Abstract
Intracellular symbiosis is known to be widespread in insects, but there are few described examples in other types of host. These symbionts carry out useful activities such as synthesizing nutrients and conferring resistance against adverse events such as parasitism. Such symbionts persist through host speciation events, being passed down through vertical transmission. Due to various evolutionary forces, symbionts go through a process of genome reduction, eventually resulting in tiny genomes where only those genes essential to immediate survival and those beneficial to the host remain. In the marine environment, invertebrates such as tunicates are known to harbor complex microbiomes implicated in the production of natural products that are toxic and probably serve a defensive function. Here, we show that the intracellular symbiont Candidatus Endolissoclinum faulkneri is a long-standing symbiont of the tunicate Lissoclinum patella, that has persisted through cryptic speciation of the host. In contrast to the known examples of insect symbionts, which tend to be either relatively recent or ancient relationships, the genome of Ca. E. faulkneri has a very low coding density but very few recognizable pseudogenes. The almost complete degradation of intergenic regions and stable gene inventory of extant strains of Ca. E. faulkneri show that further degradation and deletion is happening very slowly. This is a novel stage of genome reduction and provides insight into how tiny genomes are formed. The ptz pathway, which produces the defensive patellazoles, is shown to date to before the divergence of Ca. E. faulkneri strains, reinforcing its importance in this symbiotic relationship. Lastly, as in insects we show that stable symbionts can be lost, as we describe an L. patella animal where Ca. E. faulkneri is displaced by a likely intracellular pathogen. Our results suggest that intracellular symbionts may be an important source of ecologically significant natural products in animals.
Introduction
Insects are known to harbor a variety of intracellular symbionts that carry out useful functions, such as synthesizing essential amino acids not found in the host’s diet [1] or conferring resistance to parasitism and disease [2], [3]. In these systems, the bacteria are typically inherited vertically, with the host and symbiont potentially co-evolving for significant time. In recent years, genomic sequencing has revealed that intracellular symbionts in insects undergo a process of progressive genome degradation [1]. Through these studies, a model of symbiont evolution has emerged, whereby the low effective populations of host-restricted symbionts gives rise to a situation where deleterious mutations easily become fixed. The small effective population both weakens purifying selection and reduces the capacity for recombination, leading to progressive gene degradation and genome reduction in a process known as Muller’s ratchet [4]. Concurrently, the intracellular lifestyle of symbionts reduces the need for many functions that would be essential for independent life. Eventually, the loss of DNA repair pathways accelerates the process and increases the rate of genomic drift. Because strongly deleterious mutations are not observed (due to cell loss), the remaining genes in tiny genomes give a clear picture of the symbiont’s role in the relationship, even though their sequences may be suboptimal.
While intracellular symbionts are common in insects, they have never been found in chordates, such as mammals, where the only intracellular bacteria found are pathogenic [5]. We have been studying a different model of symbiosis, the tunicate Lissoclinum patella. Tunicates are sessile marine filter feeders, and as chordates they are the closest extant relatives of the vertebrates [6]. L. patella is a colonial tunicate, where groups of individual animals (zooids) live within a common tunic containing shared cloacal cavities. Extruded water from filter feeding, and waste products, are excreted into the shared cloacal cavities [7]. Much of the previous investigations in this system have focused on an extracellular symbiont that resides in the cloacal cavities of L. patella, the single-celled cyanobacterium Prochloron didemni. Through sequencing, it has been found that this symbiont produces highly modified cyclic peptides termed cyanobactins [8], [9]. More recently it has come to light that L. patella has a complex microbiome beyond P. didemni [9], and that there are multiple microhabitats within the animal which harbor distinct microbial denizens [10]. In our own efforts, we previously described a novel α-proteobacterial symbiont of L. patella, and showed that it was associated with the presence of patellazoles [11], [12] (Fig. 1), picomolar toxins that likely serve a protective function for the animal [13]. The genome of this symbiont (accession no. NC_019566), which we termed Candidatus Endolissoclinum faulkneri, showed signs of reduction, including low coding density, small gene inventory and loss of the ability for independent replication and division. At the same time the maintenance of the large patellazoles biosynthetic pathway (ptz), occupying >10% of the genome’s coding capacity, suggested its central importance to the symbiosis.
