Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Mar 15.
Published in final edited form as: Aquat Toxicol. 2012 Nov 29;0:10.1016/j.aquatox.2012.11.017. doi: 10.1016/j.aquatox.2012.11.017

Identification and Expression of Multiple CYP1-like and CYP3-like Genes in the Bivalve Mollusk Mytilus edulis

Juliano Zanette 1,2,**, Matthew J Jenny 1,3, Jared V Goldstone 1, Thiago Parente 1,4, Bruce R Woodin 1, Afonso C D Bainy 2, John J Stegeman 1,*
PMCID: PMC3846546  NIHMSID: NIHMS432142  PMID: 23277104

Abstract

Various sequencing projects over the last several years have aided the discovery of previously uncharacterized invertebrate sequences, including new cytochrome P450 genes (CYPs). Here we present data on the identification and characterization of two CYP1-like and three CYP3-like genes from the bivalve mollusk Mytilus edulis, and assess their potential as biomarkers based on their responses to several known vertebrate aryl hydrocarbon receptor (AHR) agonists. Quantitative real-time PCR was used to measure CYP transcript levels in digestive gland, labial palps, adductor muscle, gill, foot, and different regions of the mantle. Levels of both CYP1-like genes were highest in digestive gland, whereas labial palps had the highest expression levels of the three CYP3-like genes followed by digestive gland and outer margin of the mantle. Mussels were exposed by injection to the AHR agonists, β-naphthoflavone (BNF; 25 μg.g−1), 3,3′,4,4′,5-polychlorinated biphenyl (PCB126; 2 μg.g−1), or 6-formylindolo[3,2-b]carbazole (FICZ; 0.1 μg.g−1), or to Aroclor 1254 (a mixture of PCBs; 50 μg.g−1) for 24 hours, followed by CYP expression analysis. There was no statistically significant change in expression of either of the CYP1-like genes after exposure to the various AHR agonists. The CYP3-like-1 gene was significantly up-regulated by BNF in gill tissues and the CYP3-like-2 gene was up-regulated in digestive gland by PCB126 and in gill tissue by BNF. These results suggest that distinct mechanisms of CYP gene activation could be present in M. edulis, although the importance of the CYP1-like and CYP3-like genes for xenobiotic and endogenous lipids biotransformation requires additional investigation.

Keywords: cytochrome P450, CYP, AHR, Mytilus edulis, blue mussel, pollution

Introduction

The cytochrome P450s (CYPs) comprise one of the largest and most versatile protein families in living organisms, and they catalyze an extraordinary range of important biochemical reactions. Vertebrate CYPs are distributed in 18 families and a growing number of subfamilies, with for example, 57 genes arranged into 42 subfamilies in humans (Nelson et al., 2004). A large diversity of CYP genes also occurs in invertebrates, including members of the prebilateria such as the sea anemone (Goldstone, 2008), early-diverging deuterostomes (e.g., sea urchin (Goldstone et al., 2006)), and protostomes, including the ecdysozoa (e.g. Daphnia pulex (Baldwin et al., 2009) and Caenorhabditis elegans (Gotoh, 1998)), and the lophotrochozoa (e.g., the gastropod Lottia gigantea (Gotoh, 2012; Nelson, 2011; Nelson et al., 2012)). In all animals CYPs are thought to have roles in xenobiotic metabolism and bioactivation, and in development and maintenance of homeostasis, via regulation of signaling molecules (e.g. steroid hormones, eicosanoids and retinoic acid) (Nebert and Dalton, 2006; Nebert and Russell, 2002; Rewitz et al., 2006). However, even in vertebrates not all CYPs have known functions, and for most species many CYPs can be considered as “orphans”, enzymes for which the biological role is unknown.

In vertebrates, members of the CYP1 and CYP2 families (all in CYP Clan 2) and the CYP3 family (in CYP Clan 3) are known for the oxidative transformation of xenobiotics, e.g., drugs, pesticides and polycyclic aromatic hydrocarbons (PAHs) (Nebert and Russell, 2002). The induction of vertebrate CYP1 genes occurs via the aryl-hydrocarbon receptor (AHR), activated by xenobiotic chemicals such as planar halogenated hydrocarbons and PAHs, and by dietary compounds such as flavonoids (Denison et al., 2002; Hahn, 2002). The expression of CYP1 family members, especially of the CYP1A subfamily in fish, birds and mammals, has been used for decades as a marker of environmental or experimental exposure to AHR agonists (Bucheli and Fent, 1995; Payne, 1976; Stegeman et al., 1986).

Bivalves have long been known to accumulate foreign organic chemicals (Stegeman and Teal, 1973) and metals (Huggett et al., 1973) and have been employed extensively as sentinels in monitoring programs, e.g., the Mussel Watch Program in the USA and the MEDPOL and BIOMAR programs in Europe (Dondero et al., 2006; Venier et al., 2006). Many studies have examined total microsomal cytochrome P450 content, levels of CYP enzyme activity, or CYP protein by immunoassay in bivalve mollusks exposed to chemicals (Canova et al., 1998; Livingstone, 1998; Livingstone et al., 1989; Monari et al., 2007; Monari et al., 2009; Shaw et al., 2002; Snyder et al., 2001; Sole and Livingstone, 2005; Wootton et al., 1995). The interpretation of those measurements has been complicated by low catalytic activity of microsomal enzymes with diagnostic substrates for CYP1A-like activity, such as ethoxyresorufin (ethoxyresorufin-O-deethylase activity, EROD) and benzo[a]pyrene (benzo[a]pyrene hydroxylase; BPH), and lack of specific cross-reactivity of antibodies for CYP1As, (Chaty et al., 2004; Jonsson et al., 2006a; Jonsson et al., 2006b). Thus, the use of CYP protein or activity as a marker of exposure to or effects of environmental contaminants in bivalves has met with limited success and weak inference at best, reflecting the limited characterization of CYP genes and proteins in mollusks.

The sequencing of the gastropod Lottia gigantea genome revealed numerous CYP genes, and bivalve EST libraries have provided a new basis of comparison into molluscan CYP diversity (Craft et al., 2010; Fiedler et al., 2010; Gotoh, 2012; Lockwood and Somero, 2011; Milan et al., 2011; Nelson, 2011; Nelson et al., 2012). We recently identified more than 50 unique CYP sequences in Mytilus californianus (Zanette et al., 2010) from previously sequenced EST libraries (Connor and Gracey, 2011). Some of these sequences clustered with CYP1 sequences of vertebrates and with CYP1-like genes in Lottia gigantea (Zanette et al., 2010). In the present study we focused on M. edulis CYP sequences, seeking possible homologs of vertebrate CYPs that respond to chemical exposure. We cloned full-length sequences for multiple CYP genes, and found them related to genes in vertebrate CYP1 and CYP3 families. We examined organ distribution of expression and the responses to selected AHR agonists, including 3,3′,4,4′,5-polychlorinated biphenyl congener 126 (PCB126), a mixture of PCBs (Aroclor 1254), and the synthetic compound β-naphthoflavone (BNF). Notably, we also tested the endogenous tryptophan metabolite 6-formylindolo[3,2-b]carbazole (FICZ), a highly potent and rapidly metabolized AHR agonist suggested to be a physiological ligand for AHR (Wincent et al., 2009). The results are foundational for studies of CYP1- and CYP3-like genes in bivalves.

Methods

Animal sampling and laboratory care

Mussel Mytilus edulis of both sexes, 6–8 cm in shell length, were sampled from a clean reference site (Scorton Creek, Massachussets, USA) in August and September 2008, transferred to the laboratory and acclimated at 20°C in flowing seawater for one week. Food was given twice a day as a mixture of microalgae Thalasiosira weissflogi, Tetraselmis chuil and Isochrysis sp., cultured for this purpose.

Cloning of CYP1-like and CYP3-like transcripts in Mytilus edulis

Digestive gland was dissected from one randomly selected untreated mussel. Total RNA was isolated using the Aurum™ Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad Laboratories Inc., Hercules, CA), which eliminates genomic DNA by DNAse treatment. RNA quantity and quality were determined spectrophotometrically (Nanodrop ND 1000; NanoDrop Technologies, Wilmington, DE). cDNA was synthesized from 2 μg of total RNA, using the Omniscript Reverse Transcriptase kit (Qiagen Inc., Valencia, CA), anchored oligo(dT) primer (MWG Biotech, Inc., High Point, NC) and RNasin RNase inhibitor (Promega Corp., Madison, WI).

