Skip to main content
PLOS One logoLink to PLOS One
. 2013 Nov 13;8(11):e78783. doi: 10.1371/journal.pone.0078783

Overexpression of EFEMP1 Correlates with Tumor Progression and Poor Prognosis in Human Ovarian Carcinoma

Jie Chen 1, Deying Wei 2,*, Yueran Zhao 4, Xiaoyan Liu 3, Jie Zhang 4,*
Editor: Viji Shridhar5
PMCID: PMC3827232  PMID: 24236050

Abstract

Objective

This study was to explore the role of EFEMP1 in ovarian tumor progression and its relationship with prognosis of ovarian carcinoma.

Methods

EFEMP1 mRNA and protein expressions in normal ovarian tissue, ovarian tumor, high invasive subclones and low invasive subclones were evaluated by immunohistochemistry and real time RT-PCR. Serum EFEMP1 levels in patients with ovarian tumor were measured by ELISA assay. To assess the angiogenic properties of EFEMP1, VEGF and tumor microvessel density were analyzed in ovarian carcinoma by immunohistochemistry.

Results

EFEMP1 expression was up-regulated in ovarian carcinoma, positively correlated with MVD and VEGF, and its overexpression and high serum levels were significantly associated with high stage, low differentiation, lymph node metastasis and poor prognosis of ovarian cancer. EFEMP1 expression was also found to be over-expressed in the highly invasive subclones compared with the low invasive subclones.

Conclusion

EFEMP1 is a newly identified gene over-expressed in ovarian cancer, associated with poor clinicopathologic features and promotes angiogenesis. This study shows that EFEMP1 may serve as a new prognostic factor and a therapeutic target for patients with ovarian cancer in the future.

Introduction

Ovarian cancer is one of the most aggressive and heterogeneous cancer types in women and one of the leading causes of gynaecological deaths [1], [2]. Its high mortality is attributable to the fact that the majority of ovarian cancer patients are diagnosed at advanced stages when conventional therapy is less effective [3]. Although substantial advances have been made in ovarian cancer research, the overall 5-year survival rate is still less than 30% [4]. Tumor recurrence and metastasis are considered the major reasons for poor clinical outcome and cancer deaths [5]. Therefore, studying the mechanism of tumor invasion and metastasis will provide further insights into the development and progression of ovarian cancer. In recent years, many biomarkers have been investigated which are involved in the progression of ovarian cancer [6]. But few studies have been done to assess the functions of EFEMP1 in ovarian cancer development.

EFEMP1 (epidermal growth factor–containing fibulin-like extracellular matrix protein 1, fibulin-3) is a member of the fibulin family of extracellular glycoproteins, which are characterized with a fibulin-type C-terminal domain preceded by tandem calciumbinding epidermal growth factor (EGF)-like modules [7]. Fibulins have been shown to modulate cell morphology, growth, adhesion and motility, closely related to a wide variety of cancer development [8]. Overexpressions of fibulin-1 in ovarian cancer and breast cancer have been found to demonstrate oncogenic activity, during these progressions estrogen play important roles [9][11]. However in the development of hepatocellular carcinoma, gastric cancer and prostate cancer, fibulin-1 demonstrated tumor-suppressive activity, suppressing tumor growth, enhancing cell apoptosis and inhibiting tumor angiogenesis [12][15]. As a tumor suppressor gene, Fibulin-2 inhibited tumor growth, invasion and angiogenesis in hepatocellular carcinoma and breast cancer [16], [17]. In the majority of the development of cancers, Fibulin-5 was widely considered to be associated with the suppression of tumor formation through its control of cell proliferation, motility and angiogenic sprouting [18][20].

Paradoxically, EFEMP1 (fibulin-3) can also demonstrate either tumor-suppressive or oncogenic behavior tied to tissue-specific expression. In the research of pancreatic adenocarcinoma, cervical cancer and glioma [21][24], increased expression of EFEMP1 has been reported; EFEMP1 plays a role in metastasis and development, and thus links it to poor prognosis. In contrast, a potential cancer-suppressing function of EFEMP1 was found in the study of nasopharyngeal carcinomas, sporadic breast cancer, glioblastoma multiforme, and non-small cell lung cancer (NSCLC), Fibulin-3 was associated with tumour progression and inhibited cell migration and invasion [25][28]. But till now, few researches have been made about the relationship between EFEMP1 and ovarian cancer.