Here, we show that Ca. E. faulkneri has persisted in its relationship with L. patella over an extended period of evolutionary time, illustrating both the age and importance of the ptz pathway and the symbiont. Additionally, we show that the nonfunctional ∼40% of the Ca. E. faulkneri genome has persisted to the point where it contains few recognizable pseudogenes, showing a temporal separation between degradation and deletion not previously observed. In the one case of an L. patella animal that did not possess Ca. E. faulkneri, we found that it had been displaced by a likely intracellular pathogen related to known Anaplasmataceae species. This is similar to the phenomenon of symbiont displacement known to occur in insect systems [14]. Collectively, our work captures a novel intermediate stage of genome degradation and reveals similarities to a type of symbiosis previously only well described in insects.
Results and Discussion
Potential Cryptic Speciation in the Ca. E. faulkneri-Containing Clade of L. patella
We previously reported that patellazoles-containing L. patella animals formed a distinct clade in phylogenetic trees constructed with 18S rRNA and mitochondrial cytochrome c oxidase I (COXI) gene sequences [13]. The intracellular symbiont Ca. E. faulkneri, which is the likely source of the patellazoles, is only detected in animals within this clade. We reexamined this clade of L. patella, which we previously termed “group B”, and found a high degree of divergence in COXI sequence (Fig. 2). The geographically separated animals L2 (Fiji), L3 (Solomon Islands) and L5 (Papua New Guinea) shared a maximum of 85.6% COXI nucleotide identity (L5–L3). In all animal phyla, infraspecific COXI sequences have rarely been found to diverge greater than 2% [15], and in tunicate lineages cryptic speciation has been claimed based on COXI divergences ranging from 2% to 16.5% [16]–[20]. Although an ascidian molecular clock has not been established, it is known that mitochondrial genomes in this group are highly plastic [21] and divergence rates of 0.5–2.5% per Myr have been estimated [16]–[20]. Using these estimates, divergence of the members of “group B” can be dated to between 6.1 and 31 million years ago, and their degree of divergence suggests cryptic speciation. Although the reproductive compatibility of these animals is unknown, such divergence could be the result of physical separation of these sessile animals along with limited ranges for their gametes and larvae. L. patella larvae are known to have a limited range primarily due to predation [22], which also provides an evolutionary rationale for protective compounds such as the patellazoles.
Conservation of Synteny in Ca. E. faulkneri Divergent Strains L2 and L5 Supports Obligate Vertical Inheritance
With evidence that the three L. patella animals in “group B” were divergent and were possibly cryptic species, we sought to investigate the divergence of the intracellular symbiont Ca. E. faulkneri. To this end we carried out shotgun metagenomic sequencing of animal L5, and assembled the chromosome of Ca. E. faulkneri de novo. The Ca. E. faulkneri L5 genome is slightly larger than that of the strain found in L2 (1.51 Mbp vs. 1.48 Mbp, see Fig. 3). These strains share 98.8% nucleotide sequence identity in their 16S rRNA genes, which is above the 97.0% threshold that has been suggested for intraspecies conservation [23]. The closest-related characterized species is Thalassobaculum litoreum [80], a member of the family Rhodospirillaceae isolated from coastal seawater in Korea (94% 16S rRNA nucleotide identity to both Ca. E. faulkneri L2 and L5). As we noted previously [13], the closest related organism with available genome sequence data is an unclassified and unpublished marine α-proteobacterium termed BAL199 (accession no. ABHC00000000, 90% 16S rRNA gene identity to Ca. E. faulkneri), whose draft genome is much larger than Ca. E. faulkneri (6.1 Mbp) and has much higher GC content (see Table 1).
Table 1. Comparison of Ca. E. faulkneri, BAL199 and estimated Ca. X. pacificiensis genomes.