Primers used in the identification of the M. edulis CYP1-like-1, CYP1-like-2 and CYP3-like-3 sequences were designed with Primer3 (Rozen and Skaletsky, 2000). The primers were designed based on the CYP1-like and CYP3-like transcripts from the mussel M. californianus, previously identified by phylogenetic analysis (Zanette et al., 2010), and were to regions of the transcripts expected to be highly conserved. CYP1-like-1 primers were designed based on one M. californianus contig obtained from EST sequences in the GenBank with accession numbers ES401002, ES398625, ES407183, ES400274, ES401422, ES400520, ES403691, ES405860, ES401376, ES402773, ES404163, ES398150 and ES407922. Primers for CYP1-like-2 and CYP3-like-3 were designed based on M. californianus EST sequences with the accession numbers ES399754 and ES400411, respectively. Primer sequences are shown in Table 1. The full-length sequences of the two other M. edulis CYP3-like genes analyzed in the present study were found in Genbank, accession numbers AB479540 and AB479539. We did not clone those sequences but used them to design qPCR primers (below). (A paper describing these latter two M. edulis CYP3-like genes was published recently (Cubero-Leon et al., 2012), after our study was completed. The sequences we refer to as CYP3-like-1and CYP3-like-2 are referred to as CYP3A-like isoform 2 and CYP3A-like isoform 1, respectively, in that paper.)

Table 1.

Mytilus californianus primers used for the cloning of the new CYP1-like and CYP3-like genes in Mytilus edulis.

Primer name Primer sequence 5′-3′
CYP1-1 forward TGACGTGTTTAAAATTCGCATGG
CYP1-1 reverse CTGCGTCCAATACCAAATGTAAG
CYP1-2 forward TTGGGAAATACGAAAGCTACCTCCA
CYP1-2 reverse TCCAGCAACAATGAAATCCCGTA
CYP3-3 forward TTCCTGGTCCGGAACCAACTCC
CYP3-3 reverse GCAGACCTTAGCGCCGTGTCG
Open in a new tab

The PCR amplified products for the new CYP sequences were resolved on 1.5 % agarose gel, isolated and ligated in pGEM-T Easy Vector (Promega), and transformed into E. coli (TOP 10 Kit, Invitrogen). Plasmids were purified from cultures of positive clones (QiaPrep™, Qiagen) and sequenced (MWG Biotech). The 5′ and 3′ ends of those transcripts were obtained by rapid amplification of cDNA ends (RACE) with the BD Smart™ RACE cDNA Amplification Kit (Clontech) and gene-specific primers described in Table 2. Gel-purified 3′ and 5′ RACE products were cloned and sequenced as described above.

Table 2.

RACE specific-primers used for full-length cloning of CYP1-like-1, CYP1-like-2 and CYP3-like-3 sequences in Mytilus edulis.

Primer name Primer sequence 5′-3′
CYP1-1 forward 1 GCAGAGAGGCAATACGTGAAGCGTTG
CYP1-1 forward 2 AACCCACTTCAGCCCCCATGATGAC
CYP1-1 reverse 1 GTTCCGGCGAATTTCCGTATTGTTCC
CYP1-1 reverse 2 GGCATAACAAATCGCAACCATGGCA
CYP1-2 forward 1 TGGGTAAGTGGCCGACCATAGTGC
CYP1-2 forward 2 AAATCACCAGCGTGGAATGGTTGATG
CYP1-2 reverse 1 TTCCCCAAACACAAGGCCTTTCA
CYP1-2 reverse 2 TCATGGTGAACTTCTTTCTCGGCGTA
CYP3-3 forward 1 CCCAGGGAACACATTGGAAGTTTCT
CYP3-3 forward 2 GGAAAGAAAGCAGCCATTGGACAAC
CYP3-3 reverse 1 GTCTCCCCGCTGTGAGTGGATGTT
CYP3-3 reverse 2 CTTAGCGCCGTGTCGAAGAATTCAA
Open in a new tab

Phylogenetic analysis of Mytilus edulis CYPs

Nucleotide sequences for CYP1-like-1, CYP1-like-2, CYP3-like-1, CYP3-like-2 and CYP3-like-3 were translated and aligned with other CYP sequences obtained from various databases and publications (Mytilus californianus (Connor and Gracey, 2011), Lottia gigantea, JGI; Crassostrea gigas (Zhang et al., 2012)) using Muscle [v3.8.31; (Edgar, 2004)]. Phylogenetic trees were constructed by analyzing predicted amino acid sequences using maximum likelihood [RAxML 7.2.6; (Stamatakis, 2006a; Stamatakis et al., 2008)]. Regions of uncertain alignment were masked using a custom script. The WAG-CAT model of amino acid substitution with a gamma distribution of substitution rates (PROTMIXWAG) was used in all likelihood analyses, based on likelihood tests using RAxML (Stamatakis, 2006b).

Experimental treatment

A small hole, 1.5 mm diameter, was notched between the mussel valves, one day prior to injection of the chemicals (treated groups) or vehicle (vegetable oil, control group). Mussels collected in August 2008 were injected in the adductor muscle with 100 μl of the PCB mixture (Aroclor 1254; final dose 50 μg per g of mussel tissue), 6-formylindolo[3,2-b]carbazole (FICZ; 0.1 μg/g) or pure vegetable oil (Pure Vegetable Oil, Crisco®, J. M. Smucker Company, Orrville, OH, 44667, USA). Mussels collected in September 2008 were injected with 100 μl of BNF (β–naphthoflavone; 25 μg/g), PCB126 (3,3′,4,4′,5- pentachlorobiphenyl; 2 μg/g) or vegetable oil. Animals were allowed to rest on the bench for 30 min prior to being distributed in 10 L aerated aquaria (n=8 mussels per group). The doses employed in the injection of all four chemicals have been shown to strongly induce CYP1A gene expression or catalytic activity in fish (Chaty et al., 2004; Jonsson et al., 2009; Jonsson et al., 2007; Zanette et al., 2009). The dose calculation in this experiment was done assuming an average whole meat weight of 16 g per mussel, based on the biometry of five mussels from the same sets of samples.

At 24 h after injection, control mussels from the August 2008 experiment were sampled and digestive gland, gonad, labial palps, mantle margin, adductor muscle, gills and foot of individual mussels were dissected for use in the organ-specific gene expression analysis. The digestive glands of mussels treated with Aroclor 1254 and FICZ were dissected as well. In the September 2008 experiment, digestive glands and gills were dissected 24 h after injection with vegetable oil (control), PCB126 or BNF. The dissected organs were immediately placed in RNAlater (Ambion), held for 24 h at 4 °C, then stored at -20 °C.

Quantification of CYP1-like and CYP3-like transcripts

Total RNA was extracted and cDNA was synthesized as described before. Real-time PCR primers were designed to the new M. edulis CYP1-like and CYP3-like sequences, and to the 28S gene (based on alignments from AF120587, Z29550, and AF339512). Primers were obtained from MWG Biotech (Primer sequences are shown in Table 3). Real-time PCR was performed using iQ SYBR Green Supermix (according to the manufacturer’s instructions) and the iQ Real-Time PCR Detection System (Bio-Rad). For each sample, gene expression was analyzed in triplicate with the following protocol: 95°C for 3 min and 40 cycles of 95 °C for 15 s and 62 °C for 1 min. Melt curve analysis was performed on the PCR products at the end of each run to ensure that a single product was amplified. Quantitative assessment of mRNA or rRNA transcript molecule numbers was calculated using the standard curves generated from dilutions (102 – 109 molecules) of plasmid (pGEM-T Easy Vector) containing 150–1200 bp of a given target transcript. CYP transcript numbers were calculated by determining the mean 28S rRNA transcript molecule numbers from all samples for a given tissue and using that value to adjust all individual samples by using a normalization factor (28 S mol. number for sample)/(28S mol. number average in the organ) to calculate the relative transcript numbers per 1 μL of cDNA (equivalent to 100 ng of total RNA). All real-time quantitative-PCR results for CYP transcripts represent the relative number of CYP transcript molecules per 100 ng of total RNA.

Table 3.

Mytilus edulis primers employed in the CYP1-like-1, CYP1-like-2, CYP3-like-1, CYP3-like-2, CYP3-like-3 and 28S real time PCR reactions.

Primer name Primer sequence 5′-3′
CYP1-1 forward TGGTTGCGATTTGTTATGCCCTGGA
CYP1-1 reverse GGCGGAAAGCAATCCATCCGTGA
CYP1-2 forward TGGGTAAGTGGCCGACCATAGTGC
CYP1-2 reverse TTCCCCAAACACAAGGCCTTTCA
CYP3-1 forward TCAGTGCAATTGTCGTCGAAAGC
CYP3-1 reverse TCATGGCGAGCGTTTAACATCAG
CYP3-2 forward GGAGGATTGATGAGTTGGGAGGAC
CYP3-2 reverse AGGCGGCAAAAGAAAGAGTGGTC
CYP3-3 forward CCCAGGGAACACATTGGAAGTTTCT
CYP3-3 reverse GTCTCCCCGCTGTGAGTGGATGTT
28S forward CTGGCCTTCACTTTCATTGTGCC
28S reverse GACCCGTCTTGAAACACGGACCA
Open in a new tab

Statistics

Equality of variance was tested, accepting P>0.05 (Bartlett’s test) (Prism 4, GraphPad Software Inc., San Diego, CA). Data were logarithmically transformed to improve equality of variances. The differences among transcript levels for CYPs in different organs, or among control and treated groups, were evaluated using one-way analysis of variance (ANOVA, P<0.05), followed by Tukey’s test for multiple comparisons (Prism 4).

Results

Identification, cloning and analysis of M. edulis CYP sequences

Using non-specific primers designed from M. californianus CYP sequences, M. edulis nucleotide sequences of 1125, 831 and 662 bp were amplified from randomly primed cDNA by PCR, cloned, and sequenced. These were preliminarily designated as two new CYP1-like sequences and one new CYP3-like sequence, respectively. Sequencing of 5′ and 3′ ends yielded transcripts that were 1683, 1433 and 1614 base pairs in length and that coded for predicted proteins with 502, 461 and 468 amino acids, respectively (accession numbers JX885878, JX885879, JX885882) (Figure 1 and Figure 2). In addition, sequences identified as CYP3-like transcripts in M. californianus ESTs (Zanette et al., 2010), were searched against M. edulis sequences in GenBank. This search revealed two full-length M. edulis CYP3-like sequences (accession number AB479540 and AB479539) with predicted proteins of 503 and 515 amino acids, respectively, which were 51% identical to one another (Table 4). As noted above, those two CYP3-like sequences were recently described elsewhere (Cubero-Leon et al., 2012).

Figure 1.

Figure 1

Open in a new tab

Alignment of Mytilus edulis (me) and Mytilus californianus (mc) CYP1-like amino acid predicted sequences with the human (hs) and fish (Danio rerio, dr) CYP1A sequences. Dark and light grey boxes denote identical or similar amino acids in the alignment, respectively. Boxes indicate substrate recognition sites (SRS1-6) derived from CYP2s. Additional marks denote structural CYP signatures of conserved motifs (C: helix C, I: helix I, K: helix K, PERF: PERF and *: heme binding domain).

Figure 2.

Figure 2

Open in a new tab

Alignment of Mytilus edulis (me) CYP3-like amino acid predicted sequences with fish (Danio rerio, dr) and human (hs) CYP3 sequences. Dark and light grey boxes denote identical or similar amino acids in the alignment, respectively. Marks denote structural CYP signatures of conserved motifs (C: helix C, I: helix I, K: helix K, PERF: PERF and *: heme binding domain).

Table 4.

Amino acid identities among CYP1-like predicted sequences from Mytilus edulis (me) and Mytilus californianus (mc), with CYP1 sequences from Danio rerio (dr) and human (hs). Unmasked identities are on the upper diagonal, sequence-masked identities are on the lower diagonal.

me CYP1-1 mc CYP1-1 me CYP1-2 hs CYP1A1 hs CYP1A2 dr CYP1A
me CYP1-1 ID 89 46 33 34 31
mc CYP1-1 90 ID 44 34 33 31
me CYP1-2 49 47 ID 28 29 28
hs CYP1A1 37 38 32 ID 71 55
hs CYP1A2 38 37 33 75 ID 53
dr CYP1A 35 35 31 59 57 ID
Open in a new tab

Phylogenetic analysis of the five CYPs showed that the inferred amino acid sequences clustered with known vertebrate CYP1 and CYP3 sequences (Figure 3). Accordingly, we have designated these genes as CYP1-like-1 and CYP1-like-2, and CYP3-like-1, CYP3-like-2, and CYP3-like-3, based on their phylogenetic relationships to the CYP1s and CYP3s. Initial alignments of the predicted protein sequences suggested that CYP1-like-2 and CYP3-like-3 are missing 35–40 amino acids at the amino terminal end (Figure 1 and Figure 2). All sequences were masked to remove uncertainly aligned regions prior to phylogenetic analysis, including most of these missing sections. The CYP1-like sequences clustered closer to vertebrate CYP1 sequences than to other families in Clan 2 (i.e., CYP2s, CYP 17s and CYP21s). Figure 3 also shows that the M. edulis CYP1-like sequences clustered with the CYP1-like genes from the owl limpet, Lottia gigantea. The M. edulis CYP3-like sequences clustered in Clan 3 with CYPs from a variety of other molluscan species, in a sister clade to the vertebrate CYP3s.

Figure 3.

Figure 3

Open in a new tab

Phylogenetic trees of molluscan and vertebrate cytochrome P450 amino acid sequences. These maximum likelihood phylogenies include Mytilus full length sequences (“myted”; M. edulis), limpet (“lottia”; L. gigantea), sea urchin (“urchin”; S. purpuratus), zebrafish, and human sequences, along with selected other full-length bivalve sequences (C. gigas CYP356A1, M. mercenaria CYP30, H. cumingii CYP30). (A) CYP1-like and CYP17-like sequences (human CYP17A1 is the outgroup) (B) CYP3-like (CYP Clan 3) sequences.

The new M. edulis CYP1-like-1 and CYP1-like-2 predicted proteins share 33–34 % and 28–29 % identity with the human CYP1As, respectively, and 46 % to one another (Table 4). The new M. edulis CYP3-like-3 predicted protein exhibits 54 % and 43 % identity with the previously identified M. edulis CYP3-like-1 and CYP3-like-2 sequences, respectively (Table 5). CYP3-like-1, CYP3-like-2 and CYP3-like-3 predicted proteins also respectively share 38 %, 39 % and 36 % identity with human CYP3A4, respectively.

Table 5.

Amino acid identities among CYP3-like predicted sequences from Mytilus edulis (me) and CYP3 sequences from Danio rerio (dr) and human (hs). Unmasked identities are on the upper diagonal, sequence-masked identities are on the lower diagonal.

me_cyp3- 1 me cyp3- 2 me_cyp3- 3 dr_CYP3A65 dr CYP3C1 hs CYP3A4
me CYP3-1 ID 51 54 34 32 38
me CYP3-2 53 ID 43 33 33 39
me CYP3-3 60 48 ID 32 29 37
dr CYP3A65 38 38 35 ID 51 54
dr CYP3C1 35 37 33 56 ID 47
hs CYP3A4 42 44 41 59 51 ID
Open in a new tab

The inferred protein sequences of these new CYPs all have the classic conserved structural motifs, including the helix-C (WxxxR), helix-I (GxE/DTT), helix-K (ExxR), PERF (PxxFxPE/DRF) and the heme binding domain (xFxxGxRxCxG) (Figures 1 and 2). Sequences in putative substrate recognition sites (SRS) were examined (Gotoh, 1992; Kirischian et al., 2011). SRS 2, SRS 3 and SRS 6, showed less similarity with these SRS sequences of vertebrate CYPs in family 1 or 3 than did other SRSs. In contrast, SRS4 and SRS5 showed the highest similarity comparing the mussel CYP1-like or CYP3-like sequences, with the presumed homologous vertebrate CYP1 or CYP3 sequences (Figures 1 and 2, respectively).

CYP1-like and CYP3-like gene expression in Mytilus edulis organs

The two newly identified M. edulis CYP1-like genes showed similar patterns of organ-specific expression, with higher levels of transcripts observed in digestive gland, compared to other organs. Levels of CYP1-like-1 expression were intermediate in the gonad and labial palps, and very low in mantle margin, adductor muscle and foot. Levels of CYP1-like-2 expression were markedly higher in the digestive gland compared to the other six organs (Figure 4).

Figure 4.

