Abstract
Purpose
To determine the genetic origin of disease in four Chinese families with blepharophimosis syndrome.
Methods
Four Han Chinese families with blepharophimosis syndrome were ascertained and patients underwent complete physical and ophthalmic examinations. Blood samples were collected and genomic DNA was extracted. Sequence analysis of the forkhead transcriptional factor 2 (FOXL2) gene was performed by direct sequencing and mutations were analyzed.
Results
Three mutations in FOXL2 were found in four families, including c.672_701dup30 (p.Ala224_Ala234dup10), c.313C>A (p.N105H), and c.430G>T (p.R144W). The c.672_701dup30 (p.Ala224_Ala234dup10) mutation was reported previously and predicted to result in expansions of the polyalanine tract. The mutations of c.313C>A (p. N105H) and c.430G>T (p.R144W) are two novel missense mutations.
Conclusions
Our study further supports the view that the expansion of the polyalanine tract is the hotspot of mutations within FOXL2. The two novel missense mutations detected in this study will expand the mutation spectrum of the FOXL2 gene and contribute to the research on the molecular pathogenesis of FOXL2.
Introduction
Blepharophimosis syndrome (BPES, MIM #110100) is a rare autosomal dominant inheritable disorder with an estimated incidence of 1 in 50,000 births [1]. It is a complex eyelid disease characterized by blepharophimosis, ptosis, epicanthus inversus, and telecanthus. Other ocular abnormities with BPES are strabismus, refractive error, and amblyopia in one or both eyes [2]. There are two forms of BPES distinguished by the eyelid defects with (type I) or without (type II) premature ovarian failure [3]. However, both types of BPES are caused by mutations of the forkhead transcriptional factor 2 (FOXL2) gene spanning approximately 2.7 kb on chromosome 3q23.
FOXL2 (OMIM 605597) is a member of the superfamily of Forkhead Box (Fox) transcription factors. It is a single-exon gene and encodes a protein with 376 residues containing a 100 amino acid DNA-binding forkhead domain and a polyalanine (poly-Ala) tract that is highly conserved in mammals. Currently, more than 100 different mutations have been identified in FOXL2, including frameshifts, insertions, nonsense mutations, and missense mutations [4,5]. Although some authors have found that mutations resulting in a predicted truncated protein before the poly-Ala tract are associated with BPES type I, whereas mutations resulting in an extended protein might lead to BPES type II, no clear genotype-phenotype correlation has been confirmed between mutations and BPES types because the genetic and clinical heterogeneity are found in and between families with BPES [6,7].
Here, we report three mutations identified in the FOXL2 gene from four Chinese families with BPES. Two of the mutations are missense, and one of them is indel.
Methods
Patient ascertainment
Four Han Chinese families with BPES (Figure 1) were recruited through the Ophthalmic Genetics Clinic of the Tianjin Eye Hospital, Tianjin, China. Patients with BPES were diagnosed depending on the following clinical criteria: blepharophimosis, ptosis, epicanthus inversus, and telecanthus. Premature ovarian failure was defined as cessation of menses for a duration of ≥6 months before the age of 40 and a concentration of follicle-stimulating hormone of >40 IU/l.
Figure 1.
Pedigrees and respective forkhead transcriptional factor 2 (FOXL2) mutations of patients with blepharophimosis syndrome (BPES). Squares and circles indicate males and females, respectively, and the darkened symbols represent the affected members. The patients with the arrow above are the probands.
After informed consent was received, 3 ml blood samples were taken from the blood vessels of 27 affected and 21 unaffected individuals from the four unrelated families, and DNA was extracted from blood lymphocytes according to the standard methods of protocol (Roche Biochemical, Inc. Penzberg, Germany). This study obtained institutional review board (IRB) approval from the Tianjin Eye Hospital and conformed to the tenets of the Declaration of Helsinki.
Mutation analysis
Amplification of the genomic fragments encompassing FOXL2 coding regions (NCBI human genome build 35.1, NC_000003 for gDNA, NM_023067 for messenger RNA, and NP_075555 for protein) was performed by PCR using the primers in Table 1. PCR was carried in 20 μl of standard PCR buffer containing 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.5 μM of each primer, 1 U of Taq polymerase, and 50 ng of DNA. The amplification program was an initial 2 min denaturation at 98 °C, followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C, 1 min at 72 °C, and a final 7 min extension step at 72 °C. The PCR products were separated on a 2% agarose gel and purified with the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA).
Table 1. The primer pairs for amplification of the forkhead transcriptional factor 2 (FOXL2).
| Name | Forward | Reverse | Size (bp) |
|---|---|---|---|
| Frg-1 |
TCCGCAGTCTCCAGAAGTTT |
GACAGCGTGAGCCTCTTCTC |
354 |
| Frg-2 |
GCACAGTCAAGGAGCCAGA |
GCCCTTCTCGAACATGTCTT |
359 |
| Frg-3 |
CCCGTTCTACGAGAAGAATAAG |
ATCTGGCAGGAGGCATAGG |
396 |
| Frg-4 |
ACATGTTCGAGAAGGGCAAC |
CCAGGCCATTGTACGAGTTC |
426 |
| Frg-5 |
CCTATGCCTCCTGCCAGAT |
GTCGTGGTCCCAGTAAGAGC |
452 |
| Frg-6 | CCGGCGTAGTGAACTCGTA | AAAGCGAAAAAGCACAGAGG | 486 |
DNA sequencing analysis was performed using the BigDye Terminator Cycle Sequencing V3.1 kit on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). Sequencing results were assembled and analyzed with the Seqman program of DNASTAR software (DNASTAR Inc., Madison, WI). Each heterozygous mutant was further validated with bidirectional sequencing in all relatives of the affected families and 100 normal healthy controls. Cloning sequencing was performed for the validation of multiple nucleotides insertions. A multiple sequence alignment was performed using the Clustal W algorithm in the software package. Mutation naming followed the nomenclature recommended by the Human Genomic Variation Society.
Results
All patients in the four families were found to have typical features of BPES, including small palpebral fissures, ptosis of the eyelids, and epicanthus inversus (Figure 2). The clinical forms of families A and B were classified as BPES type II because the affected females in these two families did not have fertility problems. However, we were unable to evaluate the BPES types for families C and D because there were no female patients in family C, while the two affected females in family D were of pubertal age and had normal hormonal measurements and menstrual cycle (data not shown).
Figure 2.
Characteristic clinical features of the patients with blepharophimosis syndrome (BPES). A, B, C, D: The photos represent affected individuals from the four families with BPES. All patients have small palpebral fissures, ptosis of the eyelids, and epicanthus inversus.
Sequence analysis of FOXL2 revealed three heterozygous mutations in four probands from the four families with BPES, including c.672_701dup30 (p.Ala224_Ala234dup10), c.313C>A (p. N105H), and c.430G>T (p.R144W; Figure 3). These mutations were also present in the affected patients from the corresponding families, but none of the unaffected family members or 100 normal control subjects examined carried these mutations.
Figure 3.
Sequencing results of the three mutations in the forkhead transcriptional factor 2 (FOXL2) gene. A: Mutation of c.672_701dup30 (p.Ala224_Ala234dup10). B: Mutation of c.313C>A (p.N105H). C: Mutation of c.430G>T (p.R144W). The upper panel is the chromatogram of the FOXL2 wild type, and the lower panel is the chromatogram of the mutant. The arrow indicates the position of the insertion. The box includes the position of the missense mutation.
The mutation of c.672_701dup30 (p.Ala224_Ala234dup10) was previously reported and was detected in both family A and B. It is a frameshift mutation within the coding region of the poly-Ala tract and was predicated to result in poly-Ala expansions. To examine the possibility of a common origin between family A and B, four single-nucleotide polymorphisms (rs56799713, rs1482976, rs12630172, and rs2291252) harboring the FOXL2 locus were genotyped in the probands of the families of A and B (Table 2). The haplotypes of these two probands were quite distinct. This suggested that the same mutation, c.672_701dup30 (p.Ala224_Ala234dup10), occurred independently in these two families rather than that they had descended from a common ancestor.
Table 2. Sequence analysis of four single nucleotide polymorphisms (SNPs) in two probands from two families carrying with C.672_701DUP mutation.
| SNP | Location | Family A | Family B |
|---|---|---|---|
|
rs56799713 |
138660471 |
C/C |
C/A |
|
rs1482976 |
138661115 |
T/T |
C/T |
|
rs12630172 |
138662552 |
G/G |
G/T |
| rs2291252 | 138662983 | G/G | G/G |
The heterozygous mutations of c.313C>A and c.430G>T were detected in family C and D, respectively. The C to T change at nucleotide position 313 would result in an asparagine at codon 105 substituted by a histidine (N105H), whereas the C to T change at the nucleotide position 430 would be predicted to result in an arginine at codon 144 replaced by a tryptophan residue (R144W).
The multiple sequence alignment of the FOXL2 protein shows that N105H and R144W were conserved among human, Pongo (chimpanzee), mouse, cow, chicken and zebrafish (Figure 4). The N105H and R144W amino acid changes produce PROVEAN scores of −4.943 and −6.766, respectively, as predicted by the PROVEAN tool. Both of them produce a position-specific independent counts ( PSIC) profile score of 1.0 calculated by the POLYPHEN2 program. These values indicate that the amino acid substitutions at N105 and R144 are likely to have a deleterious effect on the protein. These results suggest that the mutations of c.313C>A (p. N105H) and c.430G>T (p.R144W) are novel mutations in the FOXL2 gene.
Figure 4.

Sequence alignment of the forkhead transcriptional factor 2 (FOXL2) gene product among the human, Pongo, mouse, cow, chicken and zebrafish. The N105 and R144 are conserved among all of these species.
Discussion
As mentioned above, FOXL2 is a member of the winged helix/forkhead transcription factor family, and is mainly expressed in the developing eyelid and ovarian follicular granulosa cells. It encodes a protein with 376 amino acid residues, which contains a 100 amino acid DNA-binding forkhead domain from amino acid position 52 to 152 and an alanine-rich domain from amino acid position 221 to 234 downstream of the forkhead domain. Currently, 46 missense mutations have been found in the FOXL2 gene. Thirty-two of these are located in the forkhead domain [6-18], 1 in the alanine-rich domain, 10 in the region flanked by the forkhead and alanine-rich domains [9,12,17,19-22], and 3 downstream of the alanine-rich domain [6,8]. These missense mutations might lead to the BPES phenotype either by haploinsufficiency or through the dominant-negative effect. However, the exact molecular pathogenesis mechanism is not yet clear, nor can genetic and phenotype correlations be established for these missense mutations.
The missense mutation of N105H was located in the DNA-binding forkhead domain. It was caused by a C to A change at the nucleotide position 313. The mutation at N105 was reported previously by Crisponi et al. [23], and comprises a substitution of a serine (S) to an asparagine (N) due to an A to T change at the nucleotide position 314. The asparagine (N) at codon 105 is highly conserved among vertebrates and lower animals, and may provide key sites for N-linked glycosylation when occurring in an Asn-X-Ser/Thr form in the motif [24]. Because glycosylation is important for both protein structure and function, substitution of the asparagine either by a serine or a histidine would be deleterious to the structure and function of the protein.
The R144W mutation was also located in the DNA-binding forkhead domain. R144 is highly conserved in vertebrates and low animals, and localized at the first position in the arginine/lysine (RK)-rich region (R144R145R146R147R148M149K150R151) at the C-terminal of the forkhead domain. The RK-rich region is conserved in several forkhead domains and might function as a nuclear localization signal. Mutations in the RK-rich region have been demonstrated to lead to mislocalization of the proteins [25]. The missense mutation of R144W would affect the protein structure and function, as predicted by the PROVEAN tool and POLYPHEN2 program.
Previous studies showed that missense mutations inside or outside the forkhead domain could determine the expressivity of BPES. Mutations inside the forkhead domain might produce a more severe phenotype, while mutations outside it might produce a mild phenotype, except in an Indian BPES family carrying a missense mutation outside the forkhead domain but with a severe phenotype [15,26]. In this study, BPES families carrying either the N105H or R144W mutation had a typical clinical BPES phenotype, which further supported the possibility that the affected BPES individuals with missense mutations inside the forkhead domain might have a severe or typical phenotype.
The c.672_701dup30 mutation was reported previously and localized in the alanine-rich domain. Thus far, the role of the alanine-rich domain in FOXL2 has not yet been elucidated. It might be related to the function and structure of the protein because the number of alanine residues is strictly conserved among mammals. It was reported that the alanine-rich domain was a mutational “hotspot,” since the majority of the in-frame mutations occurred in this region and resulted in poly-Ala expansions. The possible mechanism for the in-frame changes in the poly-Ala tract of FOXL2 is the DNA hairpin–induced polymerase slippage that leads to the poly-Ala expansions [7]. The poly-Ala expansions might lead to protein mislocalization and aggregation, which results mainly in BPES type II [27]. Our study further supports that the poly-Ala domain is a mutational hotspot for these two independent families with BPES type II carried the same mutation of c.672_701dup30 in this region.
In summary, we identified three mutations—c.672_701dup30 (p.Ala224_Ala234dup10), c.313C>A (p.N105H), and c.430G>T (p.R144W)—in the FOXL2 gene in four Han Chinese families with BPES. The c.672_701dup30 was detected in the two families diagnosed as BPES type II, while the two missense mutations of c.313C>A and c.430G>T are novel mutations detected in the other two families with unknown types of BPES. Our data further support that poly-Ala expansions lead to BPES type II. For missense mutations, no predictions can yet be made because of a lack of sufficient information from families. The two novel missense mutations would expand the mutation spectrum of the FOXL2 gene and contribute to the study of the molecular pathogenesis of BPES.
Acknowledgments
The authors thank all participants in the families for their enthusiastic participations. This work is partially supported by the National Natural Science Foundation of China (Grant No.30940081 and No. 81170884), and Technology Foundation of Tianjin Health Bureau (Grant No. 09KR09).
References
- 1.Oley C, Baraitser M. Blepharophimosis, ptosis, epicanthus inversus syndrome (BPES syndrome). J Med Genet. 1988;25:47–51. doi: 10.1136/jmg.25.1.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Dawson EL, Hardy TG, Collin JR, Lee JP. The incidence of strabismus and refractive error in patients with blepharophimosis, ptosis and epicanthus inversus syndrome (BPES). Strabismus. 2003;11:173–7. doi: 10.1076/stra.11.3.173.16645. [DOI] [PubMed] [Google Scholar]
- 3.Zlotogora J, Sagi M, Cohen T. The blepharophimosis, ptosis, and epicanthus inversus syndrome: delineation of two types. Am J Hum Genet. 1983;35:1020–7. [PMC free article] [PubMed] [Google Scholar]
- 4.Beysen D, De Paepe A, De Baere E. FOXL2 mutations and genomic rearrangements in BPES. Hum Mutat. 2009;30:158–69. doi: 10.1002/humu.20807. [DOI] [PubMed] [Google Scholar]
- 5.Beysen D, Vandesompele J, Messiaen L, De Paepe A, De Baere E. The human FOXL2 mutation database. Hum Mutat. 2004;24:189–93. doi: 10.1002/humu.20079. [DOI] [PubMed] [Google Scholar]
- 6.De Baere E, Beysen D, Oley C, Lorenz B, Cocquet J, De Sutter P, Devriendt K, Dixon M, Fellous M, Fryns JP, Garza A, Jonsrud C, Koivisto PA, Krause A, Leroy BP, Meire F, Plomp A, Van Maldergem L, De Paepe A, Veitia R, Messiaen L. FOXL2 and BPES: mutational hotspots, phenotypic variability, and revision of the genotype-phenotype correlation. Am J Hum Genet. 2003;72:478–87. doi: 10.1086/346118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.De Baere E, Dixon MJ, Small KW, Jabs EW, Leroy BP, Devriendt K, Gillerot Y, Mortier G, Meire F, Van Maldergem L, Courtens W, Hjalgrim H, Huang S, Liebaers I, Van Regemorter N, Touraine P, Praphanphoj V, Verloes A, Udar N, Yellore V, Chalukya M, Yelchits S, De Paepe A, Kuttenn F, Fellous M, Veitia R, Messiaen L. Spectrum of FOXL2 gene mutations in blepharophimosis-ptosis-epicanthus inversus (BPES) families demonstrates a genotype–phenotype correlation. Hum Mol Genet. 2001;10:1591–600. doi: 10.1093/hmg/10.15.1591. [DOI] [PubMed] [Google Scholar]
- 8.Li D, Zeng W, Tao J, Li S, Liang C, Chen X, Mu W, Wang X, Qin Y, Jie Y, Wei W. Mutations of the transcription factor FOXL2 gene in Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome. Genet Test Mol Biomarkers. 2009;13:257–68. doi: 10.1089/gtmb.2008.0121. [DOI] [PubMed] [Google Scholar]
- 9.Wang J, Liu J, Zhang Q. FOXL2 mutations in Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome. Mol Vis. 2007;13:108–13. [PMC free article] [PubMed] [Google Scholar]
- 10.Nallathambi J, Moumne L, De Baere E, Beysen D, Usha K, Sundaresan P, Veitia RA. A novel polyalanine expansion in FOXL2: the first evidence for a recessive form of the blepharophimosis syndrome (BPES) associated with ovarian dysfunction. Hum Genet. 2007;121:107–12. doi: 10.1007/s00439-006-0276-0. [DOI] [PubMed] [Google Scholar]
- 11.Ramírez-Castro JL, Pineda-Trujillo N, Valencia AV, Muneton CM, Botero O, Trujillo O, Vasquez G, Mora BE, Durango N, Bedoya G, Ruiz-Linares A. Mutations in FOXL2 underlying BPES (types 1 and 2) in Colombian families. Am J Med Genet. 2002;113:47–51. doi: 10.1002/ajmg.10741. [DOI] [PubMed] [Google Scholar]
- 12.Beysen D, De Jaegere S, Amor D, Bouchard P, Christin-Maitre S, Fellous M, Touraine P, Grix AW, Hennekam R, Meire F, Oyen N, Wilson LC, Barel D, Clayton-Smith J, de Ravel T, Decock C, Delbeke P, Ensenauer R, Ebinger F, Gillessen-Kaesbach G, Hendriks Y, Kimonis V, Laframboise R, Laissue P, Leppig K, Leroy BP, Miller DT, Mowat D, Neumann L, Plomp A, Van Regemorter N, Wieczorek D, Veitia RA, De Paepe A, De Baere E. Identification of 34 novel and 56 known FOXL2 mutations in patients with Blepharophimosis syndrome. Hum Mutat. 2008;29:E205–19. doi: 10.1002/humu.20819. [DOI] [PubMed] [Google Scholar]
- 13.Or SF, Tong MF, Lo FM, Lam TS. Three novel FOXL2 gene mutations in Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome. Chin Med J (Engl) 2006;119:49–52. [PubMed] [Google Scholar]
- 14.Kaur I, Hussain A, Naik MN, Murthy R, Honavar SG. Mutation spectrum of fork-head transcriptional factor gene (FOXL2) in Indian Blepharophimosis Ptosis Epicanthus Inversus Syndrome (BPES) patients. Br J Ophthalmol. 2011;95:881–6. doi: 10.1136/bjo.2009.177972. [DOI] [PubMed] [Google Scholar]
- 15.Beysen D, Moumne L, Veitia R, Peters H, Leroy BP, De Paepe A, De Baere E. Missense mutations in the forkhead domain of FOXL2 lead to subcellular mislocalization, protein aggregation and impaired transactivation. Hum Mol Genet. 2008;17:2030–8. doi: 10.1093/hmg/ddn100. [DOI] [PubMed] [Google Scholar]
- 16.Dollfus H, Stoetzel C, Riehm S, Lahlou Boukoffa W, Bediard Boulaneb F, Quillet R, Abu-Eid M, Speeg-Schatz C, Francfort JJ, Flament J, Veillon F, Perrin-Schmitt F. Sporadic and familial blepharophimosis -ptosis-epicanthus inversus syndrome: FOXL2 mutation screen and MRI study of the superior levator eyelid muscle. Clin Genet. 2003;63:117–20. doi: 10.1034/j.1399-0004.2003.00011.x. [DOI] [PubMed] [Google Scholar]
- 17.Udar N, Yellore V, Chalukya M, Yelchits S, Silva-Garcia R, Small K. Comparative analysis of the FOXL2 gene and characterization of mutations in BPES patients. Hum Mutat. 2003;22:222–8. doi: 10.1002/humu.10251. [DOI] [PubMed] [Google Scholar]
- 18.Nallathambi J, Laissue P, Batista F, Benayoun BA, Lesaffre C, Moumne L, Pandaranayaka PE, Usha K, Krishnaswamy S, Sundaresan P, Veitia RA. Differential functional effects of novel mutations of the transcription factor FOXL2 in BPES patients. Hum Mutat. 2008;29:E123–31. doi: 10.1002/humu.20809. [DOI] [PubMed] [Google Scholar]
- 19.Benayoun BA, Caburet S, Dipietromaria A, Georges A, D'Haene B, Pandaranayaka PJ, L'Hote D, Todeschini AL, Krishnaswamy S, Fellous M, De Baere E, Veitia RA. Functional exploration of the adult ovarian granulosa cell tumor-associated somatic FOXL2 mutation p.Cys134Trp (c.402C>G). PLoS ONE. 2010;5:e8789. doi: 10.1371/journal.pone.0008789. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Cha SC, Jang YS, Lee JH, Kim HK, Kim SC, Kim S, Baek SH, Jung WS, Kim JR. Mutational analysis of forkhead transcriptional factor 2 (FOXL2) in Korean patients with blepharophimosis-ptosis-epicanthus inversus syndrome. Clin Genet. 2003;64:485–90. doi: 10.1046/j.1399-0004.2003.00162.x. [DOI] [PubMed] [Google Scholar]
- 21.Decock CE, De Baere EE, Bauters W, Shah AD, Delaey C, Forsyth R, Leroy BP, Kestelyn P, Claerhout I. Insights into levator muscle dysfunction in a cohort of patients with molecularly confirmed blepharophimosis-ptosis-epicanthus inversus syndrome using high-resolution imaging, anatomic examination, and histopathologic examination. Arch Ophthalmol. 2011;129:1564–9. doi: 10.1001/archophthalmol.2011.348. [DOI] [PubMed] [Google Scholar]
- 22.Laissue P, Lakhal B, Benayoun BA, Dipietromaria A, Braham R, Elghezal H, Philibert P, Saad A, Sultan C, Fellous M, Veitia RA. Functional evidence implicating FOXL2 in non-syndromic premature ovarian failure and in the regulation of the transcription factor OSR2. J Med Genet. 2009;46:455–7. doi: 10.1136/jmg.2008.065086. [DOI] [PubMed] [Google Scholar]
- 23.Crisponi. In Human Gene Mutation Database. Human Gene Mutation Database 2002 [Google Scholar]
- 24.Mellquist JL, Kasturi L, Spitalnik SL, Shakin-Eshleman SH. The amino acid following an asn-X-Ser/Thr sequon is an important determinant of N-linked core glycosylation efficiency. Biochemistry. 1998;37:6833–7. doi: 10.1021/bi972217k. [DOI] [PubMed] [Google Scholar]
- 25.Moumn’e L, Batista F, Benayoun B, Nallathambi J, Fellous M, Sundaresan P, Veitia RA. The mutations and potential targets of the forkhead transcription factor FOXL2. Mol Cell Endocrinol. 2007;••• doi: 10.1016/j.mce.2007.11.006. [DOI] [PubMed] [Google Scholar]
- 26.Haghighi A, Verdin H, Haghighi-Kakhki H, Piri N, Gohari NS, De Baere E. Missense mutation outside the forkhead domain of FOXL2 causes a severe form of BPES type II. Mol Vis. 2012;18:211–8. [PMC free article] [PubMed] [Google Scholar]
- 27.Caburet S, Demarez A, Moumne L, Fellous M, De Baere E, Veitia RA. A recurrent polyalanine expansion in the transcription factor FOXL2 induces extensive nuclear and cytoplasmic protein aggregation. J Med Genet. 2004;41:932–6. doi: 10.1136/jmg.2004.024356. [DOI] [PMC free article] [PubMed] [Google Scholar]