L2 | L5 | BAL199 | Ca. X. pacificiensis | |
Length (Mbp) | 1.48 | 1.51 | 6.10 | 1.04 |
% Coding (length) | 57.2 | 55.6 | 89.7 | 77.2 |
GC% (coding) | 40.9 | 41.2 | 65.7 | 33.0 |
GC% (noncoding) | 24.7 | 25.9 | 59.3 | 28.6 |
Protein coding genes | 771 | 770 | 6107 | 956 |
Analysis of the homologs in Ca. E. faulkneri L2, L5 and BAL199 reveals that 90.1% of genes found in Ca. E. faulkneri have homologs in BAL199, and the remainder are almost all conserved between L2 and L5 (see Fig. 4A). Homologs in the two strains of Ca. E. faulkneri diverge significantly (median protein identity 85.6%), yet we found that synteny is almost entirely conserved (see Fig. 4B), with only two small in-place inversions. This is consistent with intracellular symbionts in insects, such as Buchnera aphidicola [25] and Sulcia muelleri [26], in which genetic isolation and loss of recombination pathways allows complete synteny conservation over hundreds of millions of years, despite significant sequence drift. These symbionts have genomes in a more advanced stage of reduction than Ca. E. faulkneri: the ∼641 kbp genomes of B. aphidicola contain ∼550 protein coding genes, and the ∼260 kbp genomes of S. muelleri contain ∼230 protein coding genes. B. aphidicola strains APS and Sg are found in the aphid species Acyrthosiphon pisum and Schizaphis graminum, respectively [25]; because these symbionts are strictly vertically transmitted, their divergence follows that of the hosts, estimated to have occurred 50–70 million years ago [25]. Similarly, the S. muelleri strains GWSS (host: glassy-winged sharpshooter) and SMDSEM (host: cicada) are estimated to have diverged at least 200 million years ago [26]. As with B. aphidicola and S. muelleri, Ca. E. faulkneri has lost recA (see Fig. 5), and we found no evidence of mobile elements in the genomes of L2 or L5. We compared the level of divergence in the protein coding genes of L2/L5 with that of other strain pairs with dated divergence (Fig. 6). Ca. E. faulkneri strains exhibited an intermediate level of divergence between, on one extreme, S. muelleri [26] and B. aphidicola [25], and a more recent speciation in strains of Brucella [27]. Brucella melitensis 16M and Brucella ovis 25840 are intracellular pathogens of livestock, whose divergence has been dated to 86,000–296,000 years ago, which presumably occurred in wild animal populations prior to domestication [27]. Taken together, the divergence and synteny of L2 and L5 suggest that the two strains have been genetically isolated since the divergence of their hosts, roughly concurrently with the loss of recombination pathways, as evidenced by the two observed inversion events, which presumably occurred shortly before the capability was lost.
Ca. E. faulkneri Strains L2 and L5 Contain Only a Small Number of Recent Pseudogenes
The genomes of Ca. E. faulkneri L2 and L5 both have a very low coding density (57% versus a bacterial average of 90% [28]). This is similar to the early stages of genome reduction following host-restriction, which are characterized by a proliferation of pseudogenes (and therefore low coding density), and pervasive genome rearrangements, with only modest genome reduction [1]. In previously described low-density genomes, large numbers of pseudogenes have been found. For instance, 972 pseudogenes were described in the 4.2 Mbp Sodalis glossinidius genome (coding density 51%) [29], and 550 pseudogenes were found in the 2.8 Mbp Serratia symbiotica genome (coding density 60.9%) [30]. In these cases, symbiosis was established fairly recently. For example, a rice weevil symbiont related to S. glossinidius called SOPE has a 4.5 Mbp genome with 1194 pseudogenes [31]. Recently a closely related free-living pathogen (HC) was discovered and appears to have diverged from SOPE approvimately 28,000 years ago [31]. We searched for pseudogenes in both strains of Ca. E. faulkneri by using intergenic sequences as queries in BLASTX searches against the NR database, and also by using orphan genes in both strains as queries in searches against their partner. These efforts yielded strikingly few identifiable pseudogenes (see Table 2). All of these pseudogenes are characterized by numerous frame shifts and in-frame stop codons (see Fig. 7). Their putative functions are in line with the types of losses observed in other intracellular symbionts: replication, gene regulation, stress response and peptidoglycan degradation. The remaining intergenic sequences display an AT content much lower than that of coding sequences (see Table 1 and Figure 8), in contrast to the intergenic/pseudogene regions of the S. glossinidius genome, which in our analysis was very similar to coding regions (accession NC_007712, 56.2% for coding vs. 53.1% for noncoding). The higher AT content of intergenic sequences likely reflects AT mutation biases acting disproportionately on nonfunctional sections of the genome, as part of a general trend of increased AT content in progressively reduced genomes [1]. The intergenic sequences of Ca. E. faulkneri are extremely degraded – in BLASTN searches, we were only able to find 21 hits among hundreds of intergenic sequences (see Fig. 4C), although notably these hits were all syntenic. Nevertheless, in reciprocal TBLASTX searches they still show a strong syntenic signal (see Fig. 4D), even with preservation of the two inversions seen in the synteny plot of coding regions (Fig. 4B). This strongly suggests that these intergenic sequences were once genes that underwent an extended period of time where synonymous mutations were favored. This finding is unique amongst symbiont genomes and could suggest that the process of pseudogene formation proceeds in distinct stages, with sequence degradation preceding deletion. Other examples of long-term obligate symbionts in insects all have much smaller genomes where the majority of pseudogenes have already been deleted, and their symbiotic lifestyles date back to much earlier times (genome sizes 140–700 kbp, 40–270 million years ago [14]). Further work would be required to determine if the highly-degraded sparse genome reduction stage is restricted to certain types of organism or systems, or whether it represents an intermediate stage held through which the more reduced insect symbionts have passed.
Table 2. Pseudogenes in Ca. E. faulkneri L2 and L5.
L2 Coordinates | L5 Coordinates | Strand | Nearest homolog | Function |
52194–53458 | + | A1OE_48 ftsK/SpoIIIE family protein | Replication | |
153326–154049 | 155506–156085 | + | UTP-glucose-1-phosphate uridylyltransferase | Glucose |
[alphaproteobacterium BAL199] (WP_007680598) | metabolism | |||
431976–432886 | − | A1OE_465 N-acetylmuramoyl- L-alanine amidase | Peptidoglycan | |
family protein | degradation | |||
439025–440102 | + | A1OE_470 peptidase M48 family protein | Heat shock | |
protein | ||||
722626–724001 | + | P856_442 chromosomal replication initiator | Replication | |
protein DnaA | ||||
903089–903300 | + | 23S rRNA (uracil-5-)-methyltransferase, partial | Ribosomal | |
[Methylobacterium extorquens] (WP_003607533) | structure | |||
1019673–1020560 | + | P856_614 hydroxyacylglutathione hydrolase GloB | β-lactamase | |
1237554–1237896 | − | A1OE_1333 helix-turn-helix family protein | Regulation | |
1317241–1318045 | 1349258–1350574 | + | Guanosine polyphosphate pyrophosphohydrolase | Stringent |
/sythetase alpha proteobacterium BAL199 | response | |||
(WP_007669831) |
Analysis of the gene inventories of L2 and L5 showed loss of key genes involved in chromosomal replication, DNA mismatch repair and cell division (Fig. 5). For instance, the replication initiator dnaA [32] is missing in L2, whereas ftsK, which is involved in the termination of replication, is missing in L5. These genes are detectable as pseudogenes (see Table 2) and intact ORFs in the corresponding strain (see Table 3), suggesting that their loss was recent. This is supported by the GC content of the pseudogenes, which are at an intermediate GC content, significantly different from both coding and intergenic regions (see Table 1, Fig. 7 and Fig. 8). Other central genes are missing in both L2 and L5, for instance the almost universally conserved protein FtsZ [33], which has a central role in bacterial cell division, forming the Z-ring that divides an elongated rod cell in the center. To the best of our knowledge, Ca. E. faulkneri L2 possesses the largest genome lacking both dnaA and ftsZ, