J. Affect. Disord. 2008;111(1):1–12. doi: 10.1016/j.jad.2008.04.009. [DOI] [PubMed] [Google Scholar]
  9. Brown GW, Harris TO, Hepworth C, Robinson R. Clinical and psychosocial origins of chronic depressive episodes. 2: A patient enquiry. Br. J. Psychiatry. 1994;165:457–465. doi: 10.1192/bjp.165.4.457. [DOI] [PubMed] [Google Scholar]
  10. Brown GW, Moran P. Clinical and psychosocial origins of chronic depressive episodes. 1: a community survey. Br. J. Psychiatry. 1994;165:447–456. doi: 10.1192/bjp.165.4.447. [DOI] [PubMed] [Google Scholar]
  11. Caspi A, Hariri AR, Holmes A, Uher R, Moffitt TE. Genetic sensitivity to the environment: the case of the serotonin transporter gene and its implications for studying complex diseases and traits. Am. J. Psychiatry. 2010;167(5):509–527. doi: 10.1176/appi.ajp.2010.09101452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cicchetti D, Rogosch FA, Sturge-Apple ML. Interactions of child maltreatment and serotonin transporter and monoamine oxidase A polymorphisms: depressive symptomatology among adolescents from low socioeconomic status backgrounds. Dev. Psychopathol. 2007;19(4):1161–1180. doi: 10.1017/S0954579407000600. [DOI] [PubMed] [Google Scholar]
  13. Cohen-Woods S, Gaysina D, Craddock N, Farmer A, Gray J, Gunasinghe C, Hoda F, Jones L, Knight J, Korszun A, Owen MJ, Sterne A, Craig IW, McGuffin P. Depression Case Control (DeCC) Study fails to support involvement of the muscarinic acetylcholine receptor M2 (CHRM2) gene in recurrent major depressive disorder. Hum. Mol. Genet. 2009;18(8):1504–1509. doi: 10.1093/hmg/ddp051. [DOI] [PubMed] [Google Scholar]
  14. Eley TC, Sugden K, Corsico A, Gregory AM, Sham P, McGuffin P, Plomin R, Craig IW. Gene-environment interaction analysis of serotonin system markers with adolescent depression. Mol. Psychiatry. 2004;9:908–915. doi: 10.1038/sj.mp.4001546. [DOI] [PubMed] [Google Scholar]
  15. Fisher HL, Cohen-Woods S, Hosang G, Uher R, Powell-Smith G, Keers R, Tropeano M, Korszun A, Jones L, Jones I, Owen M, Craddock N, Craig IW, Farmer AE, McGuffin P. Exploration of the interaction between life events and the serotonin transporter gene (5-HTT) in recurrent depression. J. Affect. Disord. 2012;136:189–193. doi: 10.1016/j.jad.2011.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fisher HL, Craig TK, Fearon P, Morgan K, Dazzan P, Lappin J, Hutchinson G, Doody GA, Jones PB, McGuffin P, Murray RM, Leff J, Morgan C. Reliability and comparability of psychosis patients’ retrospective reports of childhood abuse. Schizophr. Bull. 2011;37(3):546–553. doi: 10.1093/schbul/sbp103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gelernter J, Kranzler H, Cubells JF. Serotonin transporter protein (SLC6A4) allele and haplotype frequencies and linkage disequilibria in African- and European-American and Japanese populations and in alcohol-dependent subjects. Hum. Genet. 1997;101(2):243–246. doi: 10.1007/s004390050624. [DOI] [PubMed] [Google Scholar]
  18. Gibb BE, McGeary JE, Beevers CG, Miller IW. Serotonin transporter (5-HTTLPR) genotype, childhood abuse, and suicide attempts in adult psychiatric inpatients. Suicide Life Threat. Behav. 2006;36:687–693. doi: 10.1521/suli.2006.36.6.687. [DOI] [PubMed] [Google Scholar]
  19. Hammen C, Brennan PA, Keenan-Miller D, Hazel NA, Najman JM. Chronic and acute stress, gender, and serotonin transporter gene-environment interactions predicting depression symptoms in youth. J. Child. Psychol. Psychiatry. 2010;51(2):180–187. doi: 10.1111/j.1469-7610.2009.02177.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huezo-Diaz P, Uher R, Smith R, Rietschel M, Henigsberg N, Marusic A, Mors O, Maier W, Hauser J, Souery D, Placentino A, Zobel A, Larsen ER, Czerski PM, Gupta B, Hoda F, Perroud N, Farmer A, Craig I, Aitchison KJ, McGuffin P. Moderation of antidepressant response by the serotonin transporter gene. Br. J. Psychiatry. 2009;195(1):30–38. doi: 10.1192/bjp.bp.108.062521. [DOI] [PubMed] [Google Scholar]
  21. Karg K, Shedden K, Burmeister M, Sen S. The serotonin transporter promoter variant (5-HTTLPR), stress, and depression meta-analysis revisited: evidence of genetic moderation. Arch. Gen. Psychiatry. 2011;68(5):444–454. doi: 10.1001/archgenpsychiatry.2010.189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kendler KS, Neale MC, Kessler RC, Heath AC, Eaves LJ. The lifetime history of major depression in women. Arch. Gen. Psychiatry. 1993;50:863–870. doi: 10.1001/archpsyc.1993.01820230054003. [DOI] [PubMed] [Google Scholar]
  23. Kessler RC, McGonagle KA, Swartz M, Blazer DG, Nelson CB. Sex and depression in the National Comorbidity Survey, I: lifetime prevalence, chronicity and recurrence. J. Affect. Disord. 1993;29:85–96. doi: 10.1016/0165-0327(93)90026-g. [DOI] [PubMed] [Google Scholar]
  24. Kobiella A, Reimold M, Ulshofer DE, Ikonomidou VN, Vollmert C, Vollstadt-Klein S, Rietshel M, Reischi G, Heinz A, Smolka MN. How the serotonin transporter 5-HTTLPR polymorphism influences amygdale function: the roles of in vivo serotonin transporter expression and amygdale structure. Transl. Psychiatry. 2011;1(8):e37. doi: 10.1038/tp.2011.29. doi: 10.1038/tp. 2011.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Lenroot RK, Giedd JN. Brain development in children and adolescents: insights from anatomical magnetic resonance imaging. Neurosci. Biobehav. Rev. 2006;30:718–729. doi: 10.1016/j.neubiorev.2006.06.001. [DOI] [PubMed] [Google Scholar]
  26. McGuffin P, Katz R, Aldrich J. Past and present state examination: the assessment of ‘lifetime ever’ psychopathology. Psychol. Med. 1986;16(2):461–465. doi: 10.1017/s0033291700009302. [DOI] [PubMed] [Google Scholar]
  27. Munafò MR, Durrant C, Lewis G, Flint J. Gene X environment interactions at the serotonin transporter locus. Biol. Psychiatry. 2009;65(3):211–219. doi: 10.1016/j.biopsych.2008.06.009. [DOI] [PubMed] [Google Scholar]
  28. Risch N, Herrell R, Lehner T, Liang KY, Eaves L, Hoh J, Griem A, Kovacs M, Ott J, Merikangas KR. Interaction between the serotonin transporter gene (5-HTTLPR), stressful life events, and risk of depression: a meta-analysis. JAMA. 2009;301(23):2462–2471. doi: 10.1001/jama.2009.878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Roy A, Hu XZ, Janal MN, Goldman D. Interaction between childhood trauma and serotonin transporter gene variation in suicide. Neuropsychopharmacology. 2007;32:2046–2052. doi: 10.1038/sj.npp.1301331. [DOI] [PubMed] [Google Scholar]
  30. Scher CD, Forde DR, McQuaid JR, Stein MB. Prevalence and demographic correlates of childhood maltreatment in an adult community sample. Child Abuse Negl. 2004;28:167–180. doi: 10.1016/j.chiabu.2003.09.012. [DOI] [PubMed] [Google Scholar]
  31. Sibille E, Lewis DA. SERT-ainly involved in depression, but when? Am. J. Psychiatry. 2006;163:8–10. doi: 10.1176/appi.ajp.163.1.8. [DOI] [PubMed] [Google Scholar]
  32. Taylor CG, Norman DK, Murphy JM, Jellinek M, Quinn D, Poitrast FG, Goshko M. Diagnosed intellectual and emotional impairment among parents who seriously mistreat their children: prevalence, type and outcome in a court sample. Child Abuse Negl. 1991;15:389–401. doi: 10.1016/0145-2134(91)90023-7. [DOI] [PubMed] [Google Scholar]
  33. Uher R, Caspi A, Houts R, Sugden K, Williams B, Poulton R, Moffitt T. Serotonin transporter gene moderates childhood maltreatment’s effects on persistent but not single-episode depression: Replications and implications for resolving inconsistent results. J. Affect. Disord. 2011;135(1-3):56–65. doi: 10.1016/j.jad.2011.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Uher R, McGuffin P. The moderation by the serotonin transporter gene of environmental adversity in the aetiology of mental illness: review and methodological analysis. Mol. Psychiatry. 2008;13(2):131–146. doi: 10.1038/sj.mp.4002067. [DOI] [PubMed] [Google Scholar]
  35. Uher R, McGuffin P. The moderation by the serotonin transporter gene of environmental adversity in the etiology of depression: 2009 update. Mol. Psychiatry. 2010;15(1):18–22. doi: 10.1038/mp.2009.123. [DOI] [PubMed] [Google Scholar]
  36. Wacholder S. Binomial regression in GLIM: estimating risk ratios and risk differences. Am. J. Epidemiol. 1986;123:174–184. doi: 10.1093/oxfordjournals.aje.a114212. [DOI] [PubMed] [Google Scholar]
  37. Wing JK, Babor T, Brugha T, Burke J, Cooper JE, Giel R, Jablenski A, Regier D, Sartorius N. SCAN. Schedules for Clinical Assessment in Neuropsychiatry. Arch. Gen. Psychiatry. 1990;47(6):589–593. doi: 10.1001/archpsyc.1990.01810180089012. [DOI] [PubMed] [Google Scholar]
  38. World Health Organisation . The ICD-10 Classification of Mental and Behavioural Disorders. Diagnostic Criteria for Research. World Health Organisation; Geneva, Switzerland: 1993. [Google Scholar]

RESOURCES