Skip to main content
The American Journal of Pathology logoLink to The American Journal of Pathology
. 2012 May;180(5):2120–2133. doi: 10.1016/j.ajpath.2012.01.037

Yin Yang 1 Plays an Essential Role in Breast Cancer and Negatively Regulates p27

Meimei Wan ⁎, Weiwei Huang ⁎,†, Timothy E Kute ⁎,‡, Lance D Miller ⁎, Qiang Zhang ⁎, Heather Hatcher ⁎, Jingxuan Wang §, Daniel B Stovall ⁎, Gregory B Russell , Paul D Cao ⁎, Zhiyong Deng ⁎, Wei Wang ⁎, Qingyuan Zhang §, Ming Lei †, Suzy V Torti ⁎,∥, Steven A Akman ⁎, Guangchao Sui ⁎,⁎
PMCID: PMC3828504  PMID: 22440256

Abstract

Yin Yang 1 (YY1) is highly expressed in various types of cancers and regulates tumorigenesis through multiple pathways. In the present study, we evaluated YY1 expression levels in breast cancer cell lines, a breast cancer TMA, and two gene arrays. We observed that, compared with normal samples, YY1 is generally overexpressed in breast cancer cells and tissues. In functional studies, depletion of YY1 inhibited the clonogenicity, migration, invasion, and tumor formation of breast cancer cells, but did not affect the clonogenicity of nontumorigenic cells. Conversely, ectopically expressed YY1 enhanced the migration and invasion of nontumorigenic MCF-10A breast cells. In both a monolayer culture condition and a three-dimensional Matrigel system, silenced YY1 expression changed the architecture of breast cancer MCF-7 cells to that resembling MCF-10A cells, whereas ectopically expressed YY1 in MCF-10A cells had the opposite effect. Furthermore, we detected an inverse correlation between YY1 and p27 expression in both breast cancer cells and xenograft tumors with manipulated YY1 expression. Counteracting the changes in p27 expression attenuated the effects of YY1 alterations on these cells. In addition, YY1 promoted p27 ubiquitination and physically interacted with p27. In conclusion, our data suggest that YY1 is an oncogene and identify p27 as a new target of YY1.


Breast cancer development and progression are associated with both genetic and epigenetic alterations related to different signaling pathways.1 Genetic mutation of tumor suppressors such as BRCA12 have been correlated with breast cancer. Epigenetic mechanisms contribute to the disease phenotypes by both directly altering the expression of cancer-related genes and affecting the penetrance of variants with genetic vulnerability. Deregulated expression of proliferative or oncogenic genes due to aberrant DNA methylation and histone modifications has a crucial role in breast cell malignancy.3,4

The multifunctional protein Yin Yang 1 (YY1) is an important regulator of differential epigenetic regulation in gene expression and protein modifications. As a ubiquitously expressed and highly conserved protein from Xenopus to human, YY1 functions as a transcription factor to either activate or repress its target genes, depending on its recruited cofactors.5–8 The domain architecture and transcriptional activity of YY1 have been extensively studied.9 Some YY1-recruited proteins such as p300, HDAC1, Mdm2, Ezh2, and PRMT1 mediate differential histone modifications. YY1 regulates many genes with protein products essential to cell proliferation and differentiation (reviewed in references 6 through 10), and YY1 gene expression is regulated by various growth stimuli.7 In addition, YY1 is one of the Polycomb Group proteins that contribute to the aberrant epigenetics of cancers.11 The functional role of YY1 has been characterized in the developmental studies of Drosophila melanogaster using two orthologs of YY1, Pleiohomeotic and Pleiohomeotic-like.12,13 YY1 is one of the few Polycomb Group proteins that can directly bind DNA and recruit other Polycomb Group proteins to establish and maintain gene silencing.

Many lines of evidence suggest a regulatory role of YY1 in cancer development. YY1 regulates expression of many cancer-related genes such as MYC (alias c-myc) and c-Fos.14,15 In addition, YY1 is associated with many proteins with critical regulatory functions such as p300, HDAC1, Ezh2, Mdm2, p53, Rb, and mTOR.16–21 In particular, YY1-Mdm2 interaction has a role in enhancing Mdm2-mediated p53 ubiquitination and degradation.19,22 Furthermore, YY1 is highly expressed in breast cancer, and cooperates with activator protein 2 to stimulate expression of ERBB2 (Her2/neu),23,24 a proto-oncogene overexpressed in approximately 30% of breast cancers and generally correlated with a poor prognosis.25 Recently, we have demonstrated the regulation of YY1 expression by G-quadruplex, a four-stranded DNA structure formed by non–Watson-Crick base pairing that is typically present in the promoters of oncogenes.26 These data strongly suggest that YY1 is an oncogene in tumorigenesis. Consistently, increased YY1 expression has been reported in multiple human cancers (reviewed in references 8, 27, and 28).

In the present study, we demonstrated that YY1 is generally overexpressed in breast cancer and is essential to the tumorigenicity of breast cancer cells. Furthermore, ectopic YY1 confers many oncogenic properties to nontumorigenic breast cells. p27 levels inversely correlated with manipulated YY1 expression, and YY1 positively regulated p27 ubiquitination. These data support the concept that YY1 has an oncogenic role in breast cancer development.

Materials and Methods

Antibodies and DNA Vectors for Gene Expression and Knockdown

The antibodies, their catalog numbers and vendors include YY1 (H-414, sc-1703; and H-10, sc-7341; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), Ezh2 (AC22; Cell Signaling Technology, Inc., Beverly, MA), p27 (610241; BD Biosciences, Franklin Lakes, NJ), Ki-67 (sp6; NeoMarkers, Inc., Freemont, CA), β-actin (MAB1501; Chemicon International Inc., Temecula, CA), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (10R-G109A; Fitzgerald Industries International, Inc., Acton, MA).

We generated lentiviral vector pSL5 and pSL9 using a chicken β-actin promoter29 to drive inserted cDNA and to carry anti-puromycin and anti-blasticidin genes, respectively. The short hairpin RNA (shRNA) was designed based on our previously published methods.30,31 The target sequences included a scrambled control (5′-GGGACTACTCTATTACGTCATT-3′), human YY1 (5′-GGGAGCAGAAGCAGGTGCAGAT-3′), and human p27 (5′-GGCTAACTCTGAGGACACGCATT-3′). The inducible H1 promoter with a tetracycline regulator site present downstream of the H1 promoter was used for doxycycline (Dox)–induced shRNA expression in tetracycline regulator–containing cells. Other lentiviral vectors have been described previously.19

Cell Culture, Lentiviral Production, and Infection

Human mammary epithelial cells (HMECs), nontumorigenic breast cell line MCF-10A, and tumorigenic breast cell lines MCF-7, MDA-MB-231, SK-BR-3, ZR-75-1, BT-474, and HEK (HMEC immortalized by SV40 large-T antigen, the telomerase catalytic subunit, and H-Ras)32 were cultured according to the protocol of the American Type Culture Collection or the cited literature. 293FT cells were cultured in DMEM (Dulbecco's modified Eagle's medium) supplied with 10% fetal bovine serum. MCF-10A is a spontaneously immortalized and nontransformed human mammary epithelial cell line and exhibits many features of normal breast epithelium.33 Therefore, MCF-10A has been used as a nontumorigenic control in many previous breast cancer studies. MCF-7 and MDA-MB-231 breast cancer cell lines, used in our functional studies, were derived, respectively, from pleural effusion from a patient with breast cancer34 and the mammary gland of another patient with breast cancer.35

Lentivirus was produced as described previously36 by transfecting 293FT cells with a lentiviral plasmid and three packaging plasmids (pMDLg/pRRE, pRSV-REV, and pVSV-G) using the calcium phosphate precipitation method. To infect cells, concentrated lentivirus was added to the medium with 8 μg/mL polybrene and incubated for 6 hours before reverting to normal medium.

Tissue Microarray

The generation and applications of the breast cancer TMA process have been described previously.37,38 In brief, one TMA set consists of eight slides; each slide (60 × 10 mm) contains the cores of normal breast, tonsil, and liver as reference tissues, and at least two cores of breast cancer samples from each patient (de-identified). The analysis was based on the intensity of staining and percentage of stained tumor cells by two observers. Sample scoring was blinded to patient ethnicity. Intensity was scored from 0 to 2+, where 0 was negative for staining and 2+ indicated intense staining. The range of criteria was established by first analyzing a series of randomly selected breast cancer tissues for YY1 expression using our standardized method. Among these samples, we selected specific blocks as standards for 0, 1+, and 2+ intensity. Intensity in the TMA samples was determined by visual comparison with these reference standard blocks, and percentages of tumor were defined as 0% to 10%, 11% to 50%, 51% to 75%, and 76% to 100% breast tumor cell staining. Using a spreadsheet (Excel; Microsoft Corp., Redmond, WA), the mean score was obtained by multiplying the intensity score by the percentage of stained tumor cells, and the results were summed. This overall score was averaged with the number of cores studied for that patient. If there was no tumor, no score was given.

Cell Cycle Profile Analysis

Mammary cells were trypsinized and fixed using ethanol. The cells were then pelleted, resuspended in PBS containing 50 μg/mL propidium iodide, 0.1 mg/mL RNase A, and 0.05% Triton X-100, and filtered using cell strainers (40 μm; BD Biosciences). After at least 20 minutes of incubation on ice, the cells were analyzed via fluorescence-activated cell sorting using a flow cytometer (Accuri C6; BD Biosciences).

Clonogenic Assay and Cell Staining

Clonogenic assays were performed as previously described.39 Fluorescent staining of actin in cells was conducted according to a previously published procedure40 using Alexa Fluor 555 phalloidin (Invitrogen Corp., Carlsbad, CA).

Three-Dimensional Matrigel Culture of Breast Cells

These procedures generally were performed using a previously published method.41,42 Each well of a 24-well plate was coated with 200 μL Matrigel (BD Biosciences), and the plate was incubated at 37°C to allow the basement membrane to solidify. Meanwhile, cells were trypsinized and resuspended in 5 mL normal culture medium. The cells were spun at 150 × g for 5 minutes, and gently resuspended in 5 mL assay medium (DMEM/F12 medium containing 2% horse serum, 50 ng/mL epidermal growth factor, 0.5 μg/mL hydrocortisone, 0.1 μg/mL cholera toxin, antibiotics, and 4% collagen). After dilution to a final density of 5000 cells/mL in the assay medium, 1 mL of the suspended cells was added on top of the solidified collagen in the 24-well plate. The cells were allowed to grow in a 5% CO2 humidified incubator at 37°C for 10 to 15 days, after which they were stained with propidium iodide and subjected to microscopic analysis.

Breast Cancer Xenograft Study

This mouse model study was performed according to a protocol approved by the Institutional Animal Care and Use Committee of Wake Forest University School of Medicine. MDA-MB-231 cells (4 × 106 in 150 μL) stably integrated with an expression cassette of firefly luciferase were infected with lentivirus carrying Dox-inducible control shRNA or inducible-YY1 shRNA. The transduced cells were injected subcutaneously into the flank regions of 8- to 12-week-old female nude mice supplied with normal water (control) or water containing 1.5 mg/mL Dox (10 mice per group for a total of 40 mice). Tumors were measured twice a week using a Vernier caliper, and tumor volumes were calculated using the equation V = 1/2(Length × Width2).43 Mice with xenografts and control mice without grafts were anesthetized using 2% isoflurane and then injected intraperitoneally with 150 mg/kg luciferin, and tumors were imaged using the IVIS 100 System (Xenogen Corp., Alameda, CA). Up to five mice were placed in the light-tight imaging chamber of the imaging system, and images of emitted photons were collected by the cooled charge-coupled device camera over 1 to 3 minutes. Four weeks after cell implantation, all mice were sacrificed via CO2 asphyxiation. Tumor xenografts were collected, photographed, and analyzed using immunostaining and Western blot analysis.

Real-Time RT-PCR Analysis

Total RNA from cells was extracted using TRIzol reagent (Invitrogen Corp.). To determine mRNA levels of YY1 and p27, 2 μg RNA was incubated with 0.5 μg/μL oligo dT primer (Promega Corp., Madison, WI) at 70°C for 5 minutes. The following reverse transcriptase mix was then added and incubated at 42°C for 1 hour: 5 μL 5× MMLV (Moloney murine leukemia virus) buffer, 5 μL 10 mmol/L deoxyribonucleotide triphosphate, 0.6 μL ribonuclease inhibitor (RNasin; Promega Corp.) 1 μL MMLV reverse transcriptase, and 13.4 μL nuclease-free water. Quantitative PCR analysis using Taqman gene expression assays was then performed for YY1 and p27 expression, and data were normalized to GAPDH expression (Applied Biosystems, Inc., Foster City, CA). All analyses were performed using a sequence detection system (ABI7000; Applied Biosystems). The ΔΔCT method44 was used to calculate relative expression.

p27 Stability Determination

Experiments were conducted as previously described.45 To test the effect of increased YY1 on p27 stability, we used MCF-10A cells infected with pSL5 and pSL5/YY1 lentiviruses. To test the effect of endogenous YY1 silencing on p27 stability, we used MCF-7 cells with inducible-control shRNA or inducible-YY1 shRNA. The concentration of cycloheximide for MCF-10A cells was 60 μg/mL, and for MCF-7 cells was 45 μg/mL.

Cell-Based p27 Ubiquitination Assay

The experiments were performed according to a previously published procedure.46 To test the effect of YY1 increase on p27 ubiquitination, expression vectors for pSL5/p27 and pCMV/His×6-ubiquitin (0.4 μg each) were co-transfected with different amounts (0.2 and 0.4 μg) of pcDNA3/YY1, in the absence or presence of pSL5/Skp2 (0.4 μg), into 293T cells in 6-cm dishes. To test the effect of YY1 knockdown on p27 ubiquitination, 293T cells were infected with lentiviruses expressing control shRNA or YY1 shRNA. After 24 hours, the cells were transfected with plasmids expressing pCMV/His×6-ubiquitin, pSL5/p27, and pSL5/Skp2 (0.4 μg each). Two days after transfection, the cells were treated using proteasome inhibitor MG132 (20 μmol/L) for 4 hours before harvesting. A portion (10%) of the cell lysates was directly analyzed using Western blot analysis using p27, YY1, Skp2, and β-actin antibodies. The other portion of cell lysates was treated using Ni-NTA beads (Qiagen GmbH, Hilden, Germany) and analyzed via p27 immunoblotting.

Protein Interaction Studies

In vitro protein binding studies were performed as previously described.45

Statistical Analysis

Data in reporter assays and WST-1 assays are given as mean (SD). Comparisons between two groups for a single parameter were performed using Student's t-test. Statistical analyses were performed using commercially available software (SigmaPlot 11.0; Systat Software Inc., San Jose, CA). The criterion for statistical significance was set at P < 0.05.

Results

YY1 Expression in Breast Cancer Cell Lines, TMA, and Breast Cancer Gene Arrays

We first determined YY1 expression in a panel of commonly used breast cancer cell lines, MCF-7, MDA-MB-231, SK-BR-3, ZR-75-1, BT-474, and HEK,32 with HMEC and MCF-10A cells as controls. Cell lysates with an equal protein amount from these cell lines were analyzed using Western blot analysis with antibodies for YY1(H-414), Ezh2, and β-actin. As a histone methyltransferase, Ezh2 is a biomarker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells.47 The levels of β-actin or GAPDH did not always show equal intensity using Western blot analysis; BT-474 cells repeatedly exhibited low levels of β-actin (Figure 1A) and GAPDH (not shown), which suggested that they could not be used as normalizing controls. Inasmuch as an equal amount of total protein was loaded in each line, we directly quantified the relative YY1 and Ezh2 expression based on the signal of their blots (Figure 1A). In all six cancer cell lines, YY1 expression was increased by 5.7-fold or greater versus HMECs, and by 1.8-fold or greater versus MCF-10A cells (Figure 1A). Similarly, Ezh2 was also elevated by 2.2-fold or greater compared with MCF-10A cells, and its expression in HMECs was not detected (Figure 1A).

Figure 1.

Figure 1

YY1 expression in breast cancer cell lines and patient samples. A: YY1 and Ezh2 expression in nontumorigenic and tumorigenic breast cell lines. Total cell lysates of different cell lines (labeled on the top) were analyzed using Western blot analysis (antibodies labeled on the left). HMEC and MCF-10A cells were used as nontumorigenic controls. The increases in YY1 and Ezh2 protein levels in these six tumorigenic cell lines as compared with HMEC and/or MCF-10A cells are indicated under each blot. B: YY1 expression in a TMA study. The TMA derived from 120 patients37,38 was blotted using a YY1 antibody (H-10; Santa Cruz Biotechnology). The difference was determined using the Kruskal-Wallis test. *P = 0.046. C: Relative YY1 expression in different breast cancer subtypes of the Uppsala cohort (258 patient samples). The nomenclature (base-like, HER2 positive, luminal A, luminal B, and normal-like) refer to intrinsic breast cancer subtypes according to a previously reported method.48 *P= 0.051, **P = 0.0011, ***P = 8.4 × 10−7, ****P = 5.9 × 10−5, and *****P = 0.043. D: Gene array analysis of YY1 expression. In a publicly available data set of a gene microarray,49 YY1 expression in samples of invasive ductal carcinoma (IDC, 23) is significantly higher than normal breast samples from tissues adjacent to tumors (ATT, 10) and from reduction mammoplasties (RM, 10). Data are the average values generated by three YY1 probes (200047_s_at, 201901_s_at, and 213494_s_at). Their sequences are available from Affymetrix, Inc. *P = 6.9 × 10−5, **P = 0.0028, and ***P = 0.026.

To study YY1 expression in breast cancer tissues, we first validated the specificity of YY1 antibody H-10 (Santa Cruz Biotechnology) in MCF-7 cells by co-transfecting either the control or YY1 shRNA with a vector expressing enhanced version of green fluorescent protein (EGFP) at a molar ratio of 5:1 (shRNA/EGFP). Thus, EGFP-positive cells should also contain co-transfected shRNA. Cells transfected with EGFP and control shRNA exhibited YY1 levels similar to those of EGFP-negative (nontransfected) cells (see Supplemental Figure S1A at http://ajp.amjpathol.org). However, cells containing both EGFP and YY1 shRNA exhibited markedly decreased YY1 expression. Similar results were also obtained with YY1 (H-414) antibody (data not shown). Therefore, YY1 (H-10) and YY1 (H-414) antibodies did not recognize any other protein with a comparable affinity to YY1 protein in MCF-7 cells, which suggests their high specificity. Consistent with results of Western blot analysis, the immunohistochemical studies indicated a marked increase in YY1 in MCF-7 cells compared with MCF-10A cells, with YY1 predominantly localized in nuclei (see Supplemental Figure S1B at http://ajp.amjpathol.org). The YY1 (H-10) antibody was used to determine YY1 protein expression in a TMA containing 120 breast cancer samples, with normal breast tissues as controls. We observed that YY1 was significantly overexpressed in breast cancer samples compared with normal breast samples (Figure 1B; P = 0.046), and YY1 signal was detected primarily in nuclei, with some samples showing cytoplasmic staining (see Supplemental Figure S1C at http://ajp.amjpathol.org).

To determine whether YY1 is generally overexpressed at the transcription level in breast cancer, we analyzed a set of Affymetrix gene microarray data derived from the Uppsala breast cancer cohort consisting of 258 patient samples.50 To estimate where YY1 expression levels can be located among all other genes in this array, we used the negative control (Bacillus subtilis) and the average of the genes with the 10% lowest expression (from 2230 probes) to represent the base or low signal intensity of this array. In addition, we analyzed β-actin, GAPDH, and the average of the 10% highest expressed genes (also from 2230 probes) to represent the high signal intensity of this array. We then compared YY1 expression with several known breast cancer-related genes including Ezh2, HER2, ER-α, BRCA1, and Ki-67. The YY1 signal was determined on the basis of three different YY1 probes (213494_s_at, 201901_s_at, and 200047_s_at) that match three regions of the YY1 transcript (see Supplemental Figure S1D at http://ajp.amjpathol.org). Overall YY1 signal intensity was generally higher than that of Ezh2, HER2, ER-α, and Ki-67 (see Supplemental Figure S1E at http://ajp.amjpathol.org), which are well characterized for their overexpression in breast cancer.

We also analyzed YY1 expression of the breast cancer samples in this cohort on the basis of their subtypes, which were grouped using a previously reported method.48 Compared with normal-like samples, YY1 expression is significantly increased in groups of basal-like, HER2-positive, and luminal A and luminal B tumor tissues (P ≤ 0.0051) (Figure 1C). Among these four groups, we observed only a significantly higher YY1 expression in the samples of luminal B subtype compared with the basal-like samples (P = 0.043). However, we did not detect a significant change in YY1 gene expression between estrogen receptor (ER)–positive and ER-negative samples (P = 0.583). To compare YY1 gene expression in breast cancer versus normal tissues, we studied another Affymetrix gene array data set containing 10 normal breast samples from reduction mammoplasty procedures, 10 samples collected from normal tissues adjacent to breast tumors, and 23 invasive ductal carcinomas.49 YY1 expression was significantly increased in invasive ductal carcinomas compared with normal breast samples (P = 6.9 × 10−5) and normal samples adjacent to tumors (P = 0.0028) (Figure 1D). In summary, results of our studies strongly indicated that YY1 is overexpressed in breast cancer.

Manipulated YY1 Expression Affects the Migration, Invasiveness, Clonogenicity, and Cell Cycle Profiles of Mammary Cells

As we observed the significant up-regulation of YY1 in breast cancer tissues and cell lines, we wondered whether the aberrantly expressed YY1 has any biological effect in mammary cells. We studied the effects of ectopic YY1 expression in MCF-10A cells, which have relatively low YY1 levels, and YY1 silencing in MCF-7 and MDA-MB-231 cells, which have high YY1 levels.

We first infected MCF-10A cells with pSL5 vector or pSL5/YY1 lentivirus. In the wound-healing assay, ectopic YY1 markedly enhanced MCF-10A cell migration when compared with the control (Figure 2A). In the Boyden chamber assay, MCF-10A cells transduced by pSL5/YY1 exhibited significantly increased invasiveness when compared with pSL5 vector (Figure 2B). We also performed clonogenic assays using these MCF-10A cells. Because MCF-10A cells did not form well-isolated colonies, their colonies could not be counted. We used Adobe Photoshop 11.0.2 (Adobe Systems Inc., McLean, VA) to quantify the pixels of MCF-10A cell colonies stained with crystal violet. YY1 overexpression significantly increased the area covered by the colonies when compared with the vector control (P < 0.05) (Figure 2C), which suggests that ectopic YY1 expression increased survivability of MCF-10A cells. In these studies, YY1 expression was always monitored using Western blot analysis (Figure 2C).

Figure 2.

Figure 2

Effects of manipulated YY1 expression on the migration, invasion, and clonogenicity of breast cells. MCF-10A (A–C) and MCF-7 (D–F) cells with ectopically expressed YY1 and Dox-induced YY1 shRNA, respectively. In the scratch assays to test cell migration (A and D), dashed lines indicate edges of the monolayer cell gaps on the dishes. In the Boyden chamber assays to test cell invasiveness (B and E), the results were quantified. *P < 0.05. In the clonogenic assay to test cell clonogenicity (C and F), areas of MCF-10A cells were quantified in pixels, and MCF-7 cells by number of colonies. Insets in C and F represent Western blots of YY1 ectopic expression and Dox-induced knockdown, respectively.

To study the effects of YY1 silencing on breast cancer cells, we used Dox-inducible shRNA vectors. Silencing endogenous YY1 decreased migration of MCF-7 and MDA-MB-231 cells (Figure 2D; see also Supplemental Figure S2A at http://ajp.amjpathol.org). In addition, Boyden chamber assays also indicated reduced invasiveness of these two cell lines when YY1 was knocked down (Figure 2E; see also Supplemental Figure S2, B and C, at http://ajp.amjpathol.org). In the clonogenic studies, YY1 silencing significantly decreased the colony formation of MCF-7 cells (Figure 2F). In these studies, Dox-induced control shRNA did not produce these phenotypic changes (data not shown). These data suggest that elevated YY1 expression has a critical role in promoting or sustaining breast cancer cell migration, invasion, and clonogenicity. In these studies, YY1 expression was routinely monitored using Western blot analysis (Figure 2F; see also Supplemental Figure S2D at http://ajp.amjpathol.org).

To examine whether YY1 depletion exerts the same effects on both nontumorigenic and tumorigenic cells, we infected MCF-7 and MCF-10A cells with lentiviruses carrying constitutive expression cassettes of either YY1 shRNA or control shRNA and a puromycin selection marker. The infected cells were cultured in puromycin-containing medium and studied using clonogenic assays. Again, because of the diffuse nature of MCF-10A cells, we used photoshop software to quantify the pixels of stained cells in each dish. In contrast, MCF-7 cells formed well-isolated colonies that could be counted using Quantity One 4.2.2 software (BioRad Laboratories, Inc., Hercules, CA). We observed that YY1 depletion did not significantly change the clonogenicity of MCF-10A cells but markedly decreased that of MCF-7 cells (see Supplemental Figure S3, A and B, at http://ajp.amjpathol.org). We also tested ZR-75-1 and MDA-MB-231 cells, and obtained results similar to those for MCF-7 cells (data not shown). These results indicate that YY1 is essential to independent proliferation and colony formation of breast cancer cells but not to that of nontumorigenic MCF-10A cells, implicating the potential of YY1 as a therapeutic target of breast cancer.

We further tested the effects of YY1 changes on cell cycle profiles of mammary cells. Ectopic YY1 increased the G1 phase and decreased the G2/M phase of MCF-10A cells (see Supplemental Figure S4A at http://ajp.amjpathol.org). MCF-7 and MDA-MB-231 cells showed a differential response to YY1 silencing in their cell cycle profiles. Although both cells showed a slightly increased G2/M phase, the changes in the G1 and S phases were different (see Supplemental Figure S4, B and C, at http://ajp.amjpathol.org). Overall, we did not observe large alterations in cell cycle profiles of these mammary cells in response to changes in YY1 levels.

Manipulated YY1 Expression Changes Mammary Cell Architecture

MCF-10A cells exhibit a spindle shape, whereas MCF-7 cells form irregular clusters. We tested the effects of manipulated YY1 expression on the architecture of these two cell lines in monolayer culture conditions.

We observed that pSL5/YY1 lentivirus infection could induce more MCF-10A cells to undergo mitosis and grow in a highly aggregative architecture when compared with pSL5 vector-infected cells (Figure 3A). In contrast, MCF-7 cells with silenced YY1 markedly lost the cell-cell contact observed in the control shRNA–treated cells (Figure 3B). The effects of YY1 increase on MCF-10A cell architecture could also be observed in a clonogenic study. pSL5 vector–infected MCF-10A cells formed spread-out spindle-shaped colonies; however, the cells with ectopic YY1 generated colonies with more compact and rugged shapes (Figure 3C). These data suggested that YY1 has a role in regulating the morphologic changes in mammary cells.

Figure 3.

Figure 3

Effects of manipulated YY1 expression on the architecture of monolayered breast cells. MCF-10A cells infected with pSL5 and pSL5/YY1 lentiviruses (A) and MCF-7 cells infected with lentiviruses expressing control and YY1 shRNAs (B) were seeded on culture slips and co-stained using Alexa Fluor 555 phalloidin (Invitrogen Corp.) and DAPI, followed by fluorescent microscopy (×20). Cells undergoing mitoses are indicated by arrowheads in A. C: MCF-10A cells were infected with pSL5 or pSL5/YY1 lentiviruses, and puromycin-selected cells were stained using crystal violet. Western blots of YY1 expression are shown on the right.

YY1 Knockdown Reduces Tumor Formation by MDA-MB-231 Cells in a Xenograft Mouse Model

To determine whether YY1 overexpression in breast cancer cells is essential to tumor formation, we performed xenograft studies in athymic nude mice using MDA-MB-231 cells with stably integrated expression cassettes for firefly luciferase and inducible-control shRNA or inducible-YY1 shRNA. The four experimental groups are shown in Figure 4A (10 mice per group). Tumors in group 1 (inducible-YY1 shRNA, +Dox) were smaller than those in the other three groups (see Supplemental Figure S5A at http://ajp.amjpathol.org). When imaged using the IVIS system, group 1 exhibited reduced signal when compared with other groups (Figure 4B). The mice were euthanized at the end of 4 weeks, and tumor xenografts were collected, photographed (see Supplemental Figure S5B at http://ajp.amjpathol.org), and weighed. Overall, group 1 exhibited slower tumor growth than did its control groups 2 (inducible-YY1 shRNA, −Dox) and 3 (inducible-control shRNA, +Dox), and final tumor weights between groups showed statistically significant differences (P = 0.017 for group 1 versus group 2; P = 0.0001 for group 1 versus group 3) (Figure 4C). Groups 3 and 4 demonstrated similar growth rates and final tumor weights (P = 0.47) (Figure 4C).

Figure 4.

Figure 4

Effects of YY1 knockdown on xenograft breast cancer formation. A: The four experimental groups of Dox-inducible shRNAs. Each group included 10 mice. B: Schema of cell implantation (left) and representative bioluminescent images captured by IVIS at 4 weeks (right). The corresponding group numbers are indicated at the top. C: Xenograft tumor weights at 4 weeks. *P = 0.017, **P = 0.0001, and ***P = 0.47. D: Western blots of YY1 and β-actin expression in xenografts of MDA-MB-231 cells with inducible-YY1 shRNA in the absence and presence of Dox. E: IHC staining to detect YY1 expression (H-10 antibody, left) and Ki-67 (middle) in xenografts. The control without primary antibody is on the right. Scale bars: 50 μm.

Dox-induced YY1 silencing was confirmed using Western blot analysis (Figure 4D), supporting the notion that YY1 is essential for tumor formation in this mouse model. When YY1 was knocked down in the tumors with inducible-YY1 shRNA +Dox, Ki-67 staining was reduced when compared with the tumors with inducible-YY1 shRNA −Dox (Figure 4E), which suggested that silenced YY1 led to decreased cell proliferation in these tumor xenografts.

p27 Is a Potential Downstream Target of YY1 in Mediating Mammary Cell Tumorigenesis

We and others have reported the negative regulation of p53 by YY1.19,22,51–53 However, p53 is deficient in >50% of cancers and approximately 26% of breast cancers.54 To determine whether YY1 has a role in mammary cell tumorigenesis, we explored other potential YY1-regulated mechanisms that may contribute to these phenotypic changes described. Multiple studies demonstrated the functions of p27 in regulating breast cancer development (reviewed in references 55 and 56) and controlling cell architecture and motility.57 p27 is inactivated primarily through posttranslational modifications in cancers (reviewed in reference 58); YY1 has been implicated in modulating various protein modifications of histone and nonhistone proteins (reviewed in reference 7). Therefore, we wanted to determine whether YY1 regulates the function or expression of p27 in breast epithelial cells. We first tested p27 expression in the cell lines with manipulated YY1 expression. In MCF-10A and MCF-7 cells with no or low malignancy, ectopically expressed YY1 led to reduced expression of endogenous p27 (Figure 5A). In tumorigenic MCF-7 cells, MDA-MB-231 cells, and 7 of the 10 MDA-MB-231 xenografts (Figure 5B), YY1 knockdown resulted in increased p27 expression when compared with their corresponding controls. Consistently, in several other breast cell lines expressing high levels of YY1, we also observed reduced p27 expression compared with that in MCF-10A cells (see Supplemental Figure S6 at http://ajp.amjpathol.org). These data suggest that YY1 may act as a negative regulator of tumor suppressor p27.

Figure 5.

Figure 5

Effects of manipulated YY1 expression on endogenous p27 levels in breast cells. A: Effects of ectopic YY1 expression on endogenous p27 expression in MCF-7 and MCF-10A cells. B: Effects of silenced YY1 expression on endogenous p27 levels in MCF-7 cells, MDA-MB-231 cells, and a representative xenograft.

Effects of YY1 on Architecture and Proliferation of MCF-10A and MCF-7 Cells in Three-Dimensional Matrigel Culture Are Reversed by Adjusting p27 Expression

Inasmuch as altered YY1 expression changed the architecture of mammary cells in a monolayer culture condition, we also studied how YY1 expression affects mammary cell architecture in a 3-D Matrigel culture system. When we inoculated the same number of cells in the 3-D Matrigel, we observed that MCF-10A cells generated many spheroids but that MCF-7 cells formed irregular cell clusters (see Supplemental Figure S7A at http://ajp.amjpathol.org). To test the effect of ectopically expressed YY1 on cell architecture, we seeded MCF-10A cells infected with either pSL5 or pSL5/YY1 lentivirus in the 3-D Matrigel culture. Whereas pSL5-transduced MCF-10A cells retained a regular spheroid shape, the transduction of pSL5/YY1 disrupted this ability (Figure 6A; see also Supplemental Figure S7B at http://ajp.amjpathol.org), reminiscent of the effect of ectopic ERBB2 on MCF-10A cells.42 Inasmuch as we observed negative regulation of p27 by YY1, we wondered whether this regulation had a role in this phenotypic change. Therefore, we introduced exogenous p27 into pSL5/YY1-transduced MCF-10A cells with pSL9/p27 lentivirus infection carrying a blasticidin selection marker. Ectopic p27 restored the ability of the YY1-overexpressing MCF-10A cells to form spheroids, resembling the architecture formed by untreated or pSL5 virus–infected MCF-10A cells (Figure 6A; see also Supplemental Figure S7B at http://ajp.amjpathol.org). Cells infected with pSL9 vector lentivirus did not show this effect (data not shown). Expression of YY1 and p27 proteins in these conditions was confirmed using Western blot analysis (Figure 6B). These data suggest that p27 is an essential downstream target of YY1 in mediating its morphologic changes caused by YY1 elevation in MCF-10A cells.

Figure 6.

Figure 6

Effects of YY1 and p27 expression on the morphology of breast cells in three-dimensional Matrigel culture. A: Effects of ectopic YY1 and p27 expression on morphology of MCF-10A cells. The cells underwent individual infection with lentiviruses produced by pSL5 vector and pSL5/YY1, or consecutive infection with pSL5/YY1 and pSL9/p27 lentiviruses. B: Western blots of YY1 and p27 expression of cells in panel A. C: Effects of YY1 and p27 on MCF-7 cell morphology. Cells were infected by Dox-inducible YY1 shRNA-containing lentivirus and cultured in the absence and presence of Dox, or further infected by pLu-Neo/U6-p27 shRNA in the presence of Dox. D: Western blots of YY1 and p27 expression of cells in panel C.

We next studied the effects of YY1 silencing on the architecture of MCF-7 and MDA-MB-231 cells in 3-D Matrigel culture. We first tested MCF-7 cells with inducible-YY1 shRNA. When cultured in Dox-negative medium, these MCF-7 cells still exhibited an irregular clustered architecture (Figure 6C), like the parental MCF-7 cells. However, in the presence of Dox that induced YY1 knockdown, cell clusters became smaller and some spheroid-like structures were formed, which suggested that YY1 silencing could at least partially restore the differentiating capability of MCF-7 cells (Figure 6C; see also Supplemental Figure S7C at http://ajp.amjpathol.org). Because YY1 knockdown led to p27 increase, we wondered whether up-regulated p27 expression had a role in this phenotypic change. We used pLu-Neo-U6/p27 shRNA to silence p27 expression in YY1-depleted MCF-7 cells, and observed that these cells more frequently formed bigger and irregular clusters (Figure 6C; see also Supplemental Figure S7C at http://ajp.amjpathol.org), similar to the architecture of the control (−Dox) or parental MCF-7 cells. Cells infected with pLu-Neo-U6/control shRNA lentivirus did not demonstrate this effect (data not shown). These results suggested that p27 is an essential downstream target of YY1 in mediating the morphologic changes in MCF-7 cells in Matrigel. Expression of YY1 and p27 proteins was confirmed using Western blot analysis (Figure 6D). We also tested the effects of YY1 knockdown on the architecture of MDA-MB-231 cells in Matrigel. Cells with decreased YY1 formed smaller clusters than did control shRNA–infected cells; however, YY1 knockdown cells did not generate polarized structures (see Supplemental Figure S7D at http://ajp.amjpathol.org). This phenomenon suggested that, unlike MCF-7, MDA-MB-231 cells are more de-differentiated and YY1 down-regulation is insufficient to restore normal mammary gland architecture in these cells.

To test the effects of YY1 on cell proliferation, we performed WST-1 assays. Ectopic YY1 expression in MCF-10A cells infected with pSL5/YY1 significantly increased cell numbers after 6 days of culture, compared with the pSL5 vector group (P = 0.03) (see Supplemental Figure S8A at http://ajp.amjpathol.org). This effect was diminished by restoring p27 expression using pSL9/p27, compared with the same control. In MCF-7 cells carrying inducible-YY1 shRNA, YY1 silencing induced by +Dox significantly reduced cell numbers when compared with the −Dox condition (P = 0.03) (see Supplemental Figure S8B at http://ajp.amjpathol.org). However, p27 knockdown did not reinstate cell numbers, which suggests that p27 reduction was unable to rescue the growth defect caused by YY1. To determine the exponential proliferation rates of these cell groups, we plotted the data in charts with vertical axes in a logarithmic scale (see Supplemental Figure S8, C and D, at http://ajp.amjpathol.org). These lines showed comparable slopes, suggesting that the observed cell growth difference was not due to the altered proliferation rates. In these studies, expression of YY1 and p27 was routinely monitored using Western blot analysis (data not shown).

YY1 Negatively Regulates p27 Expression at the Posttranslational Level

We further explored the mechanisms whereby YY1 negatively regulates p27. Inasmuch as YY1 is well known for its transcriptional activity, we first determined whether YY1 regulates p27 gene transcription. We performed real-time PCR assays to assess steady-state p27 mRNA levels of MCF-10A and MCF-7 cells expressing ectopic YY1 or silenced endogenous YY1, respectively. Ectopic YY1 expression in MCF-10A cells did not significantly change p27 mRNA levels (Figure 7A), although YY1 knockdown increased p27 gene expression in breast cancer cells, in particular in MDA-MB-231 cells (Figure 7A). We also studied the potential regulation of p27 transcription by YY1 using p27 promoter (prmt) reporter assays. We first generated a reporter construct, p27-prmt-Gluc, which uses the p27 promoter to drive Gaussia luciferase expression (see Supplemental Figure S9A at http://ajp.amjpathol.org) and co-transfected MCF-7 cells by p27-prmt-Gluc with pcDNA3 vector or pcDNA3/YY1, as well as a plasmid expressing secreted alkaline phosphatase as a transfection control. Ectopically expressed YY1 doubled the relative Gluc activity mediated by the p27 promoter compared with the vector control (P = 0.02) (see Supplemental Figure S9B at http://ajp.amjpathol.org), which suggests that increased YY1 does not reduce p27 transcription. We then analyzed the correlation between the expression of YY1 and p27 in the Uppsala cohort (gene expression profiles of 258 patients with breast cancer). The p27 gene exhibited a slightly positive correlation with the gene expression of YY1 (r = 0.12; P = 0.05) (Figure 7B). Overall, these data suggest that the negative regulation of p27 protein levels by YY1 likely does not result from YY1-mediated transcriptional regulation.

Figure 7.

Figure 7

Correlation between YY1 and p27 gene expression. A: Real-time PCR to determine p27 mRNA levels in response to ectopic YY1 expression in MCF-10A cells and YY1 knockdown in MCF-7 and MDA-MB-231 cells. *P = 0.02. B: Correlation between YY1 and p27 expression in samples from the Uppsala breast cancer cohort (258 patient samples). Signal intensity of YY1 and p27 was logarithmically transformed. A positive correlation is suggested by the Pearson product moment correlation r = 0.12 and P = 0.05.

We wondered whether YY1 regulates p27 at the posttranslational level. We first determined p27 stability with either ectopically expressed YY1 or silenced endogenous YY1. MCF-10A cells infected with pSL5/YY1 or pSL5 vector were treated using 60 μg/mL cycloheximide, and the cells were collected at different times for Western blot analysis. Ectopic YY1 reduced stability of p27 when compared with the cells infected with the control vector (P = 0.0066) (Figure 8A; see also Supplemental Figure S10A at http://ajp.amjpathol.org). We also tested YY1 stability in MCF-7 cells with silenced endogenous YY1 and treated with 45 μg/mL cycloheximide. YY1 depletion increased the stability of p27 (P = 0.0052) (Figure 8B; see also Supplemental Figure S10B at http://ajp.amjpathol.org). Previous studies have indicated that p27 turnover is regulated by ubiquitination promoted by its E3 ligase, Skp2.60,61 Therefore, we tested whether YY1 affected Skp2-mediated p27 ubiquitination by co-transfecting 293T cells with p27, Skp2, His×6-ubiquitin, and two different amounts of YY1. Ubiquitinated p27 was brought down by Ni-NTA beads (Qiagen GmbH) and blotted using a p27 antibody. Ectopic YY1 increased the signal of both monoubiquitinated and polyubiquitinated p27 (Figure 8C). In the presence of Skp2, YY1-promoted p27 ubiquitination was slightly enhanced (Figure 8C). We further studied the effect of YY1 knockdown on p27 ubiquitination. Because the ubiquitination of endogenous p27 was weak and difficult to detect (data not shown), we transfected plasmids expressing p27, Skp2, and His×6-Ub into 293T cells infected with lentiviruses expressing control and YY1 shRNAs, respectively. YY1 depletion markedly reduced the polyubiquitinated p27, whereas the monoubiquitinated p27 was likely not affected (Figure 8D). We also performed an in vitro protein binding experiment using His×6- and GST-tagged proteins that were expressed and purified from bacteria. GST-p27, but not GST-Skp2, could pull down His×6-YY1, which suggests direct interaction of YY1 with p27 but not Skp2 (Figure 8E). In this experiment, GST served as a negative control, and GST-p53 served as a positive control, based on our previous report.19

Figure 8.

Figure 8

Effects of YY1 on the stability and ubiquitination of p27. A: Effects of ectopic YY1 on p27 stability. MCF-10A cells infected by pSL5 or pSL5/YY1 lentiviruses were treated with 60 μg/mL cycloheximide, collected at time points indicated, and then analyzed by Western blots using p27 and β-actin antibodies. B: Effects of YY1 knockdown on p27 stability. MCF-7 cells inducibly expressing control or YY1 shRNA were treated with 45 μg/mL cycloheximide, collected at the times indicated, and then analyzed using Western blot analysis using p27 and β-actin antibodies. C and D: Effect of YY1 on p27 ubiquitination. Experiments were performed as described in Materials and Methods. E:In vitro binding assay to determine the direct interaction of YY1 with p27. Purified His-YY1 (1.5 μg) was incubated with an equal amount (3.0 μg) of purified GST alone or GST-fusion proteins. The components brought down by glutathione agarose were analyzed using Western blot analysis using YY1 H-10 antibody.

Discussion

Previous studies have demonstrated the regulatory mechanisms of YY1 in various cancer-related signaling pathways such as Mdm2-mediated p53 degradation, Ezh2- and PRMT1-mediated histone methylation, and p300/HDAC-mediated histone acetylation/deacetylation.7,8 Therefore, YY1 likely regulates cancer development through multiple signaling pathways. In the present study, we observed YY1 overexpression in various breast cancer cell lines, a TMA, and two gene arrays. We demonstrated the effects of manipulated YY1 expression on mammary cell proliferation, clonogenicity, migration, invasion, and tumor formation. In addition, we revealed that YY1 negatively regulated tumor suppressor p27. Overall, our data unequivocally indicate that YY1 has a proliferative or oncogenic role in breast tumorigenesis.

Our analyses of the Uppsala cohort indicated that YY1 was increased in four subtypes of breast cancer samples when compared with normal-like tissues. However, we did not observe a significant change of YY1 expression between ER-positive and ER-negative samples. It is noteworthy that a recent study using breast cancer TMA demonstrated a positive correlation between YY1 and ER expression.62 The apparent inconsistency between that report and the present study suggests that YY1 positively regulates ER levels at the posttranslational level.

It is likely that YY1-mediated p27 down-regulation is independent of YY1-mediated p53 degradation because the negative regulation of p27 by YY1 could be detected in both MCF-7 and MDA-MB-231 cells, which contain wild-type and mutated p53, respectively. Whether there is any cross-talk between these two signaling pathways in regulating breast cancer tumorigenesis requires further investigation.

In our gene array studies (Figure 1D), YY1 levels were significantly increased in invasive breast ductal carcinoma samples when compared with normal tumor-adjacent tissue and reduction mammoplasty samples. However, there was also a significant difference between the latter two groups (P = 0.026). Therefore, it is possible that these tumor-adjacent tissues exhibited elevated YY1 as part of a premalignant “field effect” in the tumor-containing breast. Correspondingly, in a study of YY1 expression in prostate cancer, prostatic intraepithelial neoplasia samples also showed increased YY1 levels.63

We detected morphologic changes in MCF-10A and MCF-7 cells caused by manipulated YY1 expression in a monolayer culture condition (Figure 3). Ectopic YY1 increased the growth contact of MCF-10A cells, whereas YY1 silencing in MCF-7 cells produced an opposite effect. These data indicated that YY1 expression positively correlated with the nuclear/cytoplasmic ratio, which can be clearly observed in Figure 3, A and B. Because this ratio usually increases during cell malignant transformation, these results suggested an oncogenic role of YY1.

Three-dimensional Matrigel culture systems faithfully recapitulate the in vivo conditions of mammary glands.64,65 Previous studies have reported that nontumorigenic cells, such as MCF-10A, form spheroid or acinus structures in the 3-D Matrigel culture; however, oncogene (such as ERBB2)–transformed or tumorigenic breast cells do not show this type of orientated or polarized architecture under the same growth conditions.42 We have observed that shRNA-mediated YY1 silencing changed MCF-7 cell architecture in the 3-D Matrigel culture to that resembling MCF-10A cells. However, YY1 knockdown in MDA-MB-231 cells did not cause this type of morphologic change. We attribute these results to the different degrees of malignancy between these two cell lines. MCF-7 cells do not exhibit the aggressive behavior of MDA-MB-231 cells in vivo, which could make MCF-7 cells more amenable to reversion to normal mammary gland architecture on adjustment of epigenetic regulation such as reducing YY1 expression. However, MDA-MB-231 cells are highly malignant and de-differentiated, and exhibit much lower p27 expression than do MCF-7 cells (see Supplemental Figure S6 at http://ajp.amjpathol.org), which renders them resistant to morphologic reversion to normality with the same treatment.

It is noteworthy that manipulated YY1 expression did not markedly alter cell proliferation rates, although changes in total cell numbers were detected (see Supplemental Figure S8 at http://ajp.amjpathol.org). This phenomenon could be contributed by other factors that influence cell growth such as the duration of the lag phase and confluent density. Lack of alteration of the proliferation rate may also explain the minor changes observed in cell cycle profiles of these cells. In our cell growth studies, restored p27 expression in MCF-10A cells diminished the increased cell numbers caused by ectopic YY1 expression; however, in MCF-7 cells, p27 knockdown did not rescue the reduced cell numbers caused by YY1 silencing (see Supplemental Figure S8, A and B, at http://ajp.amjpathol.org). The essential role of YY1 in other processes of breast cancer cells may explain this finding. The absence of YY1 protein could have seriously perturbed these pathways beyond the rescue ability of p27 knockdown. Consistently, in our 3-D Matrigel culture studies, simultaneous silencing of YY1 and p27 did not fully restore the architecture of MCF-7 cells to that formed by the cells without YY1 depletion (see Supplemental Figure S7C at http://ajp.amjpathol.org).

Although ectopic YY1 could cause multiple transformation-associated changes in vitro, our in vivo experiments indicated that YY1 overexpression did not lead to tumor formation of xenografted MCF-10A cells (data not shown). This result suggests either that ectopic YY1 alone is insufficient to initiate breast tumors or that the mouse xenograft system does not accurately mirror naturally occurring tumor formation. Multiple oncogenes including ERBB2, Ha-ras, EGFR, and Src did not show tumor formation capability in this system,66,67 although their oncogenic roles are well recognized. We are currently generating transgenic mice with mammary gland–specific YY1 overexpression to determine whether genetically elevated YY1 expression can promote breast tumorigenesis.

Although most previous reports have focused on YY1 as a transcription factor, several recent studies, including ours,19,68,69 have demonstrated YY1 regulatory functions independent of its transcriptional activity (reviewed in reference 8). In the present study, we observed reduced p27 protein levels, but not mRNA, when YY1 was ectopically expressed in mammary cells (Figures 5A and 7A). In the breast cancer samples from the Uppsala cohort, p27 and YY1 gene expression did not show a negative correlation; rather, they exhibited a weak positive correlation (Figure 7B). These data suggest that overexpressed YY1 in breast cancer most likely regulates p27 at the posttranslational level. In contrast, with silenced endogenous YY1, we observed markedly elevated p27 mRNA levels in both MCF-7 and MDA-MB-231 cells (Figure 7A) and a significant increase in its protein stability59 (Figure 8B; see also Supplemental Figure S10B at http://ajp.amjpathol.org). This suggests that both enhanced p27 transcription and protein stabilization contribute to elevated p27 expression under YY1-depleted conditions. YY1 overexpression, but not its depletion, commonly occurs in most human cancers.7 Therefore, the stimulatory effect of YY1 on p27 ubiquitination likely contributes to its negative regulation of p27 stability in breast cell tumorigenesis. The half-life of p27 in MCF-10A cells was much longer than that of MCF-7 cells (see Supplemental Figure S10 at http://ajp.amjpathol.org). This is not surprising because p27 is primarily regulated by its stability through protein modifications.70 Unlike the regulation of Mdm2-mediated p53 ubiquitination by YY1, we did not observe a direct interaction between YY1 and Skp2, the E3 ligase of p27 (Figure 8E). In addition, the presence of Skp2 just modestly enhanced YY1-promoted p27 ubiquitination (Figure 8C). The mechanism underlying YY1-mediated p27 ubiquitination is unclear and deserves further investigation. Of note, we could successfully restore p27 levels in MCF-10A cells expressing ectopic YY1, even though YY1 antagonized p27 expression. A possible explanation for this result is that ectopically introduced p27 overwhelmed or saturated the antagonism caused by YY1 increase in these cells.

Although most of the literature indicated an oncogenic role of YY1 in tumorigenesis, several reports also suggested some likely anticancer activities of YY1. YY1 activated the transcription of HLJ1, a suppressor of tumor invasion,71 and positively regulated BRCA1.72 However, the reported cancer-promoting activities of YY1 clearly override its anticancer potential.8 We predict that the overall outcome of YY1-regulated processes relies on the oncogenic stimuli, cell types, and interplay with its recruited cofactors, the availability of which may be altered under different physiologic conditions.7

YY1 regulates multiple epigenetic processes that are involved in cancer development. Therefore, overexpressed YY1 in breast cancer likely contributes to its characteristic aberrant epigenetic changes. Unlike genetic alterations, epigenetic changes are mostly reversible. Therefore, it is possible to reverse epigenetic abnormality and reduce tumorigenicity of breast cancer by targeting YY1 or its regulated signaling pathways. This may help to achieve the ultimate goal of adjusting epigenetic regulation and reverting breast cancer cells to normal cells. Multiple recent studies have suggested the potential of YY1 as a therapeutic target in cancer. Our data show that YY1 depletion markedly reduced the clonogenicity of MCF-7 and MDA-MB-231 cells but did not substantially affect nontumorigenic MCF-10A cells. These observations suggest that targeting YY1 poses a minimal risk of damage to normal breast tissues.

Acknowledgments

We thank Dr. Kazushi Inoue and Karen Klein for critical reading of the manuscript, Drs. Kazushi Inoue, Darren Seals, and Iris Edwards for several reagents and for productive discussions, Dr. Mark C. Willingham and Kent Grant for assistance with the cell imaging studies, and Dr. Jun-ichi Miyazaki for providing the chicken β-actin promoter.

Footnotes

Supported by the Golfers Against Cancer Fund, the Kulynych Interdisciplinary Cancer Research Fund, the Startup Fund of Wake Forest University School of Medicine (G.S.), and grant RSG-09-082-01-MGO from the American Cancer Society (G.S.).

Supplemental material for this article can be found at http://ajp.amjpathol.org or at 10.1016/j.ajpath.2012.01.037.

Supplementary data

Supplemental Figure S1

YY1 expression in breast cells and tissues. A: Validation of specificity of YY1 antibody. MCF-7 cells were co-transfected with EGFP and either control shRNA or YY1 shRNA at a ratio of 1:5 (EGFP/shRNA). Three days after transfection, the cells were immunostained with YY1 (H-10) as the primary antibody. Yellow arrowheads indicate cells transfected with both EGFP and control shRNA, and pink arrowheads indicate cells containing both EGFP and YY1 shRNA. B and C: Immunohistochemical studies of MCF-10A and MCF-7 cells, and breast cancer tissues, respectively. Cultured MCF-10A cells, MCF-7 cells (B) and breast cancer tissues (C) were formalin-fixed and paraffin-embedded. The sections were subjected to immunohistochemical assays using YY1 (H-10) as the primary antibody (see Materials and Methods for details). D: Schema of the YY1 transcript. YY1 probes used in the gene array analyses are indicated on the top. The length (in nucleotides) is shown at the bottom. Sequences of these YY1 probes are as follows: 213494_S_AT, 5′-GAAGGGGCACACATAGGGCCTGTCTCCGGTATGGATTCGCACATGTGTGNGCAAANTTGAAGTCCAGTGAAAAGCGTTTCCCACAGCCTTCGAACGTGCACTGAAAGGGCTTCTCTCCAGTATGAACCAGTTGGTGTCGTTTTAGTTTTGAACTCTCAACAAAAGCTTTGCCACATTCTGCACAGACGTGGACTCTGGGACCGTGGGTGTGCAGATGTTTTCTCATGGCCGAGTTATCCCTGAACATCTTTGTGCAGCCTTTATGAGGGCAAGCTATTGTTCTTGGAGCATCATCTTCTTTAATTTTTCTTGGCTTCATTCTAGCAAATTCTGCCAGTTGTTTGGGATCTGAGAGGTCAATGCCAGGTATTCCTCCAGGAGGAAGTTTCTTTCCTGTCATATATTCTGAATAATCAGGAGGTGAGTTCTCTCCAATGATCTGTTCTTCAACCACTGTCTCATGGTCAATATCTTTTTTTTCATCTGAGGACCACATGGTGACCGAGAACTCGCCCTC-3′; 201901_S_AT, 5′-AGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCACGTTCGAAGGCTGTGGGAAACGCTTTTCACTGGACTTCAATTTGCGCACACATGTGCGAATCCATACCGGAGACAGGCCCTATGTGTGCCCCTTCGATGGTTGTAATAAGAAGTTTGCTCAGTCAACTAACCTGAAATCTCACATCTTAACACATGCTAAGGCCAAAAACAACCAGTGAAAAGAAGAGAGAAGACCCTTCTCGACCACGGGAAGCATCTTCCAGAAGTGTGATTGGGAATAAATATGCCTCTCCTTTGTATATTATTTCTAGGAAGAATTTTAAAAATGAATCCTACACACCTAAGGGACATG-3′; and 200047_S_AT, 5′-GGTTTTGTTTGCTATCTTAATTTTGGTTGTATTCTTTGATGTTAACACATTTTGTATAATTGTATCGTATAGCTGTATTGAATCATGTAGTATCAAATATTAGATGTGATTTAATAGTGTTAATCAATTTAAACCCATTTTAGTCACTTTTTTTTTCCAAAAAAATACTGCCAGATGCTGATGTTCAGTGTAATTTCTTTGCCTGTTCAGTTACAGAAAGTGGTGCTCAGTTGTAGAATGTATTGTACCTTTTAACACCTGATGTGTACATCCCATGTA-3′. E: Relative gene expression in samples from the Uppsala breast cancer cohort (258 patient samples). Relative expression of analyzed genes including YY1, Ezh2, HER2, ER-α, BRCA1, and Ki-67 are shown. A probe recognizing a sequence in Bacillus subtilis was used as a negative control, and probes for β-actin and GAPDH were positive controls. Average values of the lowest expressed 10% genes (low 10th percentile) and the highest expressed 10% genes (high 10th percentile) are shown.

mmc1.pdf (212.5KB, pdf)
Supplemental Figure S2

In vitro study to test the effects of YY1 knockdown on MDA-MB-231 cells. A: Migration assays of MDA-MB-231 cells with inducible-YY1 shRNA at days 1 and 3. B and C: Boyden chamber assay of MDA-MB-231 cells with inducible-H1 shRNAs. Average cell numbers in three random views at the indicated conditions are shown in B (*P < 0.05 versus other three groups). Representative images of trans-well migrated cells are shown in C. D: Representative Western blots of YY1 expression in these four cell groups.

mmc2.pdf (957KB, pdf)
Supplemental Figure S3

Clonogenic assays to determine the effects of YY1 knockdown on breast cells. MCF-10A cells (A) and MCF-7 cells (B) were infected with puromycin-resistant lentiviruses carrying control shRNA or YY1 shRNA. The puromycin-selected cells were seeded as indicated for clonogenic studies. Representative images of the stained dishes are shown under the graphs. Insets show Western blots indicating efficient YY1 knockdown.

mmc3.pdf (573.8KB, pdf)
Supplemental Figure S4

Cell cycle profile studies of mammary cells with manipulated YY1 expression. A: MCF-10A cells were infected with lentiviruses produced by pSL5 vector and pSL5/YY1. B: MCF-7 cells were infected with lentiviruses expressing control shRNA and YY1 shRNA, C: MDA-MB-231 cells integrated by inducible-YY1 shRNA were cultured in the absence and presence of Dox. Three days after these treatments, the cells were collected and treated for FACS analysis (see Materials and Methods). Western blots of YY1 expression in these cells are shown on the right. The experiments were repeated multiple times, and representative results are shown.

mmc4.pdf (222.3KB, pdf)
Supplemental Figure S5

Xenograft tumor volumes and images. A: Tumor volumes of xenografted MDA-MB-231 cells with inducible shRNAs in the absence and presence of Dox. B: Images at 4 weeks of xenograft tumors from Dox-treated mice. Mouse identifying numbers are labeled. L, left; R, right.

mmc5.pdf (759.5KB, pdf)
Supplemental Figure S6

Expression of YY1 and p27 in different breast cell lines. Cell lysates of breast cell lines were analyzed using Western blot analysis using YY1 (H-10), p27, and GAPDH antibodies. Two levels of exposure of the p27 immunoblot are shown.

mmc6.pdf (486KB, pdf)
Supplemental Figure S7

3-D Matrigel culture and cell proliferation rates of breast cell lines with manipulated YY1 expression. A: MCF-10A and MCF-7 cells cultured in 3-D Matrigel system. Magnified examples of MCF-10A cells forming spherical architecture are also shown. B: 3-D Matrigel culture of MCF-10A cells transduced with lentiviruses of pSL5 vector, pSL5/YY1, and pSL5/YY1 plus pSL9/p27. C and D: 3-D Matrigel culture of MCF-7 cells and MDA-MB-231 cells, respectively, transduced by lentiviruses with Dox-inducible YY1 shRNA in the absence and presence of Dox and with or without pLu-Neo-U6/p27 shRNA infection.

mmc7.pdf (936.3KB, pdf)
Supplemental Figure S8

Cell growth studies of MCF-10A and MCF-7 cells with manipulated YY1 and p27 expression. A and B: WST-1 assay of MCF-10A and MCF-7 cells, respectively, with manipulated YY1 and p27 expression. A: MCF-10A cells were individually infected with pSL5 and pSL5/YY1 lentiviruses, or pSL5/YY1 transduced cells were infected with pSL9/p27. B: MCF-7 cells transduced by inducible-YY1 shRNA were cultured either in the absence or presence of Dox or were further infected with lentivirus expressing p27 shRNA. Cell proliferation was determined using WST-1 assays. *P < 0.05. C and D: Proliferation rates of the cells in A and B plotted with vertical axes in a logarithmic scale.

mmc8.pdf (370KB, pdf)
Supplemental Figure S9

Reporter assay of YY1 on p27 promoter activity. A: Schema of p27 promoter reporter construct. B: Effects of ectopic YY1 expression on p27 promoter. The reporter plasmid was constructed by subcloning the EcoRI-SacI fragment of the p27 promoter (corresponding to the −1991 to +315, with the p27 transcription start site designated as +1) in front of Gaussia luciferase (Gluc). Data were derived from three independent experiments. *P = 0.02.

mmc9.pdf (244.3KB, pdf)
Supplemental Figure S10

Densitometric quantitation of p27 stability in the conditions of manipulated YY1 expression of Figures 8A and 8B. A: Relative p27 levels in MCF-10A cells transduced by pSL5 vector and pSL5/YY1, respectively. *P = 0.0066. The half-life of p27 in MCF-10A cells was reduced from approximately 45 hours to 12 hours by ectopic YY1 expression. B: Relative p27 levels in MCF-7 cells transduced by pLu-Puro-U6/control shRNA and pLu-Puro-U6/YY1 shRNA, respectively. *P = 0.0052. With YY1 depletion, the half-life of p27 in MCF-7 cells was increased from approximately 25 hours to a level that cannot be determined using this assay. MCF-10A cells and MCF-7 cells were treated with 60 μg/mL and 45 μg/mL cycloheximide, respectively, and collected at different times. Densitometric quantitation of Western blots was performed using Quantity One 4.2.2 software (Bio-Rad Laboratories). The relative p27 levels were normalized against the corresponding β-actin expression. The coordinate with a logarithmic y-axis (relative p27 levels) has been previously used.59

mmc10.pdf (251.7KB, pdf)

References

  • 1.Bjornsson H.T., Fallin M.D., Feinberg A.P. An integrated epigenetic and genetic approach to common human disease. Trends Genet. 2004;20:350–358. doi: 10.1016/j.tig.2004.06.009. [DOI] [PubMed] [Google Scholar]
  • 2.Deng C.X. BRCA1: cell cycle checkpoint, genetic instability, DNA damage response and cancer evolution. Nucleic Acids Res. 2006;34:1416–1426. doi: 10.1093/nar/gkl010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kopelovich L., Crowell J.A., Fay J.R. The epigenome as a target for cancer chemoprevention. J Natl Cancer Inst. 2003;95:1747–1757. doi: 10.1093/jnci/dig109. [DOI] [PubMed] [Google Scholar]
  • 4.Catteau A., Morris J.R. BRCA1 methylation: a significant role in tumour development? Semin Cancer Biol. 2002;12:359–371. doi: 10.1016/s1044-579x(02)00056-1. [DOI] [PubMed] [Google Scholar]
  • 5.Shi Y., Seto E., Chang L.S., Shenk T. Transcriptional repression by YY1, a human GLI-Kruppel–related protein, and relief of repression by adenovirus E1A protein. Cell. 1991;67:377–388. doi: 10.1016/0092-8674(91)90189-6. [DOI] [PubMed] [Google Scholar]
  • 6.Shi Y., Lee J.S., Galvin K.M. Everything you have ever wanted to know about Yin Yang 1. Biochim Biophys Acta. 1997;1332:F49–F66. doi: 10.1016/s0304-419x(96)00044-3. [DOI] [PubMed] [Google Scholar]
  • 7.Sui G. The regulation of YY1 in tumorigenesis and its targeting potential in cancer therapy. Mol Cell Pharmacol. 2009;1:157–176. [Google Scholar]
  • 8.Zhang Q., Stovall D.B., Inoue K., Sui G. The oncogenic role of Yin Yang 1. Crit Rev Oncog. 2011;16:163–197. doi: 10.1615/critrevoncog.v16.i3-4.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Thomas M.J., Seto E. Unlocking the mechanisms of transcription factor YY1: are chromatin modifying enzymes the key? Gene. 1999;236:197–208. doi: 10.1016/s0378-1119(99)00261-9. [DOI] [PubMed] [Google Scholar]
  • 10.Gordon S., Akopyan G., Garban H., Bonavida B. Transcription factor YY1: architecture, function, and therapeutic implications in cancer biology. Oncogene. 2006;25:1125–1142. doi: 10.1038/sj.onc.1209080. [DOI] [PubMed] [Google Scholar]
  • 11.Atchison L., Ghias A., Wilkinson F., Bonini N., Atchison M.L. Transcription factor YY1 functions as a PcG protein in vivo. EMBO J. 2003;22:1347–1358. doi: 10.1093/emboj/cdg124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Brown J.L., Mucci D., Whiteley M., Dirksen M.L., Kassis J.A. The Drosophila Polycomb group gene pleiohomeotic encodes a DNA binding protein with homology to the transcription factor YY1. Mol Cell. 1998;1:1057–1064. doi: 10.1016/s1097-2765(00)80106-9. [DOI] [PubMed] [Google Scholar]
  • 13.Wang L., Brown J.L., Cao R., Zhang Y., Kassis J.A., Jones R.S. Hierarchical recruitment of polycomb group silencing complexes. Mol Cell. 2004;14:637–646. doi: 10.1016/j.molcel.2004.05.009. [DOI] [PubMed] [Google Scholar]
  • 14.Sankar N., Baluchamy S., Kadeppagari R.K., Singhal G., Weitzman S., Thimmapaya B. p300 provides a corepressor function by cooperating with YY1 and HDAC3 to repress c-Myc. Oncogene. 2008;27:5717–5728. doi: 10.1038/onc.2008.181. [DOI] [PubMed] [Google Scholar]
  • 15.Zhou Q., Gedrich R.W., Engel D.A. Transcriptional repression of the c-Fos gene by YY1 is mediated by a direct interaction with ATF/CREB. J Virol. 1995;69:4323–4330. doi: 10.1128/jvi.69.7.4323-4330.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee J.S., Galvin K.M., See R.H., Eckner R., Livingston D., Moran E., Shi Y. Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300. Genes Dev. 1995;9:1188–1198. doi: 10.1101/gad.9.10.1188. [DOI] [PubMed] [Google Scholar]
  • 17.Yang W.M., Inouye C., Zeng Y., Bearss D., Seto E. Transcriptional repression by YY1 is mediated by interaction with a mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci USA. 1996;93:12845–12850. doi: 10.1073/pnas.93.23.12845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Caretti G., Di Padova M., Micales B., Lyons G.E., Sartorelli V. The Polycomb Ezh2 methyltransferase regulates muscle gene expression and skeletal muscle differentiation. Genes Dev. 2004;18:2627–2638. doi: 10.1101/gad.1241904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sui G., Affar el B., Shi Y., Brignone C., Wall N.R., Yin P., Donohoe M., Luke M.P., Calvo D., Grossman S.R., Shi Y. Yin Yang 1 is a negative regulator of p53. Cell. 2004;117:859–872. doi: 10.1016/j.cell.2004.06.004. [DOI] [PubMed] [Google Scholar]
  • 20.Petkova V., Romanowski M.J., Sulijoadikusumo I., Rohne D., Kang P., Shenk T., Usheva A. Interaction between YY1 and the retinoblastoma protein: regulation of cell cycle progression in differentiated cells. J Biol Chem. 2001;276:7932–7936. doi: 10.1074/jbc.M007411200. [DOI] [PubMed] [Google Scholar]
  • 21.Cunningham J.T., Rodgers J.T., Arlow D.H., Vazquez F., Mootha V.K., Puigserver P. mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha transcriptional complex. Nature. 2007;450:736–740. doi: 10.1038/nature06322. [DOI] [PubMed] [Google Scholar]
  • 22.Gronroos E., Terentiev A.A., Punga T., Ericsson J. YY1 inhibits the activation of the p53 tumor suppressor in response to genotoxic stress. Proc Natl Acad Sci USA. 2004;101:12165–12170. doi: 10.1073/pnas.0402283101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Begon D.Y., Delacroix L., Vernimmen D., Jackers P., Winkler R. Yin Yang 1 cooperates with activator protein 2 to stimulate ERBB2 gene expression in mammary cancer cells. J Biol Chem. 2005;280:24428–24434. doi: 10.1074/jbc.M503790200. [DOI] [PubMed] [Google Scholar]
  • 24.Allouche A., Nolens G., Tancredi A., Delacroix L., Mardaga J., Fridman V., Winkler R., Boniver J., Delvenne P., Begon D.Y. The combined immunodetection of AP-2alpha and YY1 transcription factors is associated with ERBB2 gene overexpression in primary breast tumors. Breast Cancer Res. 2008;10:R9. doi: 10.1186/bcr1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Harari D., Yarden Y. Molecular mechanisms underlying ErbB2/HER2 action in breast cancer. Oncogene. 2000;19:6102–6114. doi: 10.1038/sj.onc.1203973. [DOI] [PubMed] [Google Scholar]
  • 26.Huang W., Smaldino P.J., Zhang Q., Miller L.D., Cao P., Stadelman K., Wan M., Giri B., Lei M., Nagamine Y., Vaughn J.P., Akman S.A., Sui G. Yin Yang 1 contains G-quadruplex architectures in its promoter and 5′-UTR and its expression is modulated by G4 resolvase 1. Nucleic Acids Res. 2011;40:1033–1049. doi: 10.1093/nar/gkr849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zaravinos A., Spandidos D.A. Yin Yang 1 expression in human tumors. Cell Cycle. 2010;9:512–522. doi: 10.4161/cc.9.3.10588. [DOI] [PubMed] [Google Scholar]
  • 28.Castellano G., Torrisi E., Ligresti G., Malaponte G., Militello L., Russo A.E., McCubrey J.A., Canevari S., Libra M. The involvement of the transcription factor Yin Yang 1 in cancer development and progression. Cell Cycle. 2009;8:1367–1372. doi: 10.4161/cc.8.9.8314. [DOI] [PubMed] [Google Scholar]
  • 29.Niwa H., Yamamura K., Miyazaki J. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene. 1991;108:193–199. doi: 10.1016/0378-1119(91)90434-d. [DOI] [PubMed] [Google Scholar]
  • 30.Sui G., Soohoo C., Affar el B., Gay F., Shi Y., Forrester W.C., Shi Y. A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proc Natl Acad Sci USA. 2002;99:5515–5520. doi: 10.1073/pnas.082117599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sui G., Shi Y. Gene silencing by a DNA vector-based RNAi technology. Methods Mol Biol. 2005;309:205–218. doi: 10.1385/1-59259-935-4:205. [DOI] [PubMed] [Google Scholar]
  • 32.Elenbaas B., Spirio L., Koerner F., Fleming M.D., Zimonjic D.B., Donaher J.L., Popescu N.C., Hahn W.C., Weinberg R.A. Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev. 2001;15:50–65. doi: 10.1101/gad.828901. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Soule H.D., Maloney T.M., Wolman S.R., Peterson W.D., Jr, Brenz R., McGrath C.M., Russo J., Pauley R.J., Jones R.F., Brooks S.C. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line. MCF-10. Cancer Res. 1990;50:6075–6086. [PubMed] [Google Scholar]
  • 34.Dickson R.B., Bates S.E., McManaway M.E., Lippman M.E. Characterization of estrogen responsive transforming activity in human breast cancer cell lines. Cancer Res. 1986;46:1707–1713. [PubMed] [Google Scholar]
  • 35.Cailleau R., Olive M., Cruciger Q.V. Long-term human breast carcinoma cell lines of metastatic origin: preliminary characterization. In Vitro. 1978;14:911–915. doi: 10.1007/BF02616120. [DOI] [PubMed] [Google Scholar]
  • 36.Rubinson D.A., Dillon C.P., Kwiatkowski A.V., Sievers C., Yang L., Kopinja J., Rooney D.L., Ihrig M.M., McManus M.T., Gertler F.B., Scott M.L., Van Parijs L. A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat Genet. 2003;33:401–406. doi: 10.1038/ng1117. [DOI] [PubMed] [Google Scholar]
  • 37.Stackhouse B.L., Williams H., Berry P., Russell G., Thompson P., Winter J.L., Kute T. Measurement of glut-1 expression using tissue microarrays to determine a race-specific prognostic marker for breast cancer. Breast Cancer Res Treat. 2005;93:247–253. doi: 10.1007/s10549-005-5158-y. [DOI] [PubMed] [Google Scholar]
  • 38.Winter J.L., Stackhouse B.L., Russell G.B., Kute T.E. Measurement of PTEN expression using tissue microarrays to determine a race-specific prognostic marker in breast cancer. Arch Pathol Lab Med. 2007;131:767–772. doi: 10.5858/2007-131-767-MOPEUT. [DOI] [PubMed] [Google Scholar]
  • 39.Cao P., Deng Z., Wan M., Huang W., Cramer S.D., Xu J., Lei M., Sui G. MicroRNA-101 negatively regulates Ezh2, and its expression is modulated by androgen receptor and HIF-1alpha/HIF-1beta. Mol Cancer. 2010;9:108. doi: 10.1186/1476-4598-9-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Burger K.L., Davis A.L., Isom S., Mishra N., Seals D.F. The podosome marker protein Tks5 regulates macrophage invasive behavior. Cytoskeleton (Hoboken) 2011;68:694–711. doi: 10.1002/cm.20545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Benton G., George J. Defining 3-D culture for investigating breast cancer progression. Biosci Technol. 2005;1:50–52. [Google Scholar]
  • 42.Debnath J., Muthuswamy S.K., Brugge J.S. Morphogenesis and oncogenesis of MCF-10A mammary epithelial acini grown in three-dimensional basement membrane cultures. Methods. 2003;30:256–268. doi: 10.1016/s1046-2023(03)00032-x. [DOI] [PubMed] [Google Scholar]
  • 43.Tomayko M.M., Reynolds C.P. Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemother Pharmacol. 1989;24:148–154. doi: 10.1007/BF00300234. [DOI] [PubMed] [Google Scholar]
  • 44.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔ CT Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 45.Deng Z., Wan M., Sui G. PIASy-mediated sumoylation of Yin Yang 1 depends on their interaction but not the RING finger. Mol Cell Biol. 2007;27:3780–3792. doi: 10.1128/MCB.01761-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Pan Y., Chen J. MDM2 promotes ubiquitination and degradation of MDMX. Mol Cell Biol. 2003;23:5113–5121. doi: 10.1128/MCB.23.15.5113-5121.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Kleer C.G., Cao Q., Varambally S., Shen R., Ota I., Tomlins S.A., Ghosh D., Sewalt R.G., Otte A.P., Hayes D.F., Sabel M.S., Livant D., Weiss S.J., Rubin M.A., Chinnaiyan A.M. EZH2 is a marker of aggressive breast cancer and promotes neoplastic transformation of breast epithelial cells. Proc Natl Acad Sci USA. 2003;100:11606–11611. doi: 10.1073/pnas.1933744100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Calza S., Hall P., Auer G., Bjohle J., Klaar S., Kronenwett U., Liu E.T., Miller L., Ploner A., Smeds J., Bergh J., Pawitan Y. Intrinsic molecular signature of breast cancer in a population-based cohort of 412 patients. Breast Cancer Res. 2006;8:R34. doi: 10.1186/bcr1517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Cheng A.S., Culhane A.C., Chan M.W., Venkataramu C.R., Ehrich M., Nasir A., Rodriguez B.A., Liu J., Yan P.S., Quackenbush J., Nephew K.P., Yeatman T.J., Huang T.H. Epithelial progeny of estrogen-exposed breast progenitor cells display a cancer-like methylome. Cancer Res. 2008;68:1786–1796. doi: 10.1158/0008-5472.CAN-07-5547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Miller L.D., Smeds J., George J., Vega V.B., Vergara L., Ploner A., Pawitan Y., Hall P., Klaar S., Liu E.T., Bergh J. An expression signature for p53 status in human breast cancer predicts mutation status, transcriptional effects, and patient survival. Proc Natl Acad Sci USA. 2005;102:13550–13555. doi: 10.1073/pnas.0506230102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bain M., Sinclair J. Targeted inhibition of the transcription factor YY1 in an embryonal carcinoma cell line results in retarded cell growth, elevated levels of p53 but no increase in apoptotic cell death. Eur J Cell Biol. 2005;84:543–553. doi: 10.1016/j.ejcb.2004.12.024. [DOI] [PubMed] [Google Scholar]
  • 52.Santiago F.S., Ishii H., Shafi S., Khurana R., Kanellakis P., Bhindi R., Ramirez M.J., Bobik A., Martin J.F., Chesterman C.N., Zachary I.C., Khachigian L.M. Yin Yang-1 inhibits vascular smooth muscle cell growth and intimal thickening by repressing p21WAF1/Cip1 transcription and p21WAF1/Cip1-Cdk4-cyclin D1 assembly. Circ Res. 2007;101:146–155. doi: 10.1161/CIRCRESAHA.106.145235. [DOI] [PubMed] [Google Scholar]
  • 53.Yakovleva T., Kolesnikova L., Vukojevic V., Gileva I., Tan-No K., Austen M., Luscher B., Ekstrom T.J., Terenius L., Bakalkin G. YY1 binding to a subset of p53 DNA-target sites regulates p53-dependent transcription. Biochem Biophys Res Commun. 2004;318:615–624. doi: 10.1016/j.bbrc.2004.04.065. [DOI] [PubMed] [Google Scholar]
  • 54.Baker L., Quinlan P.R., Patten N., Ashfield A., Birse-Stewart-Bell L.J., McCowan C., Bourdon J.C., Purdie C.A., Jordan L.B., Dewar J.A., Wu L., Thompson A.M. p53 mutation, deprivation and poor prognosis in primary breast cancer. Br J Cancer. 2010;102:719–726. doi: 10.1038/sj.bjc.6605540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Alkarain A., Slingerland J. Deregulation of p27 by oncogenic signaling and its prognostic significance in breast cancer. Breast Cancer Res. 2004;6:13–21. doi: 10.1186/bcr722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Guan X., Wang Y., Xie R., Chen L., Bai J., Lu J., Kuo M.T. p27(Kip1) as a prognostic factor in breast cancer: a systematic review and meta-analysis. J Cell Mol Med. 2010;14:944–953. doi: 10.1111/j.1582-4934.2009.00730.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Belletti B., Pellizzari I., Berton S., Fabris L., Wolf K., Lovat F., Schiappacassi M., D'Andrea S., Nicoloso M.S., Lovisa S., Sonego M., Defilippi P., Vecchione A., Colombatti A., Friedl P., Baldassarre G. p27kip1 controls cell morphology and motility by regulating microtubule-dependent lipid raft recycling. Mol Cell Biol. 2010;30:2229–2240. doi: 10.1128/MCB.00723-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Abukhdeir A.M., Park B.H. P21 and p27: roles in carcinogenesis and drug resistance. Expert Rev Mol Med. 2008;10:e19. doi: 10.1017/S1462399408000744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Chu I., Sun J., Arnaout A., Kahn H., Hanna W., Narod S., Sun P., Tan C.K., Hengst L., Slingerland J. p27 phosphorylation by Src regulates inhibition of cyclin E–Cdk2. Cell. 2007;128:281–294. doi: 10.1016/j.cell.2006.11.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Carrano A.C., Eytan E., Hershko A., Pagano M. SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat Cell Biol. 1999;1:193–199. doi: 10.1038/12013. [DOI] [PubMed] [Google Scholar]
  • 61.Tsvetkov L.M., Yeh K.H., Lee S.J., Sun H., Zhang H. p27(Kip1) ubiquitination and degradation is regulated by the SCF(Skp2) complex through phosphorylated Thr187 in p27. Curr Biol. 1999;9:661–664. doi: 10.1016/s0960-9822(99)80290-5. [DOI] [PubMed] [Google Scholar]
  • 62.Powe D.G., Akhtar G., Habashy H.O., Abdel-Fatah T., Rakha E.A., Green A.R., Ellis I.O. Investigating AP-2 and YY1 protein expression as a cause of high HER2 gene transcription in breast cancers with discordant HER2 gene amplification. Breast Cancer Res. 2009;11:R90. doi: 10.1186/bcr2461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Seligson D., Horvath S., Huerta-Yepez S., Hanna S., Garban H., Roberts A., Shi T., Liu X., Chia D., Goodglick L., Bonavida B. Expression of transcription factor Yin Yang 1 in prostate cancer. Int J Oncol. 2005;27:131–141. [PubMed] [Google Scholar]
  • 64.Nelson C.M., Bissell M.J. Modeling dynamic reciprocity: engineering three-dimensional culture models of breast architecture, function, and neoplastic transformation. Semin Cancer Biol. 2005;15:342–352. doi: 10.1016/j.semcancer.2005.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Martin K.J., Patrick D.R., Bissell M.J., Fournier M.V. Prognostic breast cancer signature identified from 3-D culture model accurately predicts clinical outcome across independent datasets. PLoS One. 2008;3:e2994. doi: 10.1371/journal.pone.0002994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Ciardiello F., Gottardis M., Basolo F., Pepe S., Normanno N., Dickson R.B., Bianco A.R., Salomon D.S. Additive effects of c-erbB-2, c-Ha-ras, and transforming growth factor-alpha genes on in vitro transformation of human mammary epithelial cells. Mol Carcinog. 1992;6:43–52. doi: 10.1002/mc.2940060108. [DOI] [PubMed] [Google Scholar]
  • 67.Dimri M., Naramura M., Duan L., Chen J., Ortega-Cava C., Chen G., Goswami R., Fernandes N., Gao Q., Dimri G.P., Band V., Band H. Modeling breast cancer-associated c-Src and EGFR overexpression in human MECs: c-Src and EGFR cooperatively promote aberrant three-dimensional acinar architecture and invasive behavior. Cancer Res. 2007;67:4164–4172. doi: 10.1158/0008-5472.CAN-06-2580. [DOI] [PubMed] [Google Scholar]
  • 68.Deng Z., Wan M., Cao P., Rao A., Cramer S.D., Sui G. Yin Yang 1 regulates the transcriptional activity of androgen receptor. Oncogene. 2009;28:3746–3757. doi: 10.1038/onc.2009.231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Deng Z., Cao P., Wan M., Sui G. Yin Yang 1: a multifaceted protein beyond a transcription factor. Transcription. 2010;1:81–84. doi: 10.4161/trns.1.2.12375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Vervoorts J., Luscher B. Post-translational regulation of the tumor suppressor p27(KIP1) Cell Mol Life Sci. 2008;65:3255–3264. doi: 10.1007/s00018-008-8296-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Wang C.C., Tsai M.F., Dai T.H., Hong T.M., Chan W.K., Chen J.J., Yang P.C. Synergistic activation of the tumor suppressor HLJ1 by the transcription factors YY1 and activator protein 1. Cancer Res. 2007;67:4816–4826. doi: 10.1158/0008-5472.CAN-07-0504. [DOI] [PubMed] [Google Scholar]
  • 72.Lee M.H., Lahusen T., Wang R.H., Xiao C., Xu X., Hwang Y.S., He W.W., Shi Y., Deng C.X. Yin Yang 1 positively regulates BRCA1 and inhibits mammary cancer formation. Oncogene. 2012;31:116–127. doi: 10.1038/onc.2011.217. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Figure S1

YY1 expression in breast cells and tissues. A: Validation of specificity of YY1 antibody. MCF-7 cells were co-transfected with EGFP and either control shRNA or YY1 shRNA at a ratio of 1:5 (EGFP/shRNA). Three days after transfection, the cells were immunostained with YY1 (H-10) as the primary antibody. Yellow arrowheads indicate cells transfected with both EGFP and control shRNA, and pink arrowheads indicate cells containing both EGFP and YY1 shRNA. B and C: Immunohistochemical studies of MCF-10A and MCF-7 cells, and breast cancer tissues, respectively. Cultured MCF-10A cells, MCF-7 cells (B) and breast cancer tissues (C) were formalin-fixed and paraffin-embedded. The sections were subjected to immunohistochemical assays using YY1 (H-10) as the primary antibody (see Materials and Methods for details). D: Schema of the YY1 transcript. YY1 probes used in the gene array analyses are indicated on the top. The length (in nucleotides) is shown at the bottom. Sequences of these YY1 probes are as follows: 213494_S_AT, 5′-GAAGGGGCACACATAGGGCCTGTCTCCGGTATGGATTCGCACATGTGTGNGCAAANTTGAAGTCCAGTGAAAAGCGTTTCCCACAGCCTTCGAACGTGCACTGAAAGGGCTTCTCTCCAGTATGAACCAGTTGGTGTCGTTTTAGTTTTGAACTCTCAACAAAAGCTTTGCCACATTCTGCACAGACGTGGACTCTGGGACCGTGGGTGTGCAGATGTTTTCTCATGGCCGAGTTATCCCTGAACATCTTTGTGCAGCCTTTATGAGGGCAAGCTATTGTTCTTGGAGCATCATCTTCTTTAATTTTTCTTGGCTTCATTCTAGCAAATTCTGCCAGTTGTTTGGGATCTGAGAGGTCAATGCCAGGTATTCCTCCAGGAGGAAGTTTCTTTCCTGTCATATATTCTGAATAATCAGGAGGTGAGTTCTCTCCAATGATCTGTTCTTCAACCACTGTCTCATGGTCAATATCTTTTTTTTCATCTGAGGACCACATGGTGACCGAGAACTCGCCCTC-3′; 201901_S_AT, 5′-AGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCACGTTCGAAGGCTGTGGGAAACGCTTTTCACTGGACTTCAATTTGCGCACACATGTGCGAATCCATACCGGAGACAGGCCCTATGTGTGCCCCTTCGATGGTTGTAATAAGAAGTTTGCTCAGTCAACTAACCTGAAATCTCACATCTTAACACATGCTAAGGCCAAAAACAACCAGTGAAAAGAAGAGAGAAGACCCTTCTCGACCACGGGAAGCATCTTCCAGAAGTGTGATTGGGAATAAATATGCCTCTCCTTTGTATATTATTTCTAGGAAGAATTTTAAAAATGAATCCTACACACCTAAGGGACATG-3′; and 200047_S_AT, 5′-GGTTTTGTTTGCTATCTTAATTTTGGTTGTATTCTTTGATGTTAACACATTTTGTATAATTGTATCGTATAGCTGTATTGAATCATGTAGTATCAAATATTAGATGTGATTTAATAGTGTTAATCAATTTAAACCCATTTTAGTCACTTTTTTTTTCCAAAAAAATACTGCCAGATGCTGATGTTCAGTGTAATTTCTTTGCCTGTTCAGTTACAGAAAGTGGTGCTCAGTTGTAGAATGTATTGTACCTTTTAACACCTGATGTGTACATCCCATGTA-3′. E: Relative gene expression in samples from the Uppsala breast cancer cohort (258 patient samples). Relative expression of analyzed genes including YY1, Ezh2, HER2, ER-α, BRCA1, and Ki-67 are shown. A probe recognizing a sequence in Bacillus subtilis was used as a negative control, and probes for β-actin and GAPDH were positive controls. Average values of the lowest expressed 10% genes (low 10th percentile) and the highest expressed 10% genes (high 10th percentile) are shown.

mmc1.pdf (212.5KB, pdf)
Supplemental Figure S2

In vitro study to test the effects of YY1 knockdown on MDA-MB-231 cells. A: Migration assays of MDA-MB-231 cells with inducible-YY1 shRNA at days 1 and 3. B and C: Boyden chamber assay of MDA-MB-231 cells with inducible-H1 shRNAs. Average cell numbers in three random views at the indicated conditions are shown in B (*P < 0.05 versus other three groups). Representative images of trans-well migrated cells are shown in C. D: Representative Western blots of YY1 expression in these four cell groups.

mmc2.pdf (957KB, pdf)
Supplemental Figure S3

Clonogenic assays to determine the effects of YY1 knockdown on breast cells. MCF-10A cells (A) and MCF-7 cells (B) were infected with puromycin-resistant lentiviruses carrying control shRNA or YY1 shRNA. The puromycin-selected cells were seeded as indicated for clonogenic studies. Representative images of the stained dishes are shown under the graphs. Insets show Western blots indicating efficient YY1 knockdown.

mmc3.pdf (573.8KB, pdf)
Supplemental Figure S4

Cell cycle profile studies of mammary cells with manipulated YY1 expression. A: MCF-10A cells were infected with lentiviruses produced by pSL5 vector and pSL5/YY1. B: MCF-7 cells were infected with lentiviruses expressing control shRNA and YY1 shRNA, C: MDA-MB-231 cells integrated by inducible-YY1 shRNA were cultured in the absence and presence of Dox. Three days after these treatments, the cells were collected and treated for FACS analysis (see Materials and Methods). Western blots of YY1 expression in these cells are shown on the right. The experiments were repeated multiple times, and representative results are shown.

mmc4.pdf (222.3KB, pdf)
Supplemental Figure S5

Xenograft tumor volumes and images. A: Tumor volumes of xenografted MDA-MB-231 cells with inducible shRNAs in the absence and presence of Dox. B: Images at 4 weeks of xenograft tumors from Dox-treated mice. Mouse identifying numbers are labeled. L, left; R, right.

mmc5.pdf (759.5KB, pdf)
Supplemental Figure S6

Expression of YY1 and p27 in different breast cell lines. Cell lysates of breast cell lines were analyzed using Western blot analysis using YY1 (H-10), p27, and GAPDH antibodies. Two levels of exposure of the p27 immunoblot are shown.

mmc6.pdf (486KB, pdf)
Supplemental Figure S7

3-D Matrigel culture and cell proliferation rates of breast cell lines with manipulated YY1 expression. A: MCF-10A and MCF-7 cells cultured in 3-D Matrigel system. Magnified examples of MCF-10A cells forming spherical architecture are also shown. B: 3-D Matrigel culture of MCF-10A cells transduced with lentiviruses of pSL5 vector, pSL5/YY1, and pSL5/YY1 plus pSL9/p27. C and D: 3-D Matrigel culture of MCF-7 cells and MDA-MB-231 cells, respectively, transduced by lentiviruses with Dox-inducible YY1 shRNA in the absence and presence of Dox and with or without pLu-Neo-U6/p27 shRNA infection.

mmc7.pdf (936.3KB, pdf)
Supplemental Figure S8

Cell growth studies of MCF-10A and MCF-7 cells with manipulated YY1 and p27 expression. A and B: WST-1 assay of MCF-10A and MCF-7 cells, respectively, with manipulated YY1 and p27 expression. A: MCF-10A cells were individually infected with pSL5 and pSL5/YY1 lentiviruses, or pSL5/YY1 transduced cells were infected with pSL9/p27. B: MCF-7 cells transduced by inducible-YY1 shRNA were cultured either in the absence or presence of Dox or were further infected with lentivirus expressing p27 shRNA. Cell proliferation was determined using WST-1 assays. *P < 0.05. C and D: Proliferation rates of the cells in A and B plotted with vertical axes in a logarithmic scale.

mmc8.pdf (370KB, pdf)
Supplemental Figure S9

Reporter assay of YY1 on p27 promoter activity. A: Schema of p27 promoter reporter construct. B: Effects of ectopic YY1 expression on p27 promoter. The reporter plasmid was constructed by subcloning the EcoRI-SacI fragment of the p27 promoter (corresponding to the −1991 to +315, with the p27 transcription start site designated as +1) in front of Gaussia luciferase (Gluc). Data were derived from three independent experiments. *P = 0.02.

mmc9.pdf (244.3KB, pdf)
Supplemental Figure S10

Densitometric quantitation of p27 stability in the conditions of manipulated YY1 expression of Figures 8A and 8B. A: Relative p27 levels in MCF-10A cells transduced by pSL5 vector and pSL5/YY1, respectively. *P = 0.0066. The half-life of p27 in MCF-10A cells was reduced from approximately 45 hours to 12 hours by ectopic YY1 expression. B: Relative p27 levels in MCF-7 cells transduced by pLu-Puro-U6/control shRNA and pLu-Puro-U6/YY1 shRNA, respectively. *P = 0.0052. With YY1 depletion, the half-life of p27 in MCF-7 cells was increased from approximately 25 hours to a level that cannot be determined using this assay. MCF-10A cells and MCF-7 cells were treated with 60 μg/mL and 45 μg/mL cycloheximide, respectively, and collected at different times. Densitometric quantitation of Western blots was performed using Quantity One 4.2.2 software (Bio-Rad Laboratories). The relative p27 levels were normalized against the corresponding β-actin expression. The coordinate with a logarithmic y-axis (relative p27 levels) has been previously used.59

mmc10.pdf (251.7KB, pdf)

Articles from The American Journal of Pathology are provided here courtesy of American Society for Investigative Pathology

RESOURCES