Abstract
NLBP (novel LZAP-binding protein) was recently shown to function as a tumor suppressor capable of inhibiting the NFκB signaling pathway. NLBP is also known as a negative regulator of cell invasion, and its expression is reduced in several cancer cell lines that have little invasive activity. Although these phenomena suggest that NLBP may be a potential tumor suppressor, its role as a tumor suppressor in human lung cancer is not well established. In contrast to our expectation, NLBP was highly expressed in the early stage of lung adenocarcinoma tissues, and overexpression of NLBP promoted proliferation of H1299 lung adenocarcinoma cells. We also found that p120 catenin (p120ctn) was a novel binding partner of NLBP, and that NLBP binds to the regulatory domain of p120ctn, and p120ctn associates with N-terminal region of NLBP, respectively. This binding leads to p120ctn stability to inhibit proteasomal degradation of p120ctn by inhibiting its ubiqutination. In addition, we also found that overexpression of NLBP and p120ctn in human lung cancer are closely related with adenocarcinoma compared with squamous cell carcinoma. Taken together, our findings reveal that NLBP is highly overexpressed in human lung adenocarcinoma, and that overexpression of NLBP promotes the cell proliferation of lung adenocarcinoma through interacting with p120ctn and suggest that NLBP may function as an oncogene in early stage carcinogenesis of lung adenocarcinoma.
Keywords: cell proliferation, NLBP, p120 catenin, ubiquitination, cancer
Introduction
Lung cancer, which comprises approximately 85% non-small-cell lung cancer (NSCLC), is one of the leading causes of cancer-related mortality globally. Despite major advances in cancer treatment in the past two decades, the prognosis of patients with lung cancer has improved only minimally, with overall 5-y survival rates between 14% and 16%.1 To improve patient outcomes, it is clinically important to find efficient new targets for the diagnosis and effective treatment of lung cancer. Cancer is a multi-factorial and multi-step process that involves activating oncogenes and inactivating tumor suppressor genes in different stages of cancer progression.2 Clarifying and investigating the roles of the genes involved in lung cancer development will contribute to our understanding of the mechanisms of lung carcinogenesis.
NLBP (also known as KIAA0776, Maxer) contains 794 amino acids and no well-known functional domain. NLBP has been detected in the cytoplasm, nucleus and endoplasmic reticulum (ER). This means that NLBP has important functions at various cell components. NLBP was identified by their ability to bind to LZAP, a tumor suppressor/oncogene that inhibits cancer cell invasion.3-8 NLBP inhibits nuclear factor-kappa B (NFκB)-mediated transcription and expression of MMP-9 and works as a suppressor of cell invasion.3,4 But, a recent paper showed that NLBP/Maxer knockdown by transfection with small interfering RNA (siRNA) suppressed the proliferation of C6 glioma cells to induce G1 accumulation to affect cyclin D1 expression.5
p120ctn is known as substrate of Src protein and various receptor tyrosine kinases. It contains a coiled-coil domain, an N-terminal phosphorylation domain and a central Arm domain consisting of Arm repeats.9 It also affects Rho-family GTPases such as Rac1, Cdc42, and RhoA in some cell types,10-13 which function in cadherin-mediated adhesion and cell migration.11 Therefore, p120ctn functions in stabilizing E cadherin involved in cell migration and invasion.12,13 Indeed, most proteins physically or functionally related to p120ctn and/or E-cadherin complex are oncogenes or tumor suppressors.14 However, recent studies implicated p120ctn as a cell cycle activator to show that both p120ctn isoforms 1 or 3 of 4 types of isoforms could affect cell proliferation in lung cancer cells, which are mediated by cyclin D1.15,16
Until now, the biological roles of NLBP in human lung carcinogenesis have not been established. To address this question, we checked NLBP expression in human lung cancer and examined the effect of NLBP on the proliferation of lung adenocarcinoma cells. Furthermore, we checked the correlation between NLBP and p120ctn, which is identified new binding partner of NLBP in present study, in human lung cancer and lung cancer cell lines.
Results
Expressional analysis of NLBP in human lung cancer tissues and lung cancer cell line
Previously, we identified NLBP as an LZAP/CDK5RAP3-binding protein and demonstrated that the expression of NLBP reduces the cell invasion and NFκB activation.3,4 These phenomena prompted the examination of the possibility that NLBP may be a potential tumor suppressor. Since tumor suppressors are inactivated in many tumors by reducing their expression, we checked the NLBP expression levels in human lung cancer tissues using immunohistochemical staining and western blotting. In immunohistochemical staining analysis of 29 NSCLC surgical specimens, 18 cases (62%) showed low NLBP expression, and 11 cases (38%) exhibited high NLBP expression. In 29 NSCLC surgical specimens using immunohistochemical staining, nine of 15 (60%) cases of adenocarcinoma showed high NLBP expression, and two of 14 (14.3%) cases of SCC exhibited high NLBP expression (P = 0.011) (Fig. 1A). The relationship between NLBP expression and various clinicopathological parameters is described in Table 1. In addition, NLBP expression was significantly correlated with tumor size (P = 0.006). There was no statistically significant difference in NLBP expression by the other parameters (Table 1). However, in the subgroup analysis of 15 adenocarcinomas, NLBP expression was significantly correlated with N staging and tumor size (7 cases high expression out of N0–1 [n = 8] vs. 5 cases low expression out of N2 [n = 7], and nine cases high expression out of not more than 5 cm [n = 12] vs. 3 cases low expression out of more than 5 cm [n = 3], P = 0.041 and P = 0.044, respectively; data not shown).
Figure 1. Expression of NLBP in lung cancer tissues and exogenic NLBP expression promotes the H1299 lung adenocarcinoma cell lines. (A) The bar graphs show that the number of patients in NLBP expression by immunohistochemical analysis correlate with histologic type of NSCLC *(P < 0.05). (B and C) Examples of expression of NLBP in lung adenocarcinoma and squamous cell carcinoma. (B) Immunohistochemical analysis of NLBP in the tumor and adjacent non-tumor of lung cancer tissues (original magnification, ×200). Representative NLBP immunohistochemical images (upper panel) of adenocarcinoma (patient #26) and squamous cell carcinoma (patient #21) in 29 NSCLC samples are shown. The lower panel shows hematoxylin and eosin stained images corresponding to immunohistochemical images. (C) Immunoblot of tissue samples representative of lung adenocarcinoma (patient #21) and squamous cell carcinoma (patient #26). (D and E) Exogenic NLBP expression promotes the H1299 lung adenocarcinoma cell lines. H1299 cell lines were transfected with mock or NLBP expression plasmid. (D) The cell proliferation rates of transfected cell lines were examined by MTT assay at the indicated times. (E) The exogenic expression of NLBP was detected by western blotting using the indicated antibodies.
Table 1. Relationship between NLBP expression and clinicopathological factors of 29 patients with NSCLC.
| Clinicopathological factors (n) | NLBP expression | P value | |
|---|---|---|---|
| |
Low |
High |
|
| Gender |
|
|
0.999 |
| Male (25) Female (4) |
15 3 |
10 1 |
|
| Histology |
|
|
0.011 |
| Adenocarcinoma (15) SCC (14) |
6 12 |
9 2 |
|
| Differentiation |
|
|
0.622 |
| Well~moderate (24) Poor (5) |
14 4 |
10 1 |
|
| Tumor size |
|
|
0.012 |
| < 5 cm (21) ≥ 5 cm (8) |
10 8 |
11 0 |
|
| N stage |
|
|
0.064 |
| 0–1 (17) 2 (12) |
8 10 |
9 2 |
|
| Vascular invasion |
|
|
0.249 |
| No (16) Yes (13) |
8 10 |
8 3 |
|
| Lymphatic invasion |
|
|
0.677 |
| No (7) Yes (22) |
5 13 |
2 9 |
|
SCC, squamous cell carcinoma.
Representative expression patterns of NLBP in lung adenocarcinoma and SCC tissues evident by immunohistochemistry (Fig. 1B) and immunoblotting (Fig. 1C) are shown. In the positive cases, NLBP was mainly detected in the cytoplasm of the tumor cells (Fig. 1B). NLBP expression was also observed in normal lung tissue or mucosal gland distant from the tumors (Fig. 1B). These results indicated that NLBP probably has biological heterogeneity between the two histologies and that the upregulation of NLBP may be associated with the early progression of lung adenocarcinoma. So, we checked the possible role of NLBP as a cell proliferation activator in H1299 lung adenocarcinoma cells. .MTT assay showed that overexpression of NLBP caused a significant increase of the proliferation rate in H1299 (Fig. 1D). Western blot validated high transfection efficiency (Fig. 1E). These data suggest that NLBP positively regulates proliferation of H1299 lung cancer cells.
Identification of p120ctn as a NLBP-binding protein
Present and prior data suggested that NLBP may have dual functions to promote cell proliferation and inhibit cell invasion, such as p120ctn, which functions as a cell proliferation activator to regulate cyclin D1 expression as well as a tumor suppressor to inhibit cell invasion and migration.15,16 So, we wanted to check the correlation between NLBP and p120ctn in H1299 cell proliferation. First, we examined the binding between NLBP and p120ctn in H1299 cells. We immunoprecipitated various proteins related cell invasion including SFB-LZAP, -CRMP1, -p120ctn, or Flag-Smurf2 with Myc-NLBP protein. Since LZAP is a known NLBP binding partner, we used it as a positive control. Among these proteins, NLBP bound to p120ctn as well as LZAP, but not to CRMP1 and Smurf2 (Fig. 2A). We further confirmed the binding between p120ctn and NLBP using reverse immunoprecipitation (Fig. 2B). The binding between NLBP and p120ctn was also verified using in vitro and endogenous binding assays. A GST-pull down assay using GST-NLBP fusion protein and cell lysates of 293T cells overexpressing Flag tagged p120ctn showed that GST-NLBP specifically bound to overexpressed p120ctn, in contrast to GST only (Fig. 2C). Immunoprecipitation analysis using anti-p120ctn antibody also revealed that p120ctn specifically bound to NLBP at endogenous levels in H1299 (Fig. 2D). These data indicated that p120ctn is a real NLBP-binding partner.
Figure 2. Identification of p120ctn as a novel NLBP-binding protein. (A and B) Binding between p120ctn and NLBP in overexpressed system. (A) Myc-NLBP was transfected with SFB-LZAP, -CRMP1, -p120ctn, or Flag-Smurf2 in H1299 cells. Cell lysates were immunoprecipitated with anti-Flag antibody and subjected to western blot analysis using the indicated antibodies. The bottom panel shows equal volumes of cell lysates immunoblotted with the indicated antibodies. (B) SFB-p120ctn was transfected with Myc-vector or -NLBP in H1299 cells. Cell lysates were immunoprecipitated with anti-Myc antibody and subjected to western blot analysis using the indicated antibodies. The bottom panel shows equal volumes of cell lysates immunoblotted with indicated antibodies. (C) An in vitro binding assay between GST-NLBP and Flag-p120ctn. Cell lysates of transfected with a Flag-p120ctn expression plasmid were incubated with 2 μg of GST or GST-NLBP fusion protein for 1 h at 4 °C. The bound complexes were separated by SDS-PAGE and subjected to western blot analysis using an anti-Flag antibody (upper panel). The Coomassie stained bottom panel shows the GST fusion proteins. (D) Endogenous binding between NLBP and p120ctn in H1299 cells. Immunoprecipitation reaction was performed using rabbit IgG or anti- p120ctn antibodies and subjected to western blot analysis using the indicated antibodies. The bottom panel shows equal volumes of cell lysates immunoblotted with indicated antibodies.
Regulatory domain of p120ctn and the N-terminus of NLBP are required for p120ctn and NLBP interaction
p120ctn contains a coiled-coil (CC), regulatory domain, armadillo repeats region and C-terminal region (Fig. 3A). We mapped NLBP interacting domains of p120ctn by coimmunoprecipitation analysis using wild-type and deletion mutants of p120ctn proteins and found that the p120ctn regulatory domain was responsible for the interaction between the two proteins (Figs. 3B). To exclude the possibility that altered protein conformational change was responsible for the inability of the p120ctn D2 mutant to bind NLBP, we performed coimmunoprecipitation analysis using only the regulatory domain expression plasmid (p120ctn A2). The regulatory domain was solely sufficient for interaction with NLBP (Fig. 3C). To narrowly map the interaction between p120ctn and NLBP, we generated a series of p120ctn D2 deletion mutants (R1:R3) (Fig. 3A) and performed co-immunoprecipitation using H1299 cell extracts. p120ctn constructs lacking the R3 region weakly associated with NLBP (Fig. 3D). The results indicated the interaction of NLBP with p120ctn through amino acids 261–396. To identify the region of NLBP that interacts with p120ctn, we constructed N- or C-terminal deletion mutants of NLBP. These mutants, as illustrated in Figure 4A, were tested for checking their ability to interact with the full-length p120ctn in coexpressed H1299 cells. The N-terminal region of NLBP comprising amino acids 1–370 was important for association with full-length p120ctn (Figs. 4B and C). Since the N-terminal region of NLBP is a LZAP-binding region, we checked the binding between p120ctn and LZAP. p120ctn interacted strongly with NLBP, and showed weak binding to LZAP (Fig. S1) indicating the binding of p120ctn to NLBP but not LZAP.
Figure 3. Identification of the NLBP-binding regions of p120ctn. (A) Diagram of wild-type and serial deletion mutants of p120ctn. (B) H1299 cells were transfected with plasmids encoding Myc-NLBP and wild-type or serial deletion mutants (D1–D4) of SFB- p120ctn. Cell lysates were subjected to immunoprecipitation with anti-Flag as in (B) or anti-Myc as in (C) antibodies and immunoblotted with the indicated antibodies. The amounts of SFB-p120ctn and Myc-NLBP in the lyastes were analyzed by immunoblotting using indicated antibodies and are shown in the bottom panels. (C) Myc-NLBP was co-expressed with varying p120ctn deletion constructs (D2 or A2). The transfected cell lysates were immunoprecipitated by anti-Flag antibody and immunoblotted by anti-Myc antibody. The amounts of SFB-p120ctn and Myc-NLBP in the lyaste were analyzed by immunoblotting using indicated antibodies and shown in the bottom panels. (D) Myc-NLBP was co-expressed with varying p120ctn D2 deletion constructs (D2, R1, R2 or R3) of SFB-p120ctn. The transfected cell lysates were immunoprecipitated by anti-Flag ,antibody and immunoblotted by anti-Myc antibody. The amounts of SFB-p120ctn and Myc-NLBP in the lyaste were analyzed by immunoblotting using indicated antibodies and shown in the bottom panels.
Figure 4. Identification of the p120ctn-binding regions of NLBP. (A) Diagram of wild-type and two deletion mutants of NLBP. (B and C) H1299 cells were transfected with plasmids encoding SFP-p120ctn and wild-type, N- or C-terminal mutant of Myc-NLBP. Cell lysates were subjected to immunoprecipitation with anti-Flag as in (B) or anti-Myc as in (C) and immunoblotted with the indicated antibodies. The amounts of SFB-p120ctn and Myc-NLBP in the lyaste were analyzed by immunoblotting using indicated antibodies and shown in the bottom panels.
NLBP regulates p120ctn protein stability by interfering with the ubiquitination of p120ctn
Interestingly, we observed that p120ctn constructs which didn’t associate with NLBP increase its stability (Fig. 3). In addition, many papers show that the stability of p120ctn is regulated by ubiquin/proteasome pathway.23,24 Thus, we tested whether NLBP regulated the stability of p120ctn. As the first step in assessing the relationship between p120ctn structure and its stability, we confirmed the increased p120ctn ubiquitination after the treatment of the proteasome inhibitor MG132 (Fig. 5A). The expression levels of p120ctn proteins increased after the treatment of the proteasome inhibitor MG132 in a concentration-dependent manner (Fig. 5B). These data indicated the degradation of p120ctn by the ubiquitin/proteasomal pathway. To further confirm the role of NLBP in regulating p120ctn stability, we checked whether the ubiquitination of p120ctn was dependent on NLBP binding. The data in Figures 5C and D showed that the deletion mutants of p120ctn (D2 and R3) which did not bind to NLBP, reduced the levels of ubiquitination of p120ctn. To ascertain how NLBP binding affects ubiquitination/proteasomal degradation of p120ctn, we tested whether NLBP inhibited p120ctn ubiquitination by examining ubiquitinated p120ctn in cells cotransfected with p120ctn and NLBP expression plasmid. Ubiquitinated p120ctn was reduced in p120ctn and NLBP expression plasmid cotransfected cells (Fig. 5E). The ability of NLBP to counter the destruction of p120ctn was dose-dependent (Fig. 5F). Knock-down of NLBP in H1299 cells using two different NLBP siRNAs revealed that NLBP knock-down significantly reduced p120ctn expression levels (Fig. 5G). These results suggest that binding between NLBP and p120ctn may affect the ubiqutination and stability of p120ctn.
Figure 5. NLBP inhibits proteasomal degradation of p120ctn. (A and B) p120ctn protein is degraded in a proteasome/ubiquitination-dependent manner. Cells were transfected with SFB-p120ctn and HA-Ubi, and the transfected cells were treated with 5 μM of MG132 for 6 h. Dimethylsulfoxide was used as the negative control for the ubiqutination assay. Transfected cell lysates were purified on streptavidin pull- down, and western blotting analysis was performed using the indicated antibodies. The amounts of SFB-p120ctn and HA-Ubi in the lyaste were analyzed by immunoblotting using the indicated antibodies and shown in the bottom panels (A). Western blot analysis of endogenous p120ctn expression levels in H1299 cells treated with 6 μM of MG132 for the indicated chase times was performed using the p120ctn and β-actin antibodies (B). (C) Ubiquitination of wild-type (WT) or serial deletion mutants (D1–D4) of p120ctn. H1299 cells were transfected with HA-Ubi with wild-type or serial deletion mutants (D1–D4) of SFB-p120ctn. Transfected cell lysates were purified on streptavidin pull-down, and western blotting analysis was performed using the indicated antibodies. The amounts of transfected proteins were analyzed by immunoblotting using indicated antibodies and shown in the bottom panels. (D) Ubiquitination of wild-type (WT) or serial deletion mutants (R1-R3) of SFP-p120ctn. H1299 cells were transfected with HA-Ubi with wild-type or serial deletion mutants (R1-R3) of SFB-p120ctn. Transfected cell lysates were purified on streptavidin pull-down, and western blotting analysis was performed using the indicated antibodies. The amounts of transfected proteins were analyzed by immunoblotting and shown in the bottom panels. (E) Coexpression of NLBP reduces ubiquitination of p120ctn protein. H1299 cells were transfected with indicated expression plasmids. Transfected cell lysates were purified on streptavidin pull-down, and western blotting analysis was performed using the indicated antibodies. The amounts of transfected proteins were analyzed by immunoblotting using indicated antibodies and are shown in the bottom panels. (F) Overexpressed NLBP stabilizes the p120ctn protein in a dose-dependent manner. Increasing doses of Myc-NLBP were co-transfected with SFB-p120ctn into the cells. The protein levels of SFB-p120ctn and Myc-NLBP were assessed by immunoblotting. Green fluorescence protein was used as an internal transfection control. (G) The cells were transfected with Con, or siRNA1 or 2 directed against NLBP protein for 48 h. Endogenous NLBP and p120ctn levels were monitored through immunoblotting using anti-NLBP or p120ctn antibodies. β-actin was served as internal loading controls.
Expressional analysis of NLBP and p120ctn in human lung adenocarcinoma tissues
p120ctn promotes cell proliferation of the lung cancer cell lines through increased cyclin D1 protein level.15,16 Consistent with these papers, we also confirmed the ability of p120ctn to promote H1299 lung cancer cells (Fig. 6A). Next, we examined whether NLBP-mediated H1299 cell proliferation was dependent on the p120ctn. Figure 6B shows that overexpression of NLBP promoted the H1299 cell proliferation and that this proliferation was inhibited in H1299 cells cotransfected with NLBP expression plasmid and p120ctn siRNA. The intensity of p120ctn band was significantly reduced by p120ctn knockdown using transfecting with siRNAs (Fig. 6C). In p120ctn immunohistochemical staining analysis, 14 (48%) and 15 (52%) cases showed normal and abnormal expression, respectively (Table 2). No statistically significant differences were detected between p120ctn expression and various clinicopathological parameters. In the subgroup analysis of over- or lower-expression of NLBP and p120ctn, we found that overexpression of two protein were 4 (67%) cases of adenocarcinoma (n = 6) as compared with the one (12.5%) case of SCC (n = 8) (P = 0.091, Table 2 and Fig. 6D). Although it was not statistically significant, this tendency was similar to data of our study and suggested that the overexpressions of NLBP and p120ctn may be associated with carcinogenesis of lung adenocarcinoma.
Figure 6. The functional correlation between NLBP and p120ctn. (A) Exogenic NLBP and p120ctn expression promotes the H1299 lung adenocarcinoma cell lines. H1299 cell lines were transfected with indicated expression plasmids. The cell proliferation rates of transfected cell lines were examined by the MTT assay at the indicated times. (B) p120ctn-mediated NLBP promoted H1299 cell proliferation. Myc-NLBP was transfected with/without p120ctn siRNA into H1299 cells. The cell proliferation rates of transfected cell lines were examined by MTT assay at the indicated times. (C) H1299 cells were transfected with control or p120ctn siRNA. After 48hr, transfected cell lysates were analyzed by SDS-PAGE and immunoblotted with the indicater antibody. (D) Immunoblot of lung adenocarcinoma tissue samples using the indicated antibodies.
Table 2. NLBP and p120ctn expression level correlates with clinicopathological factors of 29 patients with NSCLC.
|
Clinicopathological factors (n) |
NLBP expression |
P value |
p120ctn expression |
P value |
NLBP/p120ctn |
P value |
|||
| |
Low |
High |
|
Abnormal |
Normal |
|
Low/abnormal (9) |
High/normal (5) |
|
| Gender |
|
|
|
|
|
|
|
|
|
| Male (25) Female (4) |
15 3 |
10 1 |
0.999 |
13 2 |
12 2 |
0.999 |
8 1 |
5 0 |
0.999 |
| Histology |
|
|
|
|
|
|
|
|
|
| Adenocarcinoma (15) SCC (14) |
6 12 |
9 2 |
0.011 |
7 8 |
8 6 |
0.573 |
2 7 |
4 1 |
0.091 |
| Differentiation |
|
|
|
|
|
|
|
|
|
| Well~moderate (24) Poor (5) |
14 4 |
10 1 |
0.622 |
12 3 |
12 2 |
0.999 |
6 3 |
4 1 |
0.999 |
| Tumor size |
|
|
|
|
|
|
|
|
|
| <5 cm (21) ≥5 cm (8) |
10 8 |
11 0 |
0.012 |
10 5 |
11 3 |
0.682 |
4 5 |
5 0 |
0.086 |
| N stage |
|
|
|
|
|
|
|
|
|
| 0–1 (17) 2 (12) |
8 10 |
9 2 |
0.064 |
10 5 |
7 7 |
0.362 |
5 4 |
4 1 |
0.580 |
| Vascular invasion |
|
|
|
|
|
|
|
|
|
| No (16) Yes (13) |
8 10 |
8 3 |
0.249 |
7 8 |
9 5 |
0.340 |
4 5 |
5 0 |
0.086 |
| Lymphatic invasion |
|
|
|
|
|
|
|
|
|
| No (7) Yes (22) |
5 13 |
2 9 |
0.677 | 3 12 |
4 10 |
0.682 | 2 7 |
1 4 |
0.999 |
Discussion
The present study presents novel results indicating the interacting between NLBP and p120ctn in the development of lung adenocarcinoma. NLBP expression was increased in early stage of lung adenocarcinoma tissues compared with SCC and overexpressed NLBP promoted H1299 cell proliferation to regulate the p120ctn stability by inhibiting p120ctn ubiquitination. The data show the novel mechanism of NLBP in tumor development to control p120ctn stability.
The molecular functions of NLBP in cancer development are not fully elucidated. However, it has been reported that NLBP/Maxer siRNA-transfected C6 glioma cells reduce their proliferation to inhibit cyclin D1 expression.5 NLBP has been demonstrated to suppress cell invasion.3,4 LZAP, which is a NLBP binding partner, displays diverse effects in different human cancers.3,6,7,25 So, it seems that NLBP may be a more complex dual functional protein in tumor development and tumor suppressor to suppress cell invasion or to activate cell proliferation. We found that the expression level of NLBP correlated with the adenocarcinoma and tumor size of NSCLC, and that the overexpressed NLBP in lung adenocarcinoma correlated with the N stage and tumor size. These results suggest that NLBP may function as an oncogene in early-stage carcinogenesis of lung adenocarcinoma.
p120ctn is also known to have dual functions, like NLBP. p120ctn is reported to be required for invasion of E-cadherin-deficient cells in part by stabilizing the mesenchymal cadherins N-cadherin or cadherin-11, which are known to promote invasion. In contrast, p120ctn maintains cell-cell contacts by stabilizing E-cadherin in E-cadherin expressing cells. p120ctn functions as a cell cycle activator to promoter cell proliferation in lung cancer cells, which are mediated by cyclin D1.15,16 Consistent with these data, NLBP presently promoted lung cancer cell proliferation through binding with p120ctn, thereby inhibiting the ubquitination/proteosome degradation of p120ctn. Therefore, the dual activities of NLBP depend on stages of tumor progression and metastasis to bind to the different proteins, like p120ctn or LZAP.
In mapping studies, the N-terminal region of NLBP was required for interaction with regulatory domain of p120ctn. This region of p120ctn overlaps with the binding region of GSK3β and Dyrk1A, which modulates p120ctn levels.21,22 So, there may be two possible mechanisms of NLBP for regulating p120ctn stability. The first mechanism is that NLBP inhibits the binding between p120ctn and GSK3β, which is a negative regulator of p120ctn stability. This type of negative regulator that regulating GSK3β function and Notch3 stabilization in NSCLC by novel scaffold protein, STRAP was reported recently.26 This is similar to our hypothesis. The second mechanism is that NLBP promotes the binding between p120ctn and Dyrk1A, which is a positive regulator of p120ctn stability. We exclude the possibility that other E3 ligase(s) modulate the p120ctn stability. Thus, we suggest that one or more ubiquitin E3 ligase proteins may ubiquitinate p120ctn protein and have a major role in the interplay between NLBP and p120ctn and early stage of cancer development. Therefore, the identification of the E3 ligase(s) may be very important project. Multivariate analysis correlating clinical outcome parameters of lung cancer patients with tumor characteristics yielded the pathological stage as the only statistically significant determinant of N staging in adenocarcinoma.
p120ctn proposed to act coordinately with β-catenin in certain vertebrate Wnt signaling contexts. This Wnt signaling pathways are fundamental to embryo development and tumor progression.23,24 A recent report demonstrated that a combinatorial activation of both canonical Wnt signaling and Kras pathway showed a remarkable increase of lung cancer formation with a more progenitor-like phenotype. The timing of Wnt/β-catenin activation likely plays an important role as to whether tumors or precancerous lesions will form in the lung.27 Another study show that hTERT (Human telomerase reverse transcriptase) is a direct target gene of β-catenin and indicate, thereby, that the Wnt signaling pathway controls self-renewal and telomerase activity at the same time.28 Unexpectedly, absence of ASCIZ (ATM substrate Chk2-interacting Zn[2+]-finger protein, also known as ATMIN and ZNF822) also leads to severe organ development defects, most notably, complete absence of lungs similar to mutants in Wnt2-2b/β-catenin and FGF10/FGFR2b signaling pathways. Thus, ASCIZ has dual functions as an efficiency factor for DNA base damage repair as well as a key transcriptional regulator of early lung development.29 Accumulating evidence suggest that the molecular mechanisms of Wnt signaling pathways related to p120ctn are important to understand for human lung cancer development. Therefore, the interaction between NLBP and p120ctn may be provided new implications for p120ctn signaling pathways.
Even though we did not find any correlation with overall survival because of small case number, if more cases were added to the statistical analysis, we may be able to propose that NLBP expression could be used as a prospective prognostic determinant of early stage of lung adenocarcinoma.
Materials and Methods
Plasmids
Human NLBP (KIAA0776), LZAP, CRMP1, Smurf2, and p120ctn cDNAs were purchased from American Type Culture Collection (ATCC) and Openbiosystems. The mammalian plasmid for the wild-type and deletion mutants of NLBP (Myc-NLBP) and wild-type of p120ctn (SFB-p120ctn) were generated by cloning the polymerase chain reaction (PCR) fragments into the Myc-tagged mammalian expression plasmid and S-Flag-tagged mammalian expression plasmid. Glutathione S-transferase (GST)-NLBP fusion construct was generated by PCR of NLBP and subcloned into pGEX-4T-1(GE Healthcare).
Cell culture and transfection
Human embryonic kidney 293T and lung adenocarcinoma H1299 cells were purchased from ATCC and maintained in DMEM medium and RPMI1640 supplemented with 10% fetal bovine serum at 37 °C in 5% CO2 (v/v). The cells (3 × 105) were plated on a 60 mm-diameter plate and transfected with the plasmids using Fugene6 reagent according to the manufacturer’s instructions (Roche).
Antibodies and immunoprecipitation
Anti-Myc, anti-β-actin, anti-HA, and anti-Flag antibodies (Sigma-Aldrich) and monoclonal p120ctn and NLBP antibodies (Santa Cruz Biotechnology and BD Bioscience) were obtained from commercial sources. Rabbit polyclonal anti-NLBP antibody was previously described.3 The resulting rabbit polyclonal antibodies were affinity-purified using the Sulfolink or AminoLink Plus Immobilization and Purification Kit (Pierce). The immunoprecipitation was previously described.3 293T or H1299 cells (3 × 106 cells) in a 100 mm-diameter plate were transfected with 4.5 µg of each of the expression plasmids as indicated in each figure legend. After 48 h, the cells were lysed in NETN buffer for 20 min on ice. Crude lysates were cleared by centrifugation at 14 000 rpm at 4 °C for 5 min, and supernatants were incubated with protein A- or G-agarose-conjugated primary antibodies. The immunocomplexes were washed three times with NETN buffer and subjected to sodium dodecyl sulfate-PAGE (SDS-PAGE). Western blotting was performed using the antibodies indicated in the figure legends.
Purification of GST-fusion protein
The GST fusion protein was expressed in Escherichia coli and purified as previously described.17
siRNA
All siRNA duplexes used in this study were purchased from IDT(Integrated DNA Technologies, Inc). The sequence of NLBP siRNA1 and 2 are 5-AGAAATGAGAGATGAGCTA and AGAAGAGGTCAATGATAAA, respectively, and have been described previously.3 The sequence of p120ctn siRNA1 and 2 are 5-GGACCTTACTGAAGTTATTTT and TAGCTGACCTCCTGACTAATT, respectively.18 The sequence of control siRNA is TTCAATAAATTCTTGAGGTTT. siRNAs were transfected into cells using RNAiMAX (Invitrogen) according to the manufacturer’s instructions.
Cell proliferation assay
The transfected cells were seeded in 96-well plates (1 × 104 cells /ml) in each well and incubated for indicated times respectively. The cell proliferation was examined by an established 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assayv performed according to the manufacturer’s instructions (5 mg/ml; Promega).
Patients and tissue specimens
We used anonymous primary tumor specimens from 29 patients diagnosed with NSCLC who underwent complete resection at the Inha University Hospital from 2003 through 2011. Follow-up information was obtained from review of the patients’ medical record and the Lung Cancer Cohort of Inha University Hospital.19 All patients had adequate formalin-fixed, paraffin-embedded (FFPE) tissue blocks. None of the patients had received radiotherapy or chemotherapy before surgical resection. This study protocol was approved by the Institutional Review Board of Inha University Hospital. The tumors were staged according to the seventh edition of TNM classification of NSCLC20 and were histologically subtyped and graded according to the World Health Organization guidelines.21 The median age of the patients was 62 y (range, 44–75 y). There were 14 cases of squamous cell carcinoma (SCC) and 15 cases of adenocarcinoma. Of these samples, 23 fresh specimens including both tumor tissue and corresponding normal tissue were stored at −70 °C immediately after resection for extraction of protein.
Immunohistochemistry
FFPE tissues were sectioned at a thickness of 4 µm and immunohistochemical stained using a BenchMark XT automated immunohistochemical stainer (Ventana Medical Systems Inc) with heat-induced epitope retrieval (CC1 solution; Ventana). The iView DAB detection kit (Ventana) was used to visualize in situ expression of the antigen. In brief, CC1 standard (pH 8.4 buffer containing Tris/Borate/EDTA) was used for antigen retrieval at 99 °C for 60 min. The endogenous peroxidase was block by incubation with iVIEW inhibitor (3% H2O2, endogenous peroxidase) at 37 °C for 4 min. The slides were incubated with NLBP polyclonal antibody (1:150, Abnova), p120ctn monoclonal antibody (1:300; Epitomics) at 37 °C for 32 min and secondary antibody to iVIEW biotinylated Ig at 37 °C for 8 min. Slides were incubated in iVIEW streptavidin horseradish peroxidase at 37 °C for 8 min and then DAB+H2O2 substrate for 8 min, followed by counterstaining with hematoxylin and bluing reagent at 37 °C. Reaction buffer (pH 7.6 Tris buffer) was used as a washing solution. Normal bronchial and submucosal glandular epithelia were used as internal control for immunohistochemical staining. Reaction buffer without primary antibodies was used as negative control to exclude the nonspecific signal. All of the immunostained sections were examined by an experienced pathologist who was unware of the patients’ clinical data.
For semiquantitative estimation of the NLBP immunohistochemical staining, the method used for LZAP was applied to our study (10). Briefly, the percentage of positively stained tumor cells was scored as 0 (<5%), 1 (5–25%), 2 (25–50%) or 3 (>50%), and intensity of staining was scored as 0 (no staining), 1 (weakly stained), 2 (moderately stained), or 3 (strongly stained). Based on the NLBP immunohistochemical staining score, which was obtained by multiplying the percentage positive score by the intensity score, we defined the NLBP expression levels as follows: the low NLBP expression group (− [score 0–1], + [score 2–3]) and the high NLBP expression group (++ [score 4–6], +++ [score >6]). As for p120ctn, the scoring criteria described by Liu et al.22 were applied to our study with slight modification. The staining scores were determined by the percentage of positive cells per slide (0–100%) for membranous and cytoplasmic staining separately. Normal expression was defined as when over 90% of the tumor cells showed cell membrane staining, and when less than 90% of the tumor cells showed cell membrane staining or more than 10% of the tumor cells showed cytoplasmic and/or nucleus staining.
Statistical analyses
The correlation between tumor protein expression and the clinicopathological features was performed using chi-square or Fisher exact tests. A paired-sample t test was used to compare the protein expression in lung tumors with that of their paired adjacent normal lung tissue samples. Overall survival curves were calculated with the Kaplan-Meier method and were analyzed with the log-rank test. All analyses were performed using the SPSS version 12.0 program (SPSS). Statistical significance was defined as P < 0.05.
Supplementary Material
Acknowledgments
This work was supported by National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 20110030831), National Research Foundation of Korea (NRF) grant funded by the korea government(MEST)(2011-0013271), and This study was supported by a grant of Korea Healthcare Technology R&D Project, Ministry for Health, Welfare and Family Affairs, Republic of Korea (A110518).
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Supplemental Materials
Supplemental materials may be found here: http://www.landesbioscience.com/journals/cc/article/25451
Footnotes
Previously published online: www.landesbioscience.com/journals/cc/article/25451
References
- 1.Siegel R, Ward E, Brawley O, Jemal A. Cancer statistics, 2011: the impact of eliminating socioeconomic and racial disparities on premature cancer deaths. CA Cancer J Clin. 2011;61:212–36. doi: 10.3322/caac.20121. [DOI] [PubMed] [Google Scholar]
- 2.Hahn WC, Weinberg RA. Rules for making human tumor cells. N Engl J Med. 2002;347:1593–603. doi: 10.1056/NEJMra021902. [DOI] [PubMed] [Google Scholar]
- 3.Kwon J, Cho HJ, Han SH, No JG, Kwon JY, Kim H. A novel LZAP-binding protein, NLBP, inhibits cell invasion. J Biol Chem. 2010;285:12232–40. doi: 10.1074/jbc.M109.065920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Wu J, Lei G, Mei M, Tang Y, Li H. A novel C53/LZAP-interacting protein regulates stability of C53/LZAP and DDRGK domain-containing Protein 1 (DDRGK1) and modulates NF-kappaB signaling. J Biol Chem. 2010;285:15126–36. doi: 10.1074/jbc.M110.110619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Shiwaku H, Yoshimura N, Tamura T, Sone M, Ogishima S, Watase K, et al. Suppression of the novel ER protein Maxer by mutant ataxin-1 in Bergman glia contributes to non-cell-autonomous toxicity. EMBO J. 2010;29:2446–60. doi: 10.1038/emboj.2010.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang J, An H, Mayo MW, Baldwin AS, Yarbrough WG. LZAP, a putative tumor suppressor, selectively inhibits NF-kappaB. Cancer Cell. 2007;12:239–51. doi: 10.1016/j.ccr.2007.07.002. [DOI] [PubMed] [Google Scholar]
- 7.Mak GW, Chan MM, Leong VY, Lee JM, Yau TO, Ng IO, et al. Overexpression of a novel activator of PAK4, the CDK5 kinase-associated protein CDK5RAP3, promotes hepatocellular carcinoma metastasis. Cancer Res. 2011;71:2949–58. doi: 10.1158/0008-5472.CAN-10-4046. [DOI] [PubMed] [Google Scholar]
- 8.Zhao JJ, Pan K, Li JJ, Chen YB, Chen JG, Lv L, et al. Identification of LZAP as a new candidate tumor suppressor in hepatocellular carcinoma. PLoS One. 2011;6:e26608. doi: 10.1371/journal.pone.0026608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Reynolds AB, Herbert L, Cleveland JL, Berg ST, Gaut JR. p120, a novel substrate of protein tyrosine kinase receptors and of p60v-src, is related to cadherin-binding factors beta-catenin, plakoglobin and armadillo. Oncogene. 1992;7:2439–45. [PubMed] [Google Scholar]
- 10.Anastasiadis PZ, Moon SY, Thoreson MA, Mariner DJ, Crawford HC, Zheng Y, et al. Inhibition of RhoA by p120 catenin. Nat Cell Biol. 2000;2:637–44. doi: 10.1038/35023588. [DOI] [PubMed] [Google Scholar]
- 11.Grosheva I, Shtutman M, Elbaum M, Bershadsky AD. p120 catenin affects cell motility via modulation of activity of Rho-family GTPases: a link between cell-cell contact formation and regulation of cell locomotion. J Cell Sci. 2001;114:695–707. doi: 10.1242/jcs.114.4.695. [DOI] [PubMed] [Google Scholar]
- 12.Noren NK, Liu BP, Burridge K, Kreft B. p120 catenin regulates the actin cytoskeleton via Rho family GTPases. J Cell Biol. 2000;150:567–80. doi: 10.1083/jcb.150.3.567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Soto E, Yanagisawa M, Marlow LA, Copland JA, Perez EA, Anastasiadis PZ. p120 catenin induces opposing effects on tumor cell growth depending on E-cadherin expression. J Cell Biol. 2008;183:737–49. doi: 10.1083/jcb.200805113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Thoreson MA, Reynolds AB. Altered expression of the catenin p120 in human cancer: implications for tumor progression. Differentiation. 2002;70:583–9. doi: 10.1046/j.1432-0436.2002.700911.x. [DOI] [PubMed] [Google Scholar]
- 15.Liu Y, Dong QZ, Zhao Y, Dong XJ, Miao Y, Dai SD, et al. P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells. Exp Cell Res. 2009;315:890–8. doi: 10.1016/j.yexcr.2008.12.016. [DOI] [PubMed] [Google Scholar]
- 16.Jiang G, Wang Y, Dai S, Liu Y, Stoecker M, Wang E, et al. P120-catenin isoforms 1 and 3 regulate proliferation and cell cycle of lung cancer cells via β-catenin and Kaiso respectively. PLoS One. 2012;7:e30303. doi: 10.1371/journal.pone.0030303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Cho HJ, Oh YJ, Han SH, Chung HJ, Kim CH, Lee NS, et al. Cdk1 protein-mediated phosphorylation of receptor-associated protein 80 (RAP80) serine 677 modulates DNA damage-induced G2/M checkpoint and cell survival. J Biol Chem. 2013;288:3768–76. doi: 10.1074/jbc.M112.401299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Cheung LW, Leung PC, Wong AS. Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene. 2010;29:2427–40. doi: 10.1038/onc.2009.523. [DOI] [PubMed] [Google Scholar]
- 19.Kim HT, Lee JE, Shin ES, Yoo YK, Cho JH, Yun MH, et al. Effect of BRCA1 haplotype on survival of non-small-cell lung cancer patients treated with platinum-based chemotherapy. J Clin Oncol. 2008;26:5972–9. doi: 10.1200/JCO.2008.16.6496. [DOI] [PubMed] [Google Scholar]
- 20.Goldstraw P, Crowley J, Chansky K, Giroux DJ, Groome PA, Rami-Porta R, et al. International Association for the Study of Lung Cancer International Staging Committee. Participating Institutions The IASLC Lung Cancer Staging Project: proposals for the revision of the TNM stage groupings in the forthcoming (seventh) edition of the TNM Classification of malignant tumours. J Thorac Oncol. 2007;2:706–14. doi: 10.1097/JTO.0b013e31812f3c1a. [DOI] [PubMed] [Google Scholar]
- 21.Travis WD, Brambilla E, Muller-Hermelink HK. CC H. World Health Organization classification of tumours: pathology and genetics of tumours of the lung, pleura, thymus and heart. IARC, Lyon, 2004. [Google Scholar]
- 22.Liu Y, Wang Y, Zhang Y, Miao Y, Zhao Y, Zhang PX, et al. Abnormal expression of p120-catenin, E-cadherin, and small GTPases is significantly associated with malignant phenotype of human lung cancer. Lung Cancer. 2009;63:375–82. doi: 10.1016/j.lungcan.2008.12.012. [DOI] [PubMed] [Google Scholar]
- 23.Hong JY, Park JI, Cho K, Gu D, Ji H, Artandi SE, et al. Shared molecular mechanisms regulate multiple catenin proteins: canonical Wnt signals and components modulate p120-catenin isoform-1 and additional p120 subfamily members. J Cell Sci. 2010;123:4351–65. doi: 10.1242/jcs.067199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hong JY, Park JI, Lee M, Muñoz WA, Miller RK, Ji H, et al. Down’s-syndrome-related kinase Dyrk1A modulates the p120-catenin-Kaiso trajectory of the Wnt signaling pathway. J Cell Sci. 2012;125:561–9. doi: 10.1242/jcs.086173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chen J, Shi Y, Li Z, Yu H, Han Y, Wang X, et al. A functional variant of IC53 correlates with the late onset of colorectal cancer. Mol Med. 2011;17:607–18. doi: 10.2119/molmed.2010.00192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kashikar ND, Zhang W, Massion PP, Gonzalez AL, Datta PK. Role of STRAP in regulating GSK3β function and Notch3 stabilization. Cell Cycle. 2011;10:1639–54. doi: 10.4161/cc.10.10.15630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Pacheco-Pinedo EC, Morrisey EE. Wnt and Kras signaling-dark siblings in lung cancer. Oncotarget. 2011;2:569–74. doi: 10.18632/oncotarget.305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jaitner S, Reiche JA, Schäffauer AJ, Hiendlmeyer E, Herbst H, Brabletz T, et al. Human telomerase reverse transcriptase (hTERT) is a target gene of β-catenin in human colorectal tumors. Cell Cycle. 2012;11:3331–8. doi: 10.4161/cc.21790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Heierhorst J, Smyth I, Jurado S. A breathtaking phenotype: unexpected roles of the DNA base damage response protein ASCIZ as a key regulator of early lung development. Cell Cycle. 2011;10:1222–4. doi: 10.4161/cc.10.8.15336. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.