The purpose of this study was to assess whether EFEMP1 expression was associated with the prognosis of ovarian cancer, and further to investigate the relation of EFEMP1 expression to angiogenesis.

Materials and Methods

Cell lines

The highly invasive subclones (S1, A1) and the low invasive subclones (S21, A19) were isolated from the human ovarian cancer cell lines SKOV3 and 3AO with the limited dilution method. Then, the cell electrophoretic mobility (EPM) of each clone was measured to study charge property using microcapillary electrophoresis (microCE) chips according to Omasu's methods [29]. Finally, MTT assay, Colony formation assay in soft agar, Matrigel invasion assay, Cell migration assay and Tumor xenografts in nude mice were made to confirm that they had high and low metastatic potentials respectively [30], [31]. Cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) and antibiotics (Gibco BRL, Rockville, MD).

Tissue Specimens

A total of 260 human ovarian tissue specimens were used for this study. Two hundred and twenty (220) epithelial ovarian tumors were obtained from the Department of Gynecology and Obstetrics, Shandong Provincial Hospital between 2005 and 2008. The ovarian tumor specimens included 60 benign ovarian tumors and 160 epithelial ovarian carcinomas (with 58 serous cystadenocarcinoma, 56 mucinous cystadenocarcinoma and 46 endometrioid carcinoma). All of the ovarian cancer patients were clinically staged according to the FIGO staging system [with 74 low stage tumors (FIGO stages I and II) and 86 high stage tumors (FIGO stages III and IV)]. None of the ovarian cancer patients received preoperative radiation or chemotherapy. Forty (40) normal ovary tissue specimens were obtained from the Department of Gynecology and Obstetrics, Shandong Provincial Hospital. The study was approved by the Institutional Medical Ethics Committee of Shandong University.

Blood samples

Blood samples were accordingly obtained with the written informed consent from the same 160 women with epithelial ovarian cancer (with 58 serous cystadenocarcinoma, 56 mucinous cystadenocarcinoma and 46 endometrioid carcinoma) and from the same 60 women with benign ovarian tumor at the Department of Gynecology and Obstetrics, Shandong Provincial Hospital between 2005 and 2008. None of the ovarian cancer patients received preoperative radiation or chemotherapy. Sixty control blood samples were obtained from age-matched examinees receiving health checks at Shandong Provincial Hospital and showing no history of disease and no abnormalities in laboratory examinations. The study was approved by the Institutional Medical Ethics Committee of Shandong University.

Enzyme-linked immunosorbent assay

Levels of EFEMP1 in serum samples were measured with sandwich enzyme-linked immunosorbent assay (ELISA) using human EFEMP1 ELISA assay kits (Immuno-Biological Laboratories, Japan). Serum was diluted with EIA buffer (1% BSA, 0.05% Tween 20 in phosphate buffer) and incubated for 2 hour at 37°C. After 4 washes with EIA buffer, horse radish peroxidase-conjugated antibodies were added and incubated for 30 minutes at 4°C. After 4 washes, 100 µL of tetramethyl benzidine solution was added and incubated for 30 minutes at room temperature. The reaction was stopped with 100 µL of 1 N sulfuric acid and measured by ELISA reader at 450 nm.

Immunohistochemistry (IHC)

According to standard streptavidin-biotin-peroxidase complex procedures, IHC was performed on formalin-fixed, paraffin-embedded sections (5 µm thick) and cell slides fixed in 4% paraformaldehyde. Briefly, after dewaxing, rehydration, and antigen retrieval, the sections were incubated with mouse anti-human EFEMP1 monoclonal antibody (sc-33722, Santa Cruz Biotechnology, Inc.) diluted 1∶50 in PBS. Human cervical cancer paraffin-embedded sections (EFEMP1 positive) were used as positive controls. A negative control was obtained by replacing the primary antibody with normal mouse immunoglobulin (IgG). Positive expression of EFEMP1 protein was defined as the presence of brown granules in the cytoplasm.

Immunohistochemistry (IHC) analysis

A semiquantitative scoring system based on intensity of staining and distribution of positive cells was used to evaluate EFEMP1 expression. The intensity of EFEMP1 positive staining ranged from 0 to 3 (negative = 0, weak = 1, moderate = 2, or strong = 3) and the percentage of positively stained cells was scored as 0 (0%), 1 (1 to 25%), 2 (26 to 50%), 3 (51 to 75%), and 4 (76 to 100%). The sum of the intensity and percentage score was used as the final staining score (0 to 7). The sum-indexes (−), (+), (++), and (+++) indicated final staining score of 0, 1–3, 4–5, and 6–7, respectively. For statistical analysis, sum-indexes (−) and (+) were defined as low EFEMP1 expression, while sum-indexes (++) and (+++) were defined as high EFEMP1 expression. Each section was independently scored by two pathologists. If an inconsistency occurred, a third pathologist was consulted to achieve consensus.

Microvessel assessment

The microvascular density (MVD) assessment was evaluated by CD34 immunohistochemical staining of tumor vessels. Any immune-positive single endothelial cell or endothelial cell clusters and microvessels in the tumor was considered to be an individual vessel and counted, as described by Weidner et al. [32]. Peritumoral vascularity, vascularity in areas of necrosis and vessels with thick muscle wall or in a diameter larger than eight erythrocytes, was excluded from the count. The sections were scanned at low power (100×) to select the most vascularized (hot-spots). The microvessels in the hot-spots were counted at power 400× magnifications, and an average count in three hot spots was calculated as MVD. All counts were made by three independent observers who had no knowledge of the corresponding clinicopathologic data.

Real-time quantitative RT-PCR (q-RT-PCR)

Total RNA was extracted using Trizol reagent (Invitrogen) and reversed transcribed. Quantitative real-time PCR analysis was performed using ABI PRISM 7500 Real-Time PCR System (Applied Biosystems). Each well (20 µl reaction volume) contained 10 µl Power SYBR Green PCR master mix (Applied Biosystems), 1 µl of each primer (5 µmol/l) and 1 ul template. The following primers were used:

EFEMP1 5′- ACCCTTCCCACCGTATCCA -3′

5′- TCTGCTCTACAGTTGTGCGTCC -3′

β-actin 5′-CCACGAAACTACCTTCAACTCCA-3′

5′-GTGATCTCCTTCTGCATCCTGTC-3′

Statistical analysis

IHC data were analyzed using chi-square test. Measurement data were expressed as the mean ± SE. For comparison of means between two groups, a two-tailed t-test was used and for comparison of means among three groups, one-way ANOVA were used. Survival curve was calculated using the Kaplan-Meier method and the log-rank test. Correlation between the expression of EFEMP1 and VEGF and MVD were analyzed with Pearson correlation coefficient. Statistical analysis was performed using SPSS software version 13.0. P-value<0.05 was considered statistically significant.

Results

Expressions of EFEMP1 in human ovarian tissues

To evaluate the mRNA and protein expressions of EFEMP1 in ovarian tissues, we detected 260 human ovarian tissue specimens, including 40 normal human ovaries, 60 benign ovarian tumors and 160 epithelial ovarian carcinomas by immunohistochemistry and real time RT-PCR. As shown in Figure 1 and 2, in normal human ovarian surface epithelial cells, EFEMP1 protein expression was very low (Fig. 1A and Fig. 2A), and in the ovarian stroma, EFEMP1 protein expression was mainly focused around the vasculatures (Fig. 1B and Fig. 2B). However in most ovarian carcinomas, the immunoreactivity was high, and high EFEMP1 protein expression was found in the cytoplasm of ovarian cancer cells (Fig. 1EFG and Fig. 2DEF). To determine the specificity of the antibody, the negative control and positive control was shown in figure 3. Moreover, high EFEMP1 protein expression was associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas (Table 1). Similarly results were also found in real time RT-PCR experiment, EFEMP1 mRNA expression was also very low in normal ovarian tissues and benign ovarian tumors, and significantly enhanced in ovarian carcinoma. Moreover, high EFEMP1 mRNA expression was also associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas (Table 2 and Figure 4A). To evaluate the prognostic value of EFEMP1 in ovarian cancer, we performed survival analysis using Kaplan-Meier analysis. The result showed that patients with high EFEMP1 expression had a much worse prognosis than those with low EFEMP1 expression (log rank, P<0.01; Figure 4B).

Figure 1. Expression of EFEMP1 in human ovarian tissues.

Figure 1

(A) The epithelial cells of normal human ovarian, (B) the stroma of normal human ovarian, (CD) Benign ovarian tumor, (E) High differentiation of ovarian carcinoma, (F) Medium differentiation of ovarian carcinoma, (G) Low differentiation of ovarian carcinoma. (Magnification ×200).

Figure 2. Expression of EFEMP1 in human ovarian tissues with higher-magnification.

Figure 2

(A) The epithelial cells of normal human ovarian, (B) the stroma of normal human ovarian, (C) Benign ovarian tumor, (D) High differentiation of ovarian carcinoma, (E) Medium differentiation of ovarian carcinoma, (F) Low differentiation of ovarian carcinoma. (Magnification ×400).

Figure 3. Positive control and negative control of immunohistochemistry (IHC) analysis.

Figure 3

Positive control (EFEMP1 positive) (A) Human cervical cancer paraffin-embedded sections. Negative control (B) normal human ovarian tissue, (C) Benign ovarian tumor, (D) High differentiation of ovarian carcinoma, (E) Medium differentiation of ovarian carcinoma, (F) Low differentiation of ovarian carcinoma. (Magnification ×200).

Table 1. Protein expression of EFEMP1 in human ovarian tissues.

N EFEMP1 low EFEMP1 high X2 P
(−/+) (++/+++)
n % n %
Normal 40 38 95% 2 5% 66.01 <0.01
Benign 60 42 70% 18 30%
Carcinoma 160 49 30.6% 111 69.4%
Pathology type 0.236 0.889
serous cystadenocarcinoma 58 19 32.8% 39 67.2%
mucinous cystadenocarcinoma 56 16 28.6% 40 71.4%
endometrioid carcinoma 46 14 30.4% 32 69.6%
Cell differentiation 26.921 <0.01
High and Medium 88 42 47.7% 46 52.3%
Low 72 7 9.7% 65 90.3%
Tumor stage 27.837 <0.01
Low stage 74 38 51.4% 36 48.6%
High stage 86 11 12.8% 75 87.2%
Nodal status 35.752 <0.01
Positive 83 8 9.6% 75 90.4%
Negative 77 41 53.2% 36 46.8%

Table 2. mRNA expression of EFEMP1 in human ovarian tissues.

N EFEMP1 mRNA P
Control 40 0.0087±0.0053
Benign 60 0.0079±0.0068 >0.05*
Carcinoma 160 0.0738±0.0095 <0.05**
Pathology type >0.05
serous cystadenocarcinoma 58 0.0684±0.0103
mucinous cystadenocarcinoma 56 0.0849±0.0136
endometrioid carcinoma 46 0.0741±0.0181
Cell differentiation <0.05
High and Medium 88 0.0256±0.0097
Low 72 0.0869±0.0127
Tumor stage <0.05
Low stage 74 0.0357±0.0083
High stage 86 0.0851±0.0138
Nodal status <0.05
Positive 83 0.0732±0.0109
Negative 77 0.0254±0.0067

Note:

*

Benign ovarian tumor compared with healthy control, P>0.05;

**

Ovarian carcinoma compared with healthy control and benign ovarian tumor, P<0.05.

Figure 4. EFEMP1 mRNA expression and Kaplan-Meier analysis.

Figure 4

(A) EFEMP1 mRNA expression. High EFEMP1 mRNA expression was also associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas. (B) Kaplan-Meier analysis. Patients with high EFEMP1 expression (blue line) had a much worse prognosis than those with low EFEMP1 expression (green line). *P<0.05 versus control.

Different expression of EFEMP1 in the highly invasive subclone and low invasive subclone

The highly invasive subclone (S1 and A1) and the low invasive subclone (S21 and A19) were derived from the SKOV3 and 3AO human ovarian cancer cell line, by limited dilution method. As shown in Figure 5, EFEMP1 protein and mRNA expressions were very higher in highly invasive subclone (S1 and A1), compared to the low invasive subclone (S21 and A19).

Figure 5. EFEMP1 expression in the highly invasive subclone and the low invasive subclone.

Figure 5

(ABCD) EFEMP1 protein expressions of high invasive subclones S1 (A) and A1 (B) and low invasive subclones S21 (C) and A19 (D) as measured by ICC staining. (EF) Negative control of ICC experiment (Magnification ×200). (G) EFEMP1 mRNA expressions of high invasive subclones S1 and A1 and low invasive subclones S21 and A19 as measured by q-RT-PCR. *P<0.05 versus control.

Serum levels of EFEMP1 in human ovarian tumor and healthy control

As shown in Table 3 and Figure 6A, the serum EFEMP1 level of ovarian carcinoma was much higher than that of healthy control and benign ovarian tumor (P<0.05). No significant difference was found between healthy control and benign ovarian tumor (P>0.05). Moreover, high serum levels of EFEMP1 were associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas (P<0.05). There were no significant differences among different pathology types of ovarian carcinoma (P>0.05).

Table 3. Serum levels of EFEMP1 in patients with ovarian tumor.

N EFEMP1(ng/ml) P
Control 60 126.47±15.83
Benign 60 132.76±18.57 >0.05*
Carcinoma 160 319.51±21.65 <0.05**
Pathology type >0.05
serous cystadenocarcinoma 58 287.69±18.81
mucinous cystadenocarcinoma 56 274.53±22.74
endometrioid carcinoma 46 268.79±18.33
Cell differentiation <0.05
High and Medium 88 147.29±13.88
Low 72 304.37±20.26
Tumor stage <0.05
Low stage 74 134.73±19.54
High stage 86 335.81±22.69
Nodal status <0.05
Positive 83 325.49±23.57
Negative 77 129.73±16.44

Note:

*

Benign ovarian tumor compared with healthy control, P>0.05;

**

Ovarian carcinoma compared with healthy control and benign ovarian tumor, P<0.05.

Figure 6. Serum levels of EFEMP1 and immunohistochemical staining of VEGF and CD34 for MVD.

Figure 6

(A) Serum levels of EFEMP1. High serum levels of EFEMP1 were associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas. (BC) Immunohistochemical staining of VEGF in low differentiation of ovarian carcinoma (B), and high differentiation of ovarian carcinoma (C) as measured by IHC staining. (Magnification ×200). (DE) Immunohistochemical staining of CD34 for MVD in low differentiation of ovarian carcinoma (D), and high differentiation of ovarian carcinoma (E) as measured by IHC staining. (Magnification ×100). *P<0.05 versus control.

Relationship between EFEMP1 and VEGF and MVD

Figure 6BCDE shows the representative immunohistochemical staining of VEGF and CD34. The immunohistochemical expressions of VEGF and EFEMP1 were evaluated with semiquantitative scoring. Angiogenesis is the process of formation of new microvessels from the preexisting vasculature. Vascular endothelial growth factor (VEGF) is considered as the most potent candidate for the induction of angiogenesis in tumor growth. We want to know whether EFEMP1 is related to angiogenesis, so the Pearson correlation coefficient was calculated to assess the correlation between EFEMP1 and MVD, and the results showed a positive correlation, with high statistical significance (Fig. 7A, r = 0.389, P<0.01). Accordingly, by Pearson correlation coefficient, the correlation between EFEMP1 and VEGF also revealed direct relation with high statistical significance (Fig. 7B, r = 0.243, P<0.01).

Figure 7. Pearson correlations analysis of EFEMP1 expression with MVD and VEGF.

Figure 7

The expression of EFEMP1 positively correlated with MVD (A) and VEGF (B). *P<0.05 versus control.

Discussion

In the present study, we have demonstrated for the first time that the expression of EFEMP1 is associated with bad clinicopathologic features, neovascularization and poor prognosis in human ovarian carcinomas.

Our immunohistochemical studies showed that there was an up-regulation of EFEMP1 expression in ovarian carcinoma tissues, compared with normal ovarian tissues and benign ovarian tumors. Real time RT-PCR experiment confirmed the results that the mRNA expression of EFEMP1 was also up-regulated in ovarian carcinoma tissues. Moreover, high EFEMP1 expression was associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas. Similar results also appeared in the research of pancreatic adenocarcinoma, cervical cancer and glioma. In pancreatic adenocarcinoma, EFEMP1 was found significantly up-regulated in the highly metastatic cell line and promoted xenograft formation in vivo [21]. In cervical cancer, EFEMP1 expression was positively correlated with MVD and VEGF, and its over-expression was found to be significantly associated with lymph node metastasis, vascular invasion and poor survival [22]. In gliomas, fibulin-3 was found highly up-regulated in gliomas and cultured glioma cells, overexpression and knockdown experiments revealed that fibulin-3 enhanced substrate-specific cell adhesion and promoted cell motility [24]. In our study, EFEMP1 was over-expressed in ovarian cancer, and associated with poor clinicopathologic features.

We also found that EFEMP1 expression was positively correlated with MVD and the expression of VEGF, which indicated that EFEMP1 may promote angiogenesis. Similar results were found in pancreatic adenocarcinoma and cervical cancer. Seeliger et al. demonstrated that overexpression of EFEMP1 in FG cells, a human pancreatic adenocarcinoma cell line, resulted in a stimulation of VEGF production and an increased number of CD34-positive microvessels in the tumor specimens [21]. Song et al. reported that EFEMP1 gene transfection elevated the VEGF protein level in Hela cells, a cervical cancer cell line, the tumors with EFEMP1 overexpression showed a faster growth rate and had a higher level of VEGF expression and microvascular density [23]. In contrast to our results, EFEMP1 was found to exert antiangiogenesis effect. Albig et al. discovered Fibulin-3 as novel antagonists of endothelial cell activities capable of reducing tumor angiogenesis and, consequently, tumor growth in vivo [33]. Such disparity may be due to the fact that tumor microenvironment influences the tumor genes to promote angiogenesis and metastasis [34]. Of cause, further researches need to be done in the future, including cell transfection experiment, chorioallantoic membrane (CAM) assay and tumor xenografts in nude mice assay to confirm our result.

High serum levels of EFEMP1 were also found in ovarian carcinoma rather than in healthy control and benign ovarian tumor, and associated with low differentiation, high stage and positive lymph node status of ovarian carcinomas. This discovery may aid in determining the diagnosis and prognosis of ovarian carcinoma. Similar result was found in pleural mesothelioma, the plasma fibulin-3 level was significantly elevated in patients with mesothelioma [35]. New biomarker can help to detect ovarian carcinoma at an earlier stage and to individualize treatment strategies.

In conclusion, EFEMP1 is a newly identified gene overexpressed in ovarian cancer, associated with poor prognosis and promotes angiogenesis. Serum levels of EFEMP1 may be helpful to early diagnosis and prognosis judgment. EFEMP1 may serve as a new prognostic factor and a therapeutic target for patients with ovarian cancer in the future.

Funding Statement

This study was supported by a grant-in-aid for scientific research from Shandong University (2012TS088) and National Nature Science Foundation of China (81202056). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Jemal A, Siegel R, Xu J, Ward E (2010) Cancer statistics, 2010. CA Cancer J Clin 60: 277–300. [DOI] [PubMed] [Google Scholar]
  • 2. Brun JL, Feyler A, Chene G, Saurel J, Brun G, et al. (2000) Long-term results and prognostic factors in patients with epithelial ovarian cancer. Gynecol Oncol 78: 21–7. [DOI] [PubMed] [Google Scholar]
  • 3. Cho KR, Shih Ie M (2009) Ovarian cancer. Annu Rev Pathol 4: 287–313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bast RC Jr, Hennessy B, Mills GB (2009) The biology of ovarian cancer: new opportunities for translation. Nat Rev Cancer 9: 415–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Chaffer CL, Weinberg RA (2011) A perspective on cancer cell metastasis. Science 331: 1559–64. [DOI] [PubMed] [Google Scholar]
  • 6. Coticchia CM, Yang J, Moses MA (2008) Ovarian cancer biomarkers: current options and future promise. J Natl Compr Canc Netw 6: 795–802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. de Vega S, Iwamoto T, Yamada Y (2009) Fibulins: multiple roles in matrix structures and tissue functions. Cell Mol Life Sci 66: 1890–1902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Gallagher WM, Currid CA, Whelan LC (2005) Fibulins and cancer: friend or foe? Trends Mol Med 11: 336–340. [DOI] [PubMed] [Google Scholar]
  • 9. Moll F, Katsaros D, Lazennec G, Hellio N, Roger P, et al. (2002) Estrogen induction and overexpression of fibulin-1C mRNA in ovarian cancer cells. Oncogene 21 (7) 1097–1107. [DOI] [PubMed] [Google Scholar]
  • 10. Greene LM, Twal WO, Duffy MJ, McDermott EW, Hill AD, et al. (2003) Elevated expression and altered processing of fibulin-1 protein in human breast cancer. Br J Cancer 88 (6) 871–878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Bardin A, Moll F, Margueron R, Delfour C, Chu ML, et al. (2005) Transcriptional and posttranscriptional regulation of fibulin-1 by estrogens leads to differential induction of messenger ribonucleic acid variants in ovarian and breast cancer cells. Endocrinology 146 (2) 760–768. [DOI] [PubMed] [Google Scholar]
  • 12. Kanda M, Nomoto S, Okamura Y, Hayashi M, Hishida M, et al. (2011) Promoter hypermethylation of fibulin 1 gene is associated with tumor progression in hepatocellular carcinoma. Mol Carcinog 50 (8) 571–579. [DOI] [PubMed] [Google Scholar]
  • 13. Cheng YY, Jin H, Liu X, Siu JM, Wong YP, et al. (2008) Fibulin 1 is downregulated through promoter hypermethylation in gastric cancer. Br J Cancer 99 (12) 2083–2087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wlazlinski A, Engers R, Hoffmann MJ, Hader C, Jung V, et al. (2007) Downregulation of several fibulin genes in prostate cancer. Prostate 67 (16) 1770–1780. [DOI] [PubMed] [Google Scholar]
  • 15. Xie L, Palmsten K, MacDonald B, Kieran MW, Potenta S, et al. (2008) Basement membrane derived fibulin-1 and fibulin-5 function as angiogenesis inhibitors and suppress tumor growth. Exp Biol Med (Maywood) 233 (2) 155–162. [DOI] [PubMed] [Google Scholar]
  • 16. Law EW, Cheung AK, Kashuba VI, Pavlova TV, Zabarovsky ER, et al. (2012) Anti-angiogenic and tumor-suppressive roles of candidate tumor-suppressor gene, Fibulin-2, in nasopharyngeal carcinoma. Oncogene 31 (6) 728–738. [DOI] [PubMed] [Google Scholar]
  • 17. Yi CH, Smith DJ, West WW, Hollingsworth MA (2007) Loss of fibulin-2 expression is associated with breast cancer progression. Am J Pathol 170 (5) 1535–1545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Schluterman MK, Chapman SL, Korpanty G, Ozumi K, Fukai T, et al. (2010) Loss of fibulin-5 binding to beta1 integrins inhibits tumor growth by increasing the level of ROS. Dis Model Mech 3 (5–6) 333–342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hu Z, Ai Q, Xu H, Ma X, Li HZ, et al. (2011) Fibulin-5 is down-regulated in urothelial carcinoma of bladder and inhibits growth and invasion of human bladder cancer cell line 5637. Urol Oncol 29 (4) 430–435. [DOI] [PubMed] [Google Scholar]
  • 20. Yue W, Sun Q, Landreneau R, Wu C, Siegfried JM, et al. (2009) Fibulin-5 suppresses lung cancer invasion by inhibiting matrix metalloproteinase-7 expression. Cancer Res 69 (15) 6339–6346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Seeliger H, Camaj P, Ischenko I, Kleespies A, De Toni EN, et al. (2009) EFEMP1 expression promotes in vivo tumor growth in human pancreatic adenocarcinoma. Mol Cancer Res 7 (2) 189–198. [DOI] [PubMed] [Google Scholar]
  • 22. Song EL, Hou YP, Yu SP, Chen SG, Huang JT, et al. (2011) EFEMP1 expression promotes angiogenesis and accelerates the growth of cervical cancer in vivo. Gynecol Oncol 121 (1) 174–180. [DOI] [PubMed] [Google Scholar]
  • 23. En-lin S, Sheng-guo C, Hua-qiao W (2010) The expression of EFEMP1 in cervical carcinoma and its relationship with prognosis. Gynecol Oncol 117 (3) 417–422. [DOI] [PubMed] [Google Scholar]
  • 24. Hu B, Thirtamara-Rajamani KK, Sim H, Viapiano MS (2009) Fibulin-3 is uniquely upregulated in malignant gliomas and promotes tumor cell motility and invasion. Mol Cancer Res 7 (11) 1756–1770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Hwang CF, Chien CY, Huang SC, Yin YF, Huang CC, et al. (2010) Fibulin-3 is associated with tumour progression and a poor prognosis in nasopharyngeal carcinomas and inhibits cell migration and invasion via suppressed AKT activity. J Pathol 222 (4) 367–379. [DOI] [PubMed] [Google Scholar]
  • 26. Sadr-Nabavi A, Ramser J, Volkmann J, Naehrig J, Wiesmann F, et al. (2009) Decreased expression of angiogenesis antagonist EFEMP1 in sporadic breast cancer is caused by aberrant promoter methylation and points to an impact of EFEMP1 as molecular biomarker. Int J Cancer 124 (7) 1727–1735. [DOI] [PubMed] [Google Scholar]
  • 27. Hu Y, Pioli PD, Siegel E, Zhang Q, Nelson J, et al. (2011) EFEMP1 suppresses malignant glioma growth and exerts its action within the tumor extracellular compartment. Mol Cancer 28;10: 123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Kim EJ, Lee SY, Woo MK, Choi SI, Kim TR, et al. (2012) Fibulin-3 promoter methylation alters the invasive behavior of non-small cell lung cancer cell lines via MMP-7 and MMP-2 regulation. Int J Oncol 40 (2) 402–8. [DOI] [PubMed] [Google Scholar]
  • 29. Omasu F, Nakano Y, Ichiki T (2005) Measurement of the electrophoretic mobility of sheep erythrocytes using microcapillary chips. Electrophoresis 26: 1163–1167. [DOI] [PubMed] [Google Scholar]
  • 30. Chen J, Zhang J, Zhao Y, Li J, Fu M (2009) Integrin beta3 down-regulates invasive features of ovarian cancer cells in SKOV3 cell subclones. J Cancer Res Clin Oncol 135: 909–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Chen J, Liu X, Zhang J, Zhao Y (2012) Targeting HMGB1 inhibits ovarian cancer growth and metastasis by lentivirus-mediated RNA interference. J Cell Physiol 227 (11) 3629–38. [DOI] [PubMed] [Google Scholar]
  • 32. Weidner N, Folkman J, Pozza F, Bevilacqua P, Allred EN, et al. (1992) Tumor angiogenesis: a new significant and independent prognostic indicator in early-stage breast carcinoma. J Natl Cancer Inst 84 (24) 1875–87. [DOI] [PubMed] [Google Scholar]
  • 33. Albig AR, Neil JR, Schiemann WP (2006) Fibulins 3 and 5 antagonize tumor angiogenesis in vivo. Cancer Res 66 (5) 2621–9. [DOI] [PubMed] [Google Scholar]
  • 34. Chen L, Sun B, Zhang S, Zhao X, He Y, et al. (2009) Influence of microenvironments on microcirculation patterns and tumor invasion-related protein expression in melanoma. Oncol Rep 21 (4) 917–23. [DOI] [PubMed] [Google Scholar]
  • 35. Pass HI, Levin SM, Harbut MR, Melamed J, Chiriboga L, et al. (2012) Fibulin-3 as a blood and effusion biomarker for pleural mesothelioma. N Engl J Med 367 (15) 1417–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES