Abstract
JUNB inactivation in transgenic mice results in a myeloproliferative disorder that closely resembles human chronic myelogenous leukemia (CML). It has been reported that downregulation of JUNB expression is a universal phenomenon in patients with CML due aberrant DNA methylation of its promoter. Based on this, we studied methylation and gene expression levels of JUNB in CML. We analyzed the methylation status of the JUNB gene in 6 cell lines and in 102 patients with CML using several bisulfite PCR assays. JUNB expression was analyzed using real-time PCR and gene expression profiling. JUNB methylation was not observed in any of the cell lines studied, and only in 3% of patients with CML. Despite the lack of JUNB methylation, JUNB was expressed at low levels both in CML cell lines (median dCT −6.86; range −5.87 to −9.61), and in patients with CML in blastic phase (BP) (median dCT −3.95; range −1.48 to −6.29) (p=0.002). Finally, we evaluated JUNB expression in 82 additional patients with CML by gene expression arrays. We found that JUNB was significantly downregulated in advanced phase CML in contrast to chronic phase CML (median log ratio difference in expression = 0.53). Overall, our results indicate that JUNB expression is downregulated in advanced phase CML through a mechanism independent from DNA methylation.
Keywords: JUNB, DNA methylation, chronic myelogenous leukemia
Introduction
The transcription factor activator protein 1 (AP-1) comprises a group of hetero and homodimeric basic region-leucine zipper (bZIP) proteins that belong to the JUN (c-JUN, JUNB, JUND), FOS (c-FOS, FOSB, FRA-1 and FRA-2), MAF (c-MAF, MAFB, MAFA, MAFG/F/K and NRL) and ATF (ATF2, LRF1/ATF3, B-ATF, JDP1, JDP2) subfamilies (1, 2). Although structurally similar to the other JUN genes, JUNB exhibits weaker DNA-binding affinity to AP-1 DNA recognition elements and has been shown to exert both transactivator and transrepressor effects depending on the promoter context and on the heterodimerization partner (3, 4). The knockout of JUNB in mice results in early embryonic lethality, while constitutive overexpression of JUNB under the control of the human Ubiquitin-C promoter (Ubi) has no major consequences in Ubi-JUNB transgenic mice (5). JUNB suppresses cell proliferation by direct transcriptional activation of the cyclin-dependent kinase inhibitor p16INK4a (6), repression of cyclin D1, a component of the G1 cyclin−cyclin-dependent kinase complex (7), and regulation of the expression of BCL-2 and BCLx (6, 8). The balance between the antagonistic biological effects exerted by JUNB and c-JUN during mitosis is fundamental for the regulation of cell cycle progression (7). Furthermore, JUNB is a crucial transcriptional regulator of myelopoiesis and its expression plays a role in the initiation, progression and maintenance of the myeloid differentiation program (8, 9). JUNB is constitutively expressed in human peripheral blood mature granulocytes and its expression is strongly induced following terminal differentiation of bone marrow myeloid precursors and established myeloid cell lines (9, 10). JUNB overexpression results in suppression of RAS- and SRC-induced tumor growth in vivo, suggesting a role of JUNB as a tumor suppressor gene. Moreover, c-JUN binds to and represses the promoter of the tumor suppressor gene p53, followed by downregulation of its target gene the CDK inhibitor p21, whereas lack of expression of c-JUN upregulates p53 and p21 expression and accelerates cell proliferation (11). Several reports have shown that JUNB inhibits c-JUN-mediated transactivation and transforming activity (11–13) and promotes growth arrest and differentiation (14–16).
Further in vivo evidence supporting the function of JUNB as tumor suppressor gene has been provided by JUNB−/−Ubi-JUNB transgenic mice generated by intercrossing JUNB+/− animals carrying the Ubi-JUNB transgene (8). These animals develop a transplantable myeloproliferative disorder (MPD) that strikingly resembles CML, including progression to blastic phase (BP) (8). Notably, JUNB inactivation specifically expands the number of long-term hematopoietic stem cells (LT-HSC) and granulocyte/macrophage progenitors resulting in a chronic MPD (17). Inactivation of JUNB expression has been previously reported in some human CML patients although the mechanism whereby this gene is inactivated has remained elusive (18). A report in 32 patients with CML indicated that most of the CpG sites in the promoter area of JUNB were methylated, suggesting that this epigenetic mechanism was responsible for JUNB silencing in 100% of the patients evaluated (19). In view of the implications of JUNB silencing in murine models, and the aforementioned report suggesting universal methylation-induced JUNB inactivation in a small cohort of patients, we evaluated the incidence of JUNB aberrant DNA methylation in CML-derived cell lines and in 102 patients with CML. We also determined JUNB mRNA expression by reverse transcription polymerase chain reaction (RT-PCR) in 27 patients with CML and validated these results analyzing JUNB gene expression in a separate cohort of 82 patients with CML by cDNA microarray analysis.