Figure 4

Open in a new tab

Levels of CYP1-like and CYP3-like transcripts in different organs of Mytilus edulis. Molecule numbers for CYP sequences were calculated based on standard curves and normalized to 28S transcript levels within each specific organ. CYP transcript levels are presented as the relative transcript molecule numbers per 100 ng of total RNA. Values shown are mean values with error bars representing one standard deviation. Equal letters indicate absence of difference among groups (ANOVA – Tukey HSD, p<0.05, n=8).

Similar to the CYP1-like genes, high levels of expression of CYP3-like-1, CYP3-like-2 and CYP3-like-3 genes were observed in the digestive gland. However, the highest levels of expression were found in the labial palps and expression in the mantle margin was similar to the levels observed in the digestive gland. Lower CYP3-like expression levels were observed in gill, compared to other organs (Figure 4).

Response of M. edulis CYP1-like and CYP3-like genes to AHR agonists

The response of the mussel CYP genes to treatment with AHR agonists was evaluated with a PCB mixture (Aroclor 1254) containing dioxin-like AHR agonists, as well as non-dioxin-like congeners, and with three single compounds, a slowly metabolized dioxin-like PCB congener PCB126, a rapidly metabolized synthetic AHR ligand BNF, and the highly potent and rapidly metabolized AHR agonist FICZ. Short-term exposure experiments with bivalve species can be complicated by shell closure and the accompanying changes in metabolic function if the shell is closed for an extended period of time. We chose to inject the AHR agonists directly into the adductor muscle to insure a consistent initial exposure. Injection of mussels with Aroclor 1254 or FICZ did not cause any changes in the levels of mRNA expression of the CYP1-like or the CYP3-like genes in digestive glands of M. edulis after 24 h, compared to the control group (Figure 5). However, the injection with PCB 126 resulted in a modest increase in the levels of digestive gland CYP3-like-2 transcript expression, but there was not a statistically significant difference in transcript levels of the CYP1-like genes or the other two CYP3-like genes in either digestive gland or gill tissues. Treatment with BNF did not cause any changes in digestive gland CYP1-like and CYP3-like expression (Figure 6). However, BNF did elicit an increase in the expression of CYP3-like-1 and CYP3-like-2 genes in gill, compared to the controls (Figure 7).

Figure 5.

Figure 5

Open in a new tab

Levels of CYP1-like and CYP3-like transcripts in Mytilus edulis injected with vegetable oil (control) or with the vertebrate CYP inducers Aroclor 1254 (mixture of PCB isomers) and 6-formylindolo[3,2-b] carbazole (FICZ). Molecule numbers for CYP sequences were calculated based on standard curves and normalized to 28S transcript levels within each specific treatment. CYP transcript levels are presented as the relative transcript molecule numbers per 100 ng of total RNA. The graph is plotted as Box and Whiskers (min., Q1, median, Q3, max.). Equal letters indicates absence of difference among groups (ANOVA –Tukey HSD, p<0.05) (n=8).

Figure 6.

Figure 6

Open in a new tab

Levels of digestive gland CYP1-like and CYP3-like transcripts in Mytilus edulis injected with vegetable oil (control) or with the mammalian AHR agonists β-naphthoflavone (BNF) and 3,3′,4,4′,5-pentachlorobiphenyl (PCB 126). Molecule numbers for CYP sequences were calculated based on standard curves and normalized to 28S transcript levels within each specific treatment. CYP transcript levels are presented as the relative transcript molecule numbers per 100 ng of total RNA. The graph is plotted as Box and Whiskers (min., Q1, median, Q3, max.). Equal letters indicates absence of difference among groups (ANOVA –Tukey HSD, p<0.05) (n=8).

Figure 7.

Figure 7

Open in a new tab

Levels of gill CYP1-like and CYP3-like transcripts in Mytilus edulis injected with vegetable oil (control) or with the mammalian AHR agonists β-naphthoflavone (BNF) and 3,3′,4,4′,5-pentachlorobiphenyl (PCB 126). Molecule numbers for CYP sequences were calculated based on standard curves and normalized to 28S transcript levels within each specific treatment. CYP transcript levels are presented as the relative transcript molecule numbers per 100 ng of total RNA. The graph is plotted as Box and Whiskers (min., Q1, median, Q3, max.). Equal letters indicates absence of difference among groups (ANOVA –Tukey HSD, p<0.05) (n=8).

Discussion

A preliminary study allowed us to identify many CYP sequences in the bivalve mollusk M. californianus (Zanette et al., 2010). To address the CYP complement and responses of selected CYPs in a definitive way we identified and cloned transcripts from M. edulis that appear to be homologues of two gene families important in xenobiotic metabolism in vertebrates, CYP families 1 and 3. Previous studies of CYP responses in bivalve mollusks have been hindered because of uncertainty regarding the identity of genes present, and a lack of specific substrate or antibody probes for molluscan CYPs, often leading to mistaken conclusions. For example, putative CYP1A cross-reactive proteins detected by immunoblotting in mussels and clams were later identified as actin and tropomyosin, respectively (Grosvik et al., 2006). This is the first study to characterize and evaluate mRNA expression profiles of multiple CYP1-like genes, together with multiple CYP3-like genes in a bivalve mollusk. The results suggest distinct organ-specific patterns for the different genes. There was no hint of induction of CYP1-like mRNA in response to vertebrate AHR agonists, but two of the CYP3-like genes showed responses.

Phylogenetic analysis of Mytilus edulis CYP1-like and CYP3-like sequences

Molecular phylogenetic analyses of the five CYPs we analyzed from M. edulis consistently showed that these mussel sequences clustered with known CYP1s and CYP3s. The CYP1-like inferred proteins, shared 28% – 31% identity with the zebrafish CYP1A, while the CYP3-like sequences shared a higher % identity with vertebrate CYP3s, ranging from 36% to 39% identity to human CYP3A4. The usual system for CYP classification establishes cut-off identities of 40% and 55% between CYP protein sequences to be considered as belonging in the same family and subfamily, respectively (Nelson et al., 1996). However, with greater evolutionary distance, the percent identity for inclusion in a given CYP family can be lower than 40% (Nelson et al., 2004). Thus, both the phylogenetic analyses and the shared sequence identities suggest that these mussel sequences likely belong in CYP families 1 and 3, although here we employ the terms CYP1-like and CYP3-like for the M. edulis CYP sequences, following other examples for provisional nomenclature for invertebrate CYP genes (Goldstone et al., 2007; Verslycke et al., 2006). A definitive family assignment for CYPs in the Lophotrochozoa, which includes mollusks, may depend on other features. Shared synteny is one such feature, but the rate of synteny loss in different animal groups is variable, e.g., relatively slow in anemone, amphioxus and urchin, and very fast in some insects, which can render gene order largely uninformative. Synteny analysis for P450s in the genome of the mollusk Lottia gigantea is in progress (Nelson, 2011; Nelson et al., 2012).

The existence of CYP1 or even CYP1-like genes in protostomes has not been established in the literature, and has been questioned by some authors (Goldstone, 2008; Goldstone et al., 2007; Goldstone et al., 2006; Rewitz et al., 2006). In addition to the genes we describe, four CYP1-like genes are present also in the genome of the oyster Crassostrea gigas, along with at least ten other slightly more distantly related CYPs (Zhang et al., 2012). As far as we are aware, ours is the first study to examine the expression of CYP1-like sequences in a bivalve mollusk. The importance of the CYP1-like proteins to physiology or xenobiotic metabolism in organisms where they do occur (i.e., in the basal lineage of deuterostomes, in echinoderms and tunicates) is not clear (Goldstone et al., 2007). This certainly is true as well of the bivalve CYP1-like genes.

The conserved nature of CYP Clan 3 genes in different animal groups has previously been observed. Comparison of CYP3-like genes from tunicate (Verslycke et al., 2006) and the CYP30 gene from the bivalve mollusk Mercenaria mercenaria (Brown et al., 1998) with the vertebrate CYP3s indicate strongly that CYP Clan 3, and likely CYP family 3, is represented in mollusks. This would be consistent with a suggestion that a common CYP family 3 ancestral gene was present 800 to 1000 million years ago, before the split to deuterostomes and protostomes (Goldstone, 2008; Verslycke et al., 2006). We find it intriguing that the mussel CYP3-like sequences share a higher % identity with vertebrate CYP3s, than do the tunicate “CYP3s”, or the clam CYP30. The identity between the three M. edulis CYP3-like sequences, and the M. mercenaria CYP30 was not striking (34%-37%). Differences in the Clan 3 genes in different bivalve species will be explored in further studies.

Organ-distribution of CYP1-like and CYP3-like transcript levels in Mytilus edulis

Much higher levels of CYP1-like transcripts were observed in the M. edulis digestive gland, than in gonad/mantle, labial palp, mantle margin, adductor muscle, gill or foot. The digestive gland in bivalve mollusks is thought to have functions equivalent to the liver in vertebrates, with a role in elimination of xenobiotics and some endogenous substrates (Marigomez et al., 1999). The CYP1 family members in mammals are involved in carcinogenesis, oxidative stress, hepatotoxicity, diseases related to the metabolism of a variety of xenobiotics and endogenous substrates (Nebert and Russell, 2002). Assuming that organ-specific distribution in the expression of a gene could relate to function, some similarity in the function for the Mytilus CYP1-like and the vertebrate CYP1A could be predicted.

M. edulis CYP3-like genes also were similar in their patterns of organ-specific expression, and quite different from the CYP1-like genes. In mammals and fish, CYP3 proteins are very abundant in the liver and especially the gastrointestinal tract. In humans it is estimated that CYP3s metabolize between 40–60 % of the pharmacological compounds (Guengerich, 2008), as well as endogenous substrates like sterols, arachidonic acid, bile salts, and vitamin D (Nebert and Dalton, 2006). In the present study, the organ-specific transcript levels of the three M. edulis CYP3-like genes showed the highest levels in the labial palp, digestive gland, and mantle margin; intermediate levels in gonad, muscle and foot; and the lowest levels in gill. Little is known about the importance of the labial palps for xenobiotic metabolism in bivalves. However, their role in pre-ingestive food sorting (Milke and Ward, 2003) could result in high levels of exposure requiring the metabolism of xenobiotics or endogenous substrates.

Many of the tissues had relatively little variation in transcript expression between individual mussels, though variation was high in digestive gland and labial palp, which may be related to the functions of the organs. Variation in gene expression is commonly observed between individuals when sampling from wild populations of bivalves, due to factors including genetic diversity, seasonal variation and sex differences in physiology (Banni et al., 2011; Ciocan et al., 2011). We chose to collect mussels later in the summer after the spawning season, and did not look at sex-specific differences. Nevertheless, some variation in CYP gene expression could result from having both male and female mussels in the same treatment groups. Investigation of sex differences in CYP expression as linked to seasonal variation and gametogenesis are warranted.

Response of M. edulis CYP1-like and CYP3-like to vertebrate AHR agonists

The M. edulis CYP1-like genes did not show any response to three potent vertebrate AHR agonists or the PCB mixture Aroclor1254 (which can induce CYP1s, CYP2s and CYP3s in mammals). In fish, CYP1A induction has been widely employed as a biomarker of exposure to AHR agonists in the aquatic environment [e.g (Bucheli and Fent, 1995; Payne, 1976; Stegeman et al., 1986)]. The prominent use of bivalve mollusks in pollution monitoring programs has prompted numerous efforts to find some CYP gene, protein or catalytic activity that would provide a similar marker of exposure in these organisms (Cravo et al., 2009; Livingstone et al., 1989; Monari et al., 2007; Monari et al., 2009; Peters et al., 1998; Porte et al., 2001; Shaw et al., 2002; Snyder et al., 2001; Sole and Livingstone, 2005; Wootton et al., 1995). There has been little success, due to lack of knowledge of specific CYP sequences, probes, or substrates [e.g. (Grosvik et al., 2006; Livingstone and Farrar, 1984; Sole and Livingstone, 2005; Stegeman and Livingstone, 1998)]. AHR occurs in invertebrates (including bivalves) (Butler et al., 2004; Hahn, 2002; Liu et al., 2010; Qin and Powell-Coffman, 2004) but whether there is a link to any CYP regulation is unknown. While recent studies have shown increases [e.g.(Bebianno et al., 2007; de Toledo-Silva et al., 2008)] as well as decreases (Cubero-Leon et al., 2012) in CYP expression, such changes still lack a mechanistic understanding that would support inference and prediction.

While it is possible that exposure longer than the 24 hr period we used could result in some response, our data are sufficient to indicate that there is not a direct transcriptional response at a time that in vertebrates is sufficient for strong induction of transcript levels via AHR activation. Thus, the lack of response seen here indicates that the CYP1-like genes may not satisfy the search for molluscan CYPs inducible by AHR agonists. An AHR homolog has been identified and cloned from M. edulis (M. E. Hahn, personal communication), and AHR has been identified in other bivalves (Butler et al., 2001; Liu et al., 2010). A recent report (Denison et al., 2011) indicates that halogenated and non-halogenated compounds can interact differently with vertebrate AHR possibly affecting its activation. However, the M. arenaria AHR was shown not to bind the halogenated AHR agonist TCDD or the non-halogenated agonist BNF (Butler et al., 2001). BNF typically is substantially less potent than TCDD. However, the M. edulis CYP1-like genes also did not respond to FICZ, the highly potent endogenous agonist for vertebrate AHR. This argues that the AHR does not regulate molluscan “CYP1”s. Thus, the M. edulis CYP1-like genes identified here may not be suitable biomarkers of exposure to AHR agonists, and may not be involved in (transcriptionally dependent) changes in monooxygenase activity occasionally seen in bivalves exposed to AHR agonists. While lack of induction could reflect lack of AHR activation by typical agonists, it is also possible that molluscan AHR simply is not involved in the regulation of CYP1-like genes. Thus, promoter regions for the M. edulis CYP1-like genes might not possess functional AHR response elements; such possibility can be examined once the recognition sites for mollusk AHR DNA binding have been determined.

There is a growing body of data showing that invertebrate AHRs do not to bind known ligands for vertebrate AHRs, indicating important functional differences between invertebrate and vertebrate AHRs. There still could be some involvement of “vertebrate” ligands in invertebrate CYP regulation, perhaps through altering interactions with other ligands. This was suggested for benzo[a]pyrene modifying the effect of xanthotoxin in activation of the promoter of black swallowtail butterfly CYP6B1 (Brown et al., 2005). CYP6B1 is in CYP clan 3, where the mussel CYP3-like genes cluster. Expression of CYP3-like-1 and CYP3-like-2 in gill was induced slightly by BNF. It is tempting to invoke the AHR, although mammalian CYP3As can be induced by PAH also via the nuclear transcription factor NR1I2 (the pregnane X receptor. PXR; also known as the steroid xenobiotic receptor, SXR) (Kumagai et al., 2012). The PXR-related constitutive androstane receptor (NR1I3, CAR) evolved in the mammalian line and does not occur in invertebrates (Krasowski et al., 2005). Studies do suggest that a nuclear receptor NR1I in early deuterostomes (tunicates) is a co-orthologue of vertebrate vitamin D receptor and PXR, and that despite a more limited ligand specificity compared to vertebrate PXR (Fidler et al., 2012; Reschly et al., 2007), it appears to bind FICZ (Ekins et al., 2008). Homologues of VDR or PXR have not been found in mollusks, although the PXR/VDR dimer partner RXR (retinoid X receptor) does occur (Horiguchi et al., 2007; Nishikawa et al., 2004; Sternberg et al., 2008). RXR’s role in response to various xenobiotic chemicals in mollusks should be assessed.

In conclusion, we identified new CYP1-like and CYP3-like genes in M. edulis and described marked differences in their expression, including a lack of induction of the CYP1-like genes and slight induction of two CYP3-like genes by AHR agonists. Uncovering new CYP sequences and evaluating expression and responses of the full CYP complement to different contaminant classes in the mussel M. edulis, in relation to other gene responses (for example by RNAseq), could identify CYP genes that are regulated via contaminant exposure, and those possibly involved in endogenous substrate metabolism. Which receptors may be involved in regulation of CYPs in bivalves is unclear; the possible involvement of novel receptors should not be ignored. Establishing receptor involvement could uncover new biomarkers of aquatic contamination, and provide a better understanding of physiologic mechanisms in those organisms that possess remarkable environmental, economic, and social importance. At present however, occasional CYP protein responses cannot be explained by a mechanism, and thus are not likely to be predictable. Finally, we emphasize that finding a molluscan CYP similar to a vertebrate CYP does not mean finding similar functions; that hypothesis must be addressed experimentally, by heterologous expression of the mussel CYPs and analysis of the catalytic functions of the individual CYPs directly.

Acknowledgments

This study was supported by a NOAA Sea Grant (NA10OAR4170086) to JJS and JVG and by a gift from Joyce and George Moss, through the Ocean Life Institute at WHOI. Studies also were supported in part by an NIH grant to JJS (5R01-ES015912). JZ was a Guest Student at the Woods Hole Oceanographic Institution and was supported by a CAPES Ph.D. Fellowship and CNPq Ph.D. Sandwich Fellowship, Brazil. Study sponsors had no involvement in the studies reported here or in the decision to submit this paper for publication.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Baldwin WS, Marko PB, Nelson DR. The cytochrome P450 (CYP) gene superfamily in Daphnia pulex. BMC Genomics. 2009;10:169. doi: 10.1186/1471-2164-10-169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Banni M, Negri A, Mignone F, Boussetta H, Viarengo A, Dondero F. Gene expression rhythms in the mussel Mytilus galloprovincialis (Lam.) across an annual cycle. PLoS One. 2011;6:e18904. doi: 10.1371/journal.pone.0018904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bebianno MJ, Lopes B, Guerra L, Hoarau P, Ferreira AM. Glutathione S-tranferases and cytochrome P450 activities in Mytilus galloprovincialis from the South coast of Portugal: effect of abiotic factors. Environ Int. 2007;33:550–558. doi: 10.1016/j.envint.2006.11.002. [DOI] [PubMed] [Google Scholar]
  4. Brown DJ, Clark GC, Van Beneden RJ. A new cytochrome P450 (CYP30) family identified in the clam, Mercenaria mercenaria. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;121:351–360. doi: 10.1016/s0742-8413(98)10056-7. [DOI] [PubMed] [Google Scholar]
  5. Brown RP, McDonnell CM, Berenbaum MR, Schuler MA. Regulation of an insect cytochrome P450 monooxygenase gene (CYP6B1) by aryl hydrocarbon and xanthotoxin response cascades. Gene. 2005;358:39–52. doi: 10.1016/j.gene.2005.05.026. [DOI] [PubMed] [Google Scholar]
  6. Bucheli TD, Fent K. Induction of Cytochrome-P450 as a Biomarker for Environmental Contamination in Aquatic Ecosystems. Critical Reviews in Environmental Science and Technology. 1995;25:201–268. [Google Scholar]
  7. Butler RA, Kelley ML, Powell WH, Hahn ME, Van Beneden RJ. An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and beta-naphthoflavone binding. Gene. 2001;278:223–234. doi: 10.1016/s0378-1119(01)00724-7. [DOI] [PubMed] [Google Scholar]
  8. Butler RA, Kelley ML, Olberding KE, Gardner GR, Van Beneden RJ. Aryl hydrocarbon receptor (AhR)-independent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on softshell clam (Mya arenaria) reproductive tissue. Comp Biochem Physiol C Toxicol Pharmacol. 2004;138:375–381. doi: 10.1016/j.cca.2004.05.001. [DOI] [PubMed] [Google Scholar]
  9. Canova S, Degan P, Peters LD, Livingstone DR, Voltan R, Venier P. Tissue dose, DNA adducts, oxidative DNA damage and CYP1A-immunopositive proteins in mussels exposed to waterborne benzo[a]pyrene. Mutat Res. 1998;399:17–30. doi: 10.1016/s0027-5107(97)00263-7. [DOI] [PubMed] [Google Scholar]
  10. Chaty S, Rodius F, Vasseur P. A comparative study of the expression of CYP1A and CYP4 genes in aquatic invertebrate (freshwater mussel, Unio tumidus) and vertebrate (rainbow trout, Oncorhynchus mykiss) Aquat Toxicol. 2004;69:81–94. doi: 10.1016/j.aquatox.2004.04.011. [DOI] [PubMed] [Google Scholar]
  11. Ciocan CM, Cubero-Leon E, Minier C, Rotchell JM. Identification of reproduction-specific genes associated with maturation and estrogen exposure in a marine bivalve Mytilus edulis. PLoS One. 2011;6:e22326. doi: 10.1371/journal.pone.0022326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Connor KM, Gracey AY. Circadian cycles are the dominant transcriptional rhythm in the intertidal mussel Mytilus californianus. Proc Natl Acad Sci U S A. 2011;108:16110–16115. doi: 10.1073/pnas.1111076108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Craft JA, Gilbert JA, Temperton B, Dempsey KE, Ashelford K, Tiwari B, Hutchinson TH, Chipman JK. Pyrosequencing of Mytilus galloprovincialis cDNAs: tissue-specific expression patterns. PLoS One. 2010;5:e8875. doi: 10.1371/journal.pone.0008875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cravo A, Lopes B, Serafim A, Company R, Barreira L, Gomes T, Bebianno MJ. A multibiomarker approach in Mytilus galloprovincialis to assess environmental quality. J Environ Monit. 2009;11:1673–1686. doi: 10.1039/b909846a. [DOI] [PubMed] [Google Scholar]
  15. Cubero-Leon E, Puinean AM, Labadie P, Ciocan C, Itoh N, Kishida M, Osada M, Minier C, Hill EM, Rotchell JM. Two CYP3A-like genes in the marine mussel Mytilus edulis: mRNA expression modulation following short-term exposure to endocrine disruptors. Mar Environ Res. 2012;74:32–39. doi: 10.1016/j.marenvres.2011.11.012. [DOI] [PubMed] [Google Scholar]
  16. de Toledo-Silva G, Siebert MN, Medeiros ID, Sincero TC, Moraes MO, Goldstone JV, Bainy AC. Cloning a new cytochrome P450 isoform (CYP356A1) from oyster Crassostrea gigas. Mar Environ Res. 2008;66:15–18. doi: 10.1016/j.marenvres.2008.02.010. [DOI] [PubMed] [Google Scholar]
  17. Denison MS, Pandini A, Nagy SR, Baldwin EP, Bonati L. Ligand binding and activation of the Ah receptor. Chem Biol Interact. 2002;141:3–24. doi: 10.1016/s0009-2797(02)00063-7. [DOI] [PubMed] [Google Scholar]
  18. Denison MS, Soshilov AA, He G, DeGroot DE, Zhao B. Exactly the same but different: promiscuity and diversity in the molecular mechanisms of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci. 2011;124:1–22. doi: 10.1093/toxsci/kfr218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dondero F, Piacentini L, Marsano F, Rebelo M, Vergani L, Venier P, Viarengo A. Gene transcription profiling in pollutant exposed mussels (Mytilus spp.) using a new low-density oligonucleotide microarray. Gene. 2006;376:24–36. doi: 10.1016/j.gene.2006.02.015. [DOI] [PubMed] [Google Scholar]
  20. Edgar RC. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics. 2004;5:113. doi: 10.1186/1471-2105-5-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ekins S, Reschly EJ, Hagey LR, Krasowski MD. Evolution of pharmacologic specificity in the pregnane X receptor. BMC Evol Biol. 2008;8:103. doi: 10.1186/1471-2148-8-103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fidler AE, Holland PT, Reschly EJ, Ekins S, Krasowski MD. Activation of a tunicate (Ciona intestinalis) xenobiotic receptor orthologue by both natural toxins and synthetic toxicants. Toxicon. 2012;59:365–372. doi: 10.1016/j.toxicon.2011.12.008. [DOI] [PubMed] [Google Scholar]
  23. Fiedler TJ, Hudder A, McKay SJ, Shivkumar S, Capo TR, Schmale MC, Walsh PJ. The transcriptome of the early life history stages of the California Sea Hare Aplysia californica. Comp Biochem Physiol Part D Genomics Proteomics. 2010;5:165–170. doi: 10.1016/j.cbd.2010.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Goldstone JV, Hamdoun A, Cole BJ, Howard-Ashby M, Nebert DW, Scally M, Dean M, Epel D, Hahn ME, Stegeman JJ. The chemical defensome: environmental sensing and response genes in the Strongylocentrotus purpuratus genome. Dev Biol. 2006;300:366–384. doi: 10.1016/j.ydbio.2006.08.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Goldstone JV, Goldstone HM, Morrison AM, Tarrant A, Kern SE, Woodin BR, Stegeman JJ. Cytochrome P450 1 genes in early deuterostomes (tunicates and sea urchins) and vertebrates (chicken and frog): origin and diversification of the CYP1 gene family. Mol Biol Evol. 2007;24:2619–2631. doi: 10.1093/molbev/msm200. [DOI] [PubMed] [Google Scholar]
  26. Goldstone JV. Environmental sensing and response genes in cnidaria: the chemical defensome in the sea anemone Nematostella vectensis. Cell Biol Toxicol. 2008;24:483–502. doi: 10.1007/s10565-008-9107-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Gotoh O. Substrate recognition sites in cytochrome P450 family 2 (CYP2) proteins inferred from comparative analyses of amino acid and coding nucleotide sequences. J Biol Chem. 1992;267:83–90. [PubMed] [Google Scholar]
  28. Gotoh O. Divergent structures of Caenorhabditis elegans cytochrome P450 genes suggest the frequent loss and gain of introns during the evolution of nematodes. Mol Biol Evol. 1998;15:1447–1459. doi: 10.1093/oxfordjournals.molbev.a025872. [DOI] [PubMed] [Google Scholar]
  29. Gotoh O. Evolution of cytochrome p450 genes from the viewpoint of genome informatics. Biol Pharm Bull. 2012;35:812–817. doi: 10.1248/bpb.35.812. [DOI] [PubMed] [Google Scholar]
  30. Grosvik BE, Jonsson H, Rodriguez-Ortega MJ, Roepstorff P, Goksoyr A. CYP1A-immunopositive proteins in bivalves identified as cytoskeletal and major vault proteins. Aquat Toxicol. 2006;79:334–340. doi: 10.1016/j.aquatox.2006.07.003. [DOI] [PubMed] [Google Scholar]
  31. Guengerich FP. Cytochrome p450 and chemical toxicology. Chem Res Toxicol. 2008;21:70–83. doi: 10.1021/tx700079z. [DOI] [PubMed] [Google Scholar]
  32. Hahn ME. Aryl hydrocarbon receptors: diversity and evolution. Chem Biol Interact. 2002;141:131–160. doi: 10.1016/s0009-2797(02)00070-4. [DOI] [PubMed] [Google Scholar]
  33. Horiguchi T, Nishikawa T, Ohta Y, Shiraishi H, Morita M. Retinoid X receptor gene expression and protein content in tissues of the rock shell Thais clavigera. Aquat Toxicol. 2007;84:379–388. doi: 10.1016/j.aquatox.2007.06.019. [DOI] [PubMed] [Google Scholar]
  34. Huggett RJ, Bender ME, Slone HD. Utilizing Metal Concentration Relationships in Eastern Oyster (Crassostrea virginica) to Detect Heavy-Metal Pollution. Water Research. 1973;7:451–460. [Google Scholar]
  35. Jonsson H, Schiedek D, Goksoyr A, Grosvik BE. Expression of cytoskeletal proteins, cross-reacting with anti-CYP1A, in Mytilus sp. exposed to organic contaminants. Aquat Toxicol. 2006a;78(Suppl 1):S42–48. doi: 10.1016/j.aquatox.2006.02.014. [DOI] [PubMed] [Google Scholar]
  36. Jonsson H, Schiedek D, Grosvik BE, Goksoyr A. Protein responses in blue mussels (Mytilus edulis) exposed to organic pollutants: a combined CYP-antibody/proteomic approach. Aquat Toxicol. 2006b;78(Suppl 1):S49–56. doi: 10.1016/j.aquatox.2006.02.024. [DOI] [PubMed] [Google Scholar]
  37. Jonsson ME, Jenny MJ, Woodin BR, Hahn ME, Stegeman JJ. Role of AHR2 in the expression of novel cytochrome P450 1 family genes, cell cycle genes, and morphological defects in developing zebra fish exposed to 3,3′,4,4′,5-pentachlorobiphenyl or 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Sci. 2007;100:180–193. doi: 10.1093/toxsci/kfm207. [DOI] [PubMed] [Google Scholar]
  38. Jonsson ME, Brunstrom B, Brandt I. The zebrafish gill model: induction of CYP1A, EROD and PAH adduct formation. Aquat Toxicol. 2009;91:62–70. doi: 10.1016/j.aquatox.2008.10.010. [DOI] [PubMed] [Google Scholar]
  39. Kirischian N, McArthur AG, Jesuthasan C, Krattenmacher B, Wilson JY. Phylogenetic and functional analysis of the vertebrate cytochrome p450 2 family. J Mol Evol. 2011;72:56–71. doi: 10.1007/s00239-010-9402-7. [DOI] [PubMed] [Google Scholar]
  40. Krasowski MD, Yasuda K, Hagey LR, Schuetz EG. Evolutionary selection across the nuclear hormone receptor superfamily with a focus on the NR1I subfamily (vitamin D, pregnane X, and constitutive androstane receptors) Nucl Recept. 2005;3:2. doi: 10.1186/1478-1336-3-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Kumagai T, Suzuki H, Sasaki T, Sakaguchi S, Miyairi S, Yamazoe Y, Nagata K. Polycyclic aromatic hydrocarbons activate CYP3A4 gene transcription through human pregnane X receptor. Drug Metab Pharmacokinet. 2012;27:200–206. doi: 10.2133/dmpk.dmpk-11-rg-094. [DOI] [PubMed] [Google Scholar]
  42. Liu N, Pan L, Miao J, Xu C, Zhang L. Molecular cloning and sequence analysis and the response of a aryl hydrocarbon receptor homologue gene in the clam Ruditapes philippinarum exposed to benzo(a)pyrene. Comp Biochem Physiol C Toxicol Pharmacol. 2010;152:279–287. doi: 10.1016/j.cbpc.2010.05.004. [DOI] [PubMed] [Google Scholar]
  43. Livingstone DR, Farrar SV. Tissue and subcellular distribution of enzyme activities of mixed-function oxygenase and benzo(a)pyrene metabolism in the common mussel Mytilus edulis L. Science of the Total Environment. 1984;39:209–235. [Google Scholar]
  44. Livingstone DR, Kirchin MA, Wiseman A. Cytochrome P-450 and oxidative metabolism in molluscs. Xenobiotica. 1989;19:1041–1062. doi: 10.3109/00498258909043161. [DOI] [PubMed] [Google Scholar]
  45. Livingstone DR. The fate of organic xenobiotics in aquatic ecosystems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp Biochem Physiol A Mol Integr Physiol. 1998;120:43–49. doi: 10.1016/s1095-6433(98)10008-9. [DOI] [PubMed] [Google Scholar]
  46. Lockwood BL, Somero GN. Transcriptomic responses to salinity stress in invasive and native blue mussels (genus Mytilus) Mol Ecol. 2011;20:517–529. doi: 10.1111/j.1365-294X.2010.04973.x. [DOI] [PubMed] [Google Scholar]
  47. Marigomez I, Lekube X, Cancio I. Immunochemical localisation of proliferating cells in mussel digestive gland tissue. Histochem J. 1999;31:781–788. doi: 10.1023/a:1003950003381. [DOI] [PubMed] [Google Scholar]
  48. Milan M, Coppe A, Reinhardt R, Cancela LM, Leite RB, Saavedra C, Ciofi C, Chelazzi G, Patarnello T, Bortoluzzi S, Bargelloni L. Transcriptome sequencing and microarray development for the Manila clam, Ruditapes philippinarum: genomic tools for environmental monitoring. BMC Genomics. 2011;12:234. doi: 10.1186/1471-2164-12-234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Milke LM, Ward JE. Influence of diet on pre-ingestive particle processing in bivalves II. Residence time in the pallial cavity and handling time on the labial palps. Journal of Experimental Marine Biology and Ecology. 2003;293:151–172. [Google Scholar]
  50. Monari M, Cattani O, Serrazanetti GP, Selli A, Pagliuca G, Zironi E, O’Hara SC, Livingstone DR. Effect of exposure to benzo[a]pyrene on SODs, CYP1A1/1A2- and CYP2E1 immunopositive proteins in the blood clam Scapharca inaequivalvis. Mar Environ Res. 2007;63:200–218. doi: 10.1016/j.marenvres.2006.08.004. [DOI] [PubMed] [Google Scholar]
  51. Monari M, Foschi J, Matozzo V, Marin MG, Fabbri M, Rosmini R, Serrazanetti GP. Investigation of EROD, CYP1A immunopositive proteins and SOD in haemocytes of Chamelea gallina and their role in response to B[a]P. Comp Biochem Physiol C Toxicol Pharmacol. 2009;149:382–392. doi: 10.1016/j.cbpc.2008.09.008. [DOI] [PubMed] [Google Scholar]
  52. Nebert DW, Russell DW. Clinical importance of the cytochromes P450. The Lancet. 2002;360:1155–1162. doi: 10.1016/S0140-6736(02)11203-7. [DOI] [PubMed] [Google Scholar]
  53. Nebert DW, Dalton TP. The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat Rev Cancer. 2006;6:947–960. doi: 10.1038/nrc2015. [DOI] [PubMed] [Google Scholar]
  54. Nelson DR, et al. P450 superfamily: update on new sequences, gene mapping, accession numbers and nomenclature. Pharmacogenetics. 1996;6:1–42. doi: 10.1097/00008571-199602000-00002. [DOI] [PubMed] [Google Scholar]
  55. Nelson DR, Zeldin DC, Hoffman SM, Maltais LJ, Wain HM, Nebert DW. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics. 2004;14:1–18. doi: 10.1097/00008571-200401000-00001. [DOI] [PubMed] [Google Scholar]
  56. Nelson DR. Progress in tracing the evolutionary paths of cytochrome P450. Biochim Biophys Acta. 2011;1814:14–18. doi: 10.1016/j.bbapap.2010.08.008. [DOI] [PubMed] [Google Scholar]
  57. Nelson DR, Goldstone JV, Stegeman JJ. The cytochrome P450 genesis locus: The origin and evolution of animal cytochrome P450s. Proc Royal Soc B - Biology. 2012 doi: 10.1098/rstb.2012.0474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Nishikawa J, Mamiya S, Kanayama T, Nishikawa T, Shiraishi F, Horiguchi T. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ Sci Technol. 2004;38:6271–6276. doi: 10.1021/es049593u. [DOI] [PubMed] [Google Scholar]
  59. Payne JF. Field Evaluation of Benzopyrene Hydroxylase Induction as a Monitor for Marine Petroleum Pollution. Science. 1976;191:945–946. doi: 10.1126/science.1251203. [DOI] [PubMed] [Google Scholar]
  60. Peters LD, Nasci C, Livingstone DR. Immunochemical investigations of cytochrome P450 forms/epitopes (CYP1A, 2B, 2E, 3A and 4A) in digestive gland of Mytilus spp. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;121:361–369. doi: 10.1016/s0742-8413(98)10057-9. [DOI] [PubMed] [Google Scholar]
  61. Porte C, Biosca X, Sole M, Albaiges J. The integrated use of chemical analysis, cytochrome P450 and stress proteins in mussels to assess pollution along the Galician coast (NW Spain) Environ Pollut. 2001;112:261–268. doi: 10.1016/s0269-7491(00)00104-4. [DOI] [PubMed] [Google Scholar]
  62. Qin H, Powell-Coffman JA. The Caenorhabditis elegans aryl hydrocarbon receptor, AHR-1, regulates neuronal development. Dev Biol. 2004;270:64–75. doi: 10.1016/j.ydbio.2004.02.004. [DOI] [PubMed] [Google Scholar]
  63. Reschly EJ, Bainy AC, Mattos JJ, Hagey LR, Bahary N, Mada SR, Ou J, Venkataramanan R, Krasowski MD. Functional evolution of the vitamin D and pregnane X receptors. BMC Evol Biol. 2007;7:222. doi: 10.1186/1471-2148-7-222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Rewitz KF, Styrishave B, Lobner-Olsen A, Andersen O. Marine invertebrate cytochrome P450: emerging insights from vertebrate and insects analogies. Comp Biochem Physiol C Toxicol Pharmacol. 2006;143:363–381. doi: 10.1016/j.cbpc.2006.04.001. [DOI] [PubMed] [Google Scholar]
  65. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol. 2000;132:365–386. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
  66. Shaw JP, Large AT, Livingstone DR, Doyotte A, Renger J, Chipman JK, Peters LD. Elevation of cytochrome P450-immunopositive protein and DNA damage in mussels (Mytilus edulis) transplanted to a contaminated site. Mar Environ Res. 2002;54:505–509. doi: 10.1016/s0141-1136(02)00191-5. [DOI] [PubMed] [Google Scholar]
  67. Snyder MJ, Girvetz E, Mulder EP. Induction of marine mollusc stress proteins by chemical or physical stress. Arch Environ Contam Toxicol. 2001;41:22–29. doi: 10.1007/s002440010217. [DOI] [PubMed] [Google Scholar]
  68. Sole M, Livingstone DR. Components of the cytochrome P450-dependent monooxygenase system and ‘NADPH-independent benzo[a]pyrene hydroxylase’ activity in a wide range of marine invertebrate species. Comp Biochem Physiol C Toxicol Pharmacol. 2005;141:20–31. doi: 10.1016/j.cca.2005.04.008. [DOI] [PubMed] [Google Scholar]
  69. Stamatakis A. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006a;22:2688–2690. doi: 10.1093/bioinformatics/btl446. [DOI] [PubMed] [Google Scholar]
  70. Stamatakis A. IPDPS2006. Rhodos, Greece: 2006b. Phylogenetic models of rate heterogeneity: A high performance computing perspective. [Google Scholar]
  71. Stamatakis A, Hoover P, Rougemont J. A rapid bootstrap algorithm for the RAxML Web servers. Syst Biol. 2008;57:758–771. doi: 10.1080/10635150802429642. [DOI] [PubMed] [Google Scholar]
  72. Stegeman JJ, Teal JM. Accumulation, Release and Retention of Petroleum Hydrocarbons by Oyster Crassostrea virginica. Marine Biology. 1973;22:37–44. [Google Scholar]
  73. Stegeman JJ, Kloepper-Sams PJ, Farrington JW. Monooxygenase Induction and Chlorobiphenyls in the Deep-Sea Fish Coryphaenoides armatus. Science. 1986;231:1287–1289. doi: 10.1126/science.231.4743.1287. [DOI] [PubMed] [Google Scholar]
  74. Stegeman JJ, Livingstone DR. Forms and functions of cytochrome P450. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998;121:1–3. [PubMed] [Google Scholar]
  75. Sternberg RM, Hotchkiss AK, Leblanc GA. Synchronized expression of retinoid X receptor mRNA with reproductive tract recrudescence in an imposex-susceptible mollusc. Environ Sci Technol. 2008;42:1345–1351. doi: 10.1021/es702381g. [DOI] [PubMed] [Google Scholar]
  76. Venier P, De Pitta C, Pallavicini A, Marsano F, Varotto L, Romualdi C, Dondero F, Viarengo A, Lanfranchi G. Development of mussel mRNA profiling: Can gene expression trends reveal coastal water pollution? Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 2006;602:121–134. doi: 10.1016/j.mrfmmm.2006.08.007. [DOI] [PubMed] [Google Scholar]
  77. Verslycke T, Goldstone JV, Stegeman JJ. Isolation and phylogeny of novel cytochrome P450 genes from tunicates (Ciona spp.): a CYP3 line in early deuterostomes? Mol Phylogenet Evol. 2006;40:760–771. doi: 10.1016/j.ympev.2006.04.017. [DOI] [PubMed] [Google Scholar]
  78. Wincent E, Amini N, Luecke S, Glatt H, Bergman J, Crescenzi C, Rannug A, Rannug U. The suggested physiologic aryl hydrocarbon receptor activator and cytochrome P4501 substrate 6-formylindolo[3,2-b]carbazole is present in humans. J Biol Chem. 2009;284:2690–2696. doi: 10.1074/jbc.M808321200. [DOI] [PubMed] [Google Scholar]
  79. Wootton AN, Herring C, Spry JA, Wiseman A, Livingstone DR, Goldfarb PS. Evidence for the existence of cytochrome p450 genes families (CYP1A, 3A, 4A, 11A) and modulation of gene expression (CYP1A) in the mussle Mytilus spp. Marine Environmental Research. 1995;39:21–26. [Google Scholar]
  80. Zanette J, Jenny MJ, Goldstone JV, Woodin BR, Watka LA, Bainy AC, Stegeman JJ. New cytochrome P450 1B1, 1C2 and 1D1 genes in the killifish Fundulus heteroclitus: Basal expression and response of five killifish CYP1s to the AHR agonist PCB126. Aquat Toxicol. 2009;93:234–243. doi: 10.1016/j.aquatox.2009.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Zanette J, Goldstone JV, Bainy AC, Stegeman JJ. Identification of CYP genes in Mytilus (mussel) and Crassostrea (oyster) species: first approach to the full complement of cytochrome P450 genes in bivalves. Mar Environ Res. 2010;69(Suppl):S1–3. doi: 10.1016/j.marenvres.2009.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Zhang G, et al. The oyster genome reveals stress adaptation and complexity of shell formation. Nature. 2012;490:49–54. doi: 10.1038/nature11413. [DOI] [PubMed] [Google Scholar]

RESOURCES