Materials and methods
Analysis of DNA methylation and cell lines
DNA methylation was analyzed using 3 different bisulfite polymerase chain reaction (PCR) assays mapping 2 different genomic areas in the proximity of the JUNB transcription start site (Figure 1A). Region 1 was the area originally studied by Yang et al (19). This region was analyzed using the same methylation specific PCR (MSP) assay used by Yang et al (19), and also by a second bisulfite PCR assay, developed by us, using the combined bisulfite PCR restriction analysis (COBRA) (20) (figure 1A). To further study the promoter region of JUNB, we developed a second COBRA assay mapping region 2 (figure 1A) Bisulfite treatment of DNA (and PCR conditions used) have been previously described (21). Bisulfite-modified DNA was amplified by PCR using primer sets designed specifically for the promoter region of JUNB gene. Characteristics of the primers are shown in Table 1. In selected cases, methylation was analyzed also using bisulfite sequencing as previously described (21).
Figure 1. JunB DNA methylation in CML.

(A) Map of the JUNB gene. Each vertical line represents a CpG site. The arrow the transcription start site. The vertical lines on top, the restriction sites for HpyCH4 IV and Taq I respectively. The solid black lines below indicate the regions analyzed using bisulfite PCR and RT-PCR assays. (B) MSP analysis of JUNB in CML. This was the original assay used by Yang et al (19). U: non-methylated reaction; M: methylated reaction. The number on top represents the sample number. SssI the artificially methylated positive control. MW: the molecular weight marker (a 50 bp ladder was used). As shown none of the samples was methylated. (C) COBRA analysis of JUNB methylation in CML in region 1 (top) and region 2 (bottom). The number on top indicate the patient sample. SssI the artificially methylated positive control. MW the molecular weight marker. The arrows on the right indicate the restricted (M, methylated) and unrestricted (UM, unmehylated) PCR products. The figure on the right indicated molecular weight.
Table 1. Primer characteristics.
JUNB GeneBank accession number: U20734. Region refers to the area analyzed as shown in figure 1A. MSP (methylation sensitive PCR), M (methlyated primers), UM (unmethylated). Primer sequences are shown in a 5′ to 3′ orientation. F, forward sequence. R, reverse sequence. Primer locations are provided in relation to the translation start site. In parentheses the expected size of the restricted (methylated) fragments.
| Region | Assay | Sequence | Restriction enzyme | Primer location | Expected Size (bp) |
|---|---|---|---|---|---|
| 1 | MSP (UM) | F:GACGTTAGGAAAGTTATCGC R:CGAACTAAATACCTAATCGCG |
N/A | F: −224 to −205 R: −109 to −89 |
182 |
| 1 | MSP (M) | F:TTGGGGGAAATGATGTTAGGAAAGTTATTGT R:ACTACAACAAACAACAAACTCTCCACTACA |
N/A | F: −235 to −205 R: −83 to −54 |
136 |
| 1 | COBRA | F:AGGGTTTTTGYGTATAGTTGT R:CCCAAACRATCTAAAAAAAA |
Taq I | F: −169 to 149 R: −28 to −9 |
161 (108) |
| 2 | COBRA | F:GAAATTTTTTATTTATGTGTTTGGGTTTT R:CCTAAACCACACRCCTTTATACC |
HpyCH4IV | F: −563 to −535 R: −319 to −297 |
267 (169) |
The following cell lines were studied for DNA methylation: K562, K562R, BV173, BV173R, Raji and HL-60. These cell lines were provided by Drs N. Donato and M. Beran (MD Anderson Cancer Center) and were maintain following standard conditions.
Gene expression analysis in samples analyzed for DNA methylation
The levels of JUNB mRNA in cell lines and patients with CML previously studied for DNA methylation status were studied. For this analysis, the following cell lines were used: K562, K562R, BV173, BV173R, Raji and HL-60. mRNA expression was analyzed using commercially available primers (Applied Biosystems, Foster City, CA) and the conditions recommend by the manufacturer for real-time (RT) PCR using an ABI7000 sequencer (Applied Biosystems, Foster City, CA). Because JUNB has only one exon, RNA was treated with DNAase I prior to cDNA conversion to prevent false positive amplification arising from DNA contamination of the sample mRNA.
Analysis of JUNB mRNA expression using cDNA arrays
To further determine the expression levels of JUNB mRNA in patients with CML, a second cohort of patients with CML previously studied by ink-jet oligonucleotide array technology gene expression arrays was examined (22). RNA amplification, labeling and hybridization to hu25k ink jet DNA microarrays have been previous described (23, 24). These CML samples were examined for JUNB expression comparing the expression level of JUNB in each CML sample to the JUNB expression in the pool of 200 samples from patients with CP-CML.
Results
Frequency of JUNB DNA methylation in CML
JunB methylation was studied in the following cell lines: K562, K562R, BV173, BV173R, Raji and HL-60. Aberrant JUNB methylation was not observed in any of the cell lines analyzed by any of the 3 methods used here (data not shown). Next, we analyzed the methylation status of the JUNB region 1 in 62 patients with CML using the original MSP assay described by Yang et al (19). Of these patients 55 were in chronic phase (CP), 3 in accelerated phase [AP], and 4 (BP). Methylation of this region was not observed in any of these patients [FIGURE 1B]. We then extended this analysis to a total of 102 patients (including the original 62 patients), using the COBRA assay in region-1. Using this assay, JUNB methylation was observed in 3 (3%) patients [FIGURE 1C]. Interestingly, all these 3 patients had CML in AP. Methylation results were confirmed in these 3 patients using bisulfite sequencing and in cell lines (FIGURE 2). Because DNA methylation can be heterogeneous, we analyzed the methylation status of a region upstream of the transcription start site (region-2) in 35 patients (13 in CP, 11 in AP, and 11 in BP) using a COBRA assay. Methylation was not observed in any of these patients (figure 1C). Finally, in view that transgenic mice lacking JUNB developed a MPD closely resembling human CML independent of the presence of BCR-ABL1 involvement (12), we studied 9 patients with Philadelphia (Ph) chromosome-negative BCR-ABL1-negative CML. Using the region 1 MSP assay, we failed to demonstrate promoter DNA methylation in JUNB (FIGURE 3). No methylation was detected with either of the COBRA assays mapping regions 1 or 2 in these patients with Ph- CML (data not shown). The characteristics of CML patients in our cohort have been previously described and were representative of patients treated at M. D. Anderson Cancer Center (25). All samples were obtained following institutional guidelines.
Figure 2. JUNB bisulfite sequencing of patients and leukemia cell lines.

Results of bisulfite sequencing (21) are shown for each CpG site studied (number on top of each column). Black circles methylated CpG site. Open, unmethylated CpG site. SssI, SssI treated positive control; K562, CML cell line; BP, blastic phase; AP, accelerated phase. Figure on the left, the number of the clone. As shown methylation was observed in most CpG sites of the artificially methylated SssI-treated positive control but rarely in K562 cells or samples with BP CML. AP confirms the methylation status in one of the AP cases.
Figure 3. Analysis of JUNB methylation in Ph-CML.

Nine patients with Ph-CML were studied using the MSP assay reported by Yang et al (19). As shown in these 5 representative patients, no methylation was observed in any of the patients. Figure on top, patient number. U unmethylated; M, methylated. SssI positive control. MW molecular weight marker. Figure on the right molecular weight.
JUNB expression in CML
Because DNA methylation is not the only mechanism of gene expression regulation, the above results did not exclude the possibility that JUNB could be downregulated in patients with CML via a DNA methylation independent mechanism. To study this possibility, we analyzed the levels of JUNB mRNA expression in CML-derived cell lines and in patient samples by using RT-PCR. The same cell lines analyzed for DNA methylation were used for expression analysis. Using the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as control, the dCT of JUNB in K562 was −9.61. JUNB expression levels were also analyzed in K562R, BV173 and BV173R. The dCT for these three cell lines ranged from −4.7 to −6.8. These results indicate that JUNB is expressed at very low levels in CML derived cell lines independently of the methylation status of JUNB gene (FIGURE 4A). We next studied the levels of JUNB expression in 27 patients with CML (10 in CP, 9 in AP, and 8 in BP), 6 patients with AML and 6 with Ph+ ALL and 5 healthy volunteers by RT-PCR and the 9 patients with Ph- CML (FIGURE 4B). The median dCT of patients in CP was −1.78 (range ± 1.56), −2.2 (range ± 2.65) in AP, −4.04 (range ± 2.65) in BP, −1.88 (range ± 0.21) in healthy volunteers and 1.56 (range ± 1.01) in AML and non-detectable in ALL. No differences in JUNB levels were observed between healthy volunteers, and patients in CP (p=0.002). In contrast, lower JUNB levels were observed in patients with CML in BP compared to CML in CP (p=0.002). These results indicate that JUNB levels are very low in CML-derived cell lines and that JUNB expression gradually declines during progression to advanced phases of CML, with the lowest JUNB levels obtained in patients with BP-CML. Of interest, JUNB levels in Ph-CML were higher than those observed in Ph+ CML (FIGURE 4B).
Figure 4. JUNB expression in BCR-ABL1-positive cell lines and in patients with CML.

(A) Expression of JUNB transcripts was analyzed by RT-PCR in healthy volunteers and BCR-ABL1-positive cell lines. Markedly low JUNB expression was observed in cell lines when compared with normal controls. Data presented as the percentage compared to control. (B) The expression of JUNB was also determined by RT-PCR in 27 patients with CML (10 in CP, 9 in AP, and 8 in BP), as well as in 6 patients with AML and Ph+ ALL and in 5 healthy volunteers and 9 with Ph-CML. No statistically significant differences in JUNB level expression were observed between healthy volunteers and patients in CP but progressive decrease expression was observed between CP, AP and BP patients. between normal or CP and advanced phase diseases (p=0.002). Levels in Ph-CML and AML were supra-normal compared to normal control and non detectable in Ph+ALL.
To validate these results, we analyzed JUNB gene expression in 82 CML cases previously studied by gene expression arrays (42 in CP, 9 in AP, and 31 in BC). Each individual CML sample in these studies was compared to a pool of mRNA from 200 CP-CML cases. As shown in FIGURE 5, results of gene expression arrays confirmed a progressive loss of JUNB expression in patients with advanced phases of CML. The expression of JUNB was heterogeneous in samples obtained from patients with CP-CML (left panel figure 5A), but patients with AP-CML exhibited decreased expression of JUNB when compared with CP-CML. Moreover, nearly all patients in BP-CML exhibited decreased JUNB expression. In fact, the median decrease expression in BP-CML samples compared to CP-CML was 0.53 logs (ANOVA p < 0.0001).
Figure 5. Microarray based JunB expression analysis in patients with CML.

(A) JUNB expression in patients with CP-, AP-, and BP-CML was analyzed using microarrays assays. Log ratio was defined as expression compared to that detected in a pool of 200 patients with CP-CML. Positive values denote increased expression while negative values denote gene downregulation decrease repression was observed between CP, AP and BP patients. As shown in BP-CML, there is almost universal downregulation of JUNB (right panel figure 4A, whereas expression levels were heterogenous in CP (left panel) and intermediate in AP (middle panel). (B) Median levels of JUNB expression as detected by microarray assay. The median decrease in JUNB expression in patients with BP-CML samples compared to those obtained from patients with CP-CML was 0.53 logs (ANOVA p=1.3×10−11).
Finally, we analyzed the effect of imatinib based therapy in 9 patients with CML and observed that the expression of JUNB increases in patients with CP-CML during therapy with the BCR-ABL1 kinase inhibitor imatinib, suggesting the expression of this gene may be regulated by the activity of this kinase (FIGURE 6).
Figure 6. JUNB expression in patients with CML receiving imatinib.

(C) JUNB MRNA levels were analyzed sequentially in 9 patients in CP-CML treated with imatinib. As shown, increased JUNB levels were observed in 8 of 9 patients analyzed after imatinib therapy. Therapy with the BCR-ABL1 kinase inhibitor imatinib mesylate results in significant expression of JUNB transcripts.
Discussion
JUNB modulates myelopoiesis and is a potential tumor suppressor gene in mice (8). Adult JUNB−/−Ubi-JUNB mice developed a transplantable MPD with complete penetrance by 11 months of age, which coincides with a myeloid-specific and age-dependent loss of JUNB expression. This disease strikingly resembles CML, both clinically and morphologically. In fact, 16% of these mice experience progression to BP, thereby recapitulating the natural course of human CML (8). Herein, we demonstrate by two different analytical methods that JUNB mRNA expression is downregulated in advanced phase CML and this occurrence is not mediated by aberrant DNA methylation. This is of importance because inactivation of JUNB expression in LT-HSC, but not in cells with a higher degree of hematopoietic commitment, invariably leads to leukemogenic stem cell expansion and development of a transplantable MPD similar to CML (17). Conversely, enforced expression of JUNB in HSC through lentiviral transduction causes stem cell loss (17). It has been reported that JUNB expression is impaired in peripheral blood cells of patients with BCR-ABL1-positive CML (18). The specific factors leading to downregulation of JUNB remain largely unknown. It has been speculated that JUNB could be downregulated due to epigenetic silencing of the JUNB gene promoter (8). DNA hypermethylation of CpG islands in the proximity of gene promoters is a well-characterized epigenetic phenomenon (26) linked to transcriptional silencing of tumor-suppressor genes in both solid tumors (27–28) and leukemia (29–32), thus leading to carcinogenesis (32–34). Several reports have emphasized the importance of methylation-induced gene silencing in the pathogenesis of CML (34–36). Yang et al have reported on the JUNB expression status of 32 patients with CML (21 in CP and 11 in BP) (19). JUNB was downregulated in all patients but no mutations were demonstrated within the JUNB gene-coding region. Interestingly, most of the CpG sites were methylated in the promoter area of the JUNB gene, suggesting that JUNB inactivation was due to methylation of the promoter region of the JUNB gene (19). In stark contrast, our results indicate that JUNB methylation is rare in patients with CML. In fact, JUNB methylation was observed in none of the BCR-ABL1-positive cell lines analyzed, and only 3 (3%) of 102 patients with CML (and none of 9 patients with Ph-negative CML) exhibited a significant degree of methylation in the promoter area of JUNB. Of note, these 3 patients had AP-CML. Overall, these results indicate that downregulation of JUNB in patients with CML is modulated by mechanisms of gene expression different from DNA methylation and that JUNB methylation is not regulated by BCR-ABL1. In addition, when RT-PCR analysis was used to determine JUNB mRNA expression, no significant differences were observed between healthy individuals and patients with CP-CML. However, JUNB expression declined in a progressive manner with advanced CML disease. These results were confirmed by gene expression microarray analysis, further strengthening the association between JUNB downregulation and CML phase progression. Interestingly, the expression of JUNB increased in patients with CP-CML during imatinib therapy suggesting that its expression may be regulated by the activity of BCR-ABL1 kinase.
Several factors could account for the striking disparity between our results and those previously reported (19). First, part of this discrepancy may be related to methodological aspects, particularly regarding the sensitivity of the MSP assay and the cohort size used by the Yang et al (19). We circumvented this potential bias by performing methylation analysis by two different methylation assays (MSP and COBRA) in a significantly larger cohort of patients. Secondly, differences in DNA methylation patterns have been observed among different ethnic populations and geographic areas (37, 38). However, a difference in methylation levels close to 100% cannot be explained solely on the basis of ethnic differences between U.S. and Asian CML patient populations, particularly since the BCR-ABL1 oncogene that drives CML pathogenesis, is universally found in all patients independently of the ethnic background. Finally, DNA promoter methylation has been dynamically linked to histone deacetylase activitity (39). In fact, these two epigenetic processes appear to function as synergistic layers for the silencing of genes in cancer (39). Hence, it would be reasonable to ascribe part of the JUNB downregulation seen in our patients to histone deacetylase activity in the absence of significant DNA methylation. Further analysis of chromatin code will be needed to validate this issue in CML.
BCR-ABL1 is regarded as sufficient and necessary for the pathogenesis of CML (40–42). Imatinib mesylate, a targeted BCR-ABL1 kinase inhibitor, is associated with a complete cytogenetic response rate of 80%–90% in patients with early CP-CML (43). However, even patients who achieve major molecular responses by RT-PCR, experience recurrence of their disease when therapy with imatinib is interrupted, suggesting the presence of residual disease below the threshold of detection of currently employed molecular techniques. This has been attributed to persistence of innately imatinib-insensitive BCR-ABL1-positive quiescent cells. It has been shown that approximately 75% of LT-HSCs are quiescent in G0 phase (44) and that CML may be initiated by transforming events occurring in this subset of cells. JUNB regulates the numbers of LT-HSC and granulocyte/macrophage progenitors and knockout mice develop a MPD similar to human CML when devoid of JUNB (8, 17). It is conceivable that the pathogenesis of CML may be primarily triggered by downregulation of JUNB in LT-HSCs independently of BCR-ABL1 expression, which might only be required in CML cases arising at the myelomonocytic stage of differentiation. Whether this model translates into human CML pathogenesis warrants further investigation, but provides a model whereby the failure of imatinib in eradicating quiescent leukemic stem cells can be explained by the absence or decreased levels of BCR-ABL1 expression. Elucidating the determinants of JUNB downregulation might facilitate the design of novel targeted therapies for CML. Indeed one of the limitations of this manuscript is that we do not validate the mechanism of JUNB down regulation.
In summary, our results indicate that JUNB downregulation is a DNA methylation-independent phenomenon encountered in CML only in advanced phases. The mechanisms leading to JUNB downregulation and the implications of this occurrence in CML pathogenesis and progression, as well as its relation with prognosis and resistance to therapy warrant further study. The answer to these questions may facilitate the development of novel therapeutic approaches for patients with CML.
Acknowledgments
This work was supported in part by an American Society of Clinical Oncology Career Development Award, the Physician-Scientist Program from the University of Texas MD Anderson Cancer Center, and CA-100067 from the NCI (to G G-M); and CA-85053 from the National Cancer Institute (JR).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of Interest
There was no conflict of interest for any of the authors.
Contributions
KY performed all the experiments, analyzed the data and wrote the manuscript. A Q-C wrote the manuscript and analyzed the data. HD and HY performed research. JR wrote manuscript, and analyzed data. G G-M designed and funded the study, wrote the manuscript and analyzed the data.
References
- 1.Angel P, Karin M. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochem Biophys Acta. 1991;1072:129–157. doi: 10.1016/0304-419x(91)90011-9. [DOI] [PubMed] [Google Scholar]
- 2.Shaulian E, Karin M. AP-1 as a regulator of cell life and death. Nat Cell Biol. 2002;4:E131–E136. doi: 10.1038/ncb0502-e131. [DOI] [PubMed] [Google Scholar]
- 3.Deng T, Karin M. Jun B differs from c-Jun in its DNA-binding and dimerization domains, and represses c-Jun by formation of inactive heterodimers. Genes Dev. 1993;7:479–490. doi: 10.1101/gad.7.3.479. [DOI] [PubMed] [Google Scholar]
- 4.Hsu JC, Cressman DE, Taub R. Promoter-specific transactivation and inhibition mediated by JunB. Cancer Res. 1993;53:3789–3794. [PubMed] [Google Scholar]
- 5.Schorpp-Kistner M, Wang ZQ, Angel P, et al. JunB is essential for mammalian placentation. EMBO J. 1999;18:934–948. doi: 10.1093/emboj/18.4.934. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Passegue E, Wanger EF. JunB suppresses cell proliferation by transcriptional activation of p16INK4a expression. EMBO J. 2000;19:2969–2979. doi: 10.1093/emboj/19.12.2969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bakiri L, Lallemand D, Bossy-Wetzel E, et al. Cell cycle-dependent variations in c-Jun and JunB phosphorylation: a role in the control of cyclin D1 expression. EMBO J. 2000;19:2056–2068. doi: 10.1093/emboj/19.9.2056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Passegue E, Jochum W, Schorpp-Kistner M, Möhle-Steinlein U, et al. Chronic myeloid leukemia with increased granulocyte progenitors in mice lacking JunB expression in the myeloid lineage. Cell. 2001;104:21–32. doi: 10.1016/s0092-8674(01)00188-x. [DOI] [PubMed] [Google Scholar]
- 9.Lord KA, Abdollahi A, Hoffman-Liebermann B, et al. Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation. Mol Cell Biol. 1993;13(2):841–851. doi: 10.1128/mcb.13.2.841-851.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Mollinedo F, Vaquerizo MJ, Naranjo JR. Expression of c-jun, jun B and jun D proto-oncogenes in human peripheral-blood granulocytes. Biochem J. 1991;273(Pt 2):477–9. doi: 10.1042/bj2730477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Schreiber M, Kolbus A, Piu F, et al. Control of cell cycle progression by c-Jun is p53 dependent. Gene Dev. 1999;13:607–619. doi: 10.1101/gad.13.5.607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chiu R, Angel P, Karin M. Jun-B differs in its biological properties from and is a negative regulator of, c-Jun. Cell. 1989;59:979–986. doi: 10.1016/0092-8674(89)90754-x. [DOI] [PubMed] [Google Scholar]
- 13.Schutte J, Viallet J, Nau M, et al. jun-B inhibits and c-fos stimulates the transforming and trans-activating activities of c-Jun. Cell. 1989;59:987–97. doi: 10.1016/0092-8674(89)90755-1. [DOI] [PubMed] [Google Scholar]
- 14.Melamed D, Resnitzky D, Haimov I, et al. Interleukin 6 induces DNA binding activity of AP1 in M1 myeloblastic cells but not in a growth resistant cell derivative. Cell Growth Differ. 1993;4:689–697. [PubMed] [Google Scholar]
- 15.Schlingensiepen K, Schlingensiepen R, Kunst M, et al. Opposite functions of jun-B and c-Jun in growth regulation and neuronal differentiation. Dev Genet. 1993;4:305–312. doi: 10.1002/dvg.1020140408. [DOI] [PubMed] [Google Scholar]
- 16.Li B, Tournier C, Davis RJ, et al. Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation. EMBO J. 1999;18:420–432. doi: 10.1093/emboj/18.2.420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Passegue E, Wagner EF, Weissman IL. JunB deficiency leads to a myeloproliferative disorder arising from hematopoietic stem cells. Cell. 2004;119(3):431–443. doi: 10.1016/j.cell.2004.10.010. [DOI] [PubMed] [Google Scholar]
- 18.Bruchova H, Borovanova T, Klamova H, et al. Gene expression profiling in chronic myeloid leukemia patients treated with hydroxyurea. Leuk Lymphoma. 2002;43(6):1289–95. doi: 10.1080/10428190290026358. [DOI] [PubMed] [Google Scholar]
- 19.Yang MY, Liu TC, Chang JG, Lin PM, Lin SF. JunB gene expression is inactivated by methylation in chronic myeloid leukemia. Blood. 2003;101:3205–3211. doi: 10.1182/blood-2002-05-1598. [DOI] [PubMed] [Google Scholar]
- 20.Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997;25:2532–2534. doi: 10.1093/nar/25.12.2532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shen L, Toyota M, Kondo Y, et al. Aberrant DNA methylation of p57KIP2 identifies a cell-cycle regulatory pathway with prognostic impact in adult acute lymphocytic leukemia. Blood. 2003;101:4131–4136. doi: 10.1182/blood-2002-08-2466. [DOI] [PubMed] [Google Scholar]
- 22.Radich JP, Dai H, Mao M, et al. Gene expression changes associated with progression and response in chronic myeloid leukemia. Proc Natl Acad Sci U S A. 2006;103(8):2794–2799. doi: 10.1073/pnas.0510423103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Hughes TR, Mao M, Jones AR, et al. Expression profiling using microarrays fabricated by an ink-jet oligonucleotide synthesizer. Nat Biotechnol. 2001;19:342–347. doi: 10.1038/86730. [DOI] [PubMed] [Google Scholar]
- 24.Van ’t Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature. 2002;415:530–536. doi: 10.1038/415530a. [DOI] [PubMed] [Google Scholar]
- 25.Issa JP, Kantarjian H, Mohan A, et al. Methylation of the ABL1 promoter in chronic myelogenous leukemia: lack of prognostic significance. Blood. 1999;93:2075–2080. [PubMed] [Google Scholar]
- 26.Jones PA, Baylin SB. The fundamental role of epigenetic events in cancer. Nat Rev Genet. 2002;3:415–428. doi: 10.1038/nrg816. [DOI] [PubMed] [Google Scholar]
- 27.Herman JG, Latif F, Weng Y, et al. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc Natl Acad Sci U S A. 1994;91:9700–9704. doi: 10.1073/pnas.91.21.9700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Dong SM, Kim H-S, Rha S-H, Sidransky D. Promoter hypermethylation of multiple genes in carcinoma of the uterine cervix. Clin Cancer Res. 2001;7:1982–1996. [PubMed] [Google Scholar]
- 29.Claus R, Lubbert M. Epigenetic targets in hematopoietic malignancies. Oncogene. 2003 Sep 29;22(42):6489–96. doi: 10.1038/sj.onc.1206814. [DOI] [PubMed] [Google Scholar]
- 30.Melki JR, Clark SJ. DNA methylation changes in leukaemia. Semin Cancer Biol. 2002;12(5):347–57. doi: 10.1016/s1044-579x(02)00055-x. [DOI] [PubMed] [Google Scholar]
- 31.Issa JP, Baylin SB, Herman JG. DNA methylation changes in hematologic malignancies: biologic and clinical implications. Leukemia. 1997;11(suppl 1):S7–S11. [PubMed] [Google Scholar]
- 32.Baylin SB, Herman JG. DNA hypermethylation in tumorigenesis: epigenetics joins genetics. Trends Genet. 2000;16:168–174. doi: 10.1016/s0168-9525(99)01971-x. [DOI] [PubMed] [Google Scholar]
- 33.Robertson KD. DNA methylation, methyltransferase, and cancer. Oncogene. 2001;20:3139–3155. doi: 10.1038/sj.onc.1204341. [DOI] [PubMed] [Google Scholar]
- 34.Nguyen TT, Mohrbacher AF, Tsai YC, et al. Quantitative measure of c-abl and p15 methylation in chronic myelogenous leukemia: Biological implications. Blood. 2000;95:2990–2992. [PubMed] [Google Scholar]
- 35.Asimakopoulos FA, Shteper PJ, Krichevsky S, et al. ABL1 methylation is a distinct molecular event associated with clonal evolution of chronic myeloid leukemia. Blood. 1999;94:2452–2460. [PubMed] [Google Scholar]
- 36.Roman-Gomez J, Castillejo JA, Jimenez A, et al. Cadherin-13, a mediator of calcium-dependent cell-cell adhesion, is silenced by methylation in chronic myeloid leukemia and correlates with pretreatment risk profile and cytogenetic response to interferon alfa. J Clin Oncol. 2003;21:1472–1479. doi: 10.1200/JCO.2003.08.166. [DOI] [PubMed] [Google Scholar]
- 37.Enokida H, Shiina H, Urakami S, et al. Ethnic group-related differences in CpG hypermethylation of the GSTP1 gene promoter among African-American, Caucasian and Asian patients with prostate cancer. Int J Cancer. 2005;116(2):174–81. doi: 10.1002/ijc.21017. [DOI] [PubMed] [Google Scholar]
- 38.Shen L, Ahuja N, Shen Y, et al. DNA methylation and environmental exposures in human hepatocellular carcinoma. J Natl Cancer Inst. 2002;94:755–761. doi: 10.1093/jnci/94.10.755. [DOI] [PubMed] [Google Scholar]
- 39.Cameron EE, Bachman KE, Myöhänen S. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Genet. 1999;21:103–107. doi: 10.1038/5047. [DOI] [PubMed] [Google Scholar]
- 40.Lugo TG, Pendergast AM, Muller AJ, et al. Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science. 1990;247(4946):1079–82. doi: 10.1126/science.2408149. [DOI] [PubMed] [Google Scholar]
- 41.Heisterkamp N, Jenster G, Hoeve J, et al. Acute leukaemia in bcr/abl transgenic mice. Nature. 1990;344:251–253. doi: 10.1038/344251a0. [DOI] [PubMed] [Google Scholar]
- 42.Daley GQ, Van Etten RA, Baltimore D. Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome. Science. 1990;247:824–830. doi: 10.1126/science.2406902. [DOI] [PubMed] [Google Scholar]
- 43.Druker BJ, Guilhot F, O’Brien SG, et al. Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. N Engl J Med. 2006 Dec 7;355(23):2408–17. doi: 10.1056/NEJMoa062867. [DOI] [PubMed] [Google Scholar]
- 44.Cheshier SH, Morrison SJ, Liao X, et al. In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proc Natl Acad Sci USA. 1999;96(6):3120–5. doi: 10.1073/pnas.96.6.3120. [DOI] [PMC free article] [PubMed] [Google Scholar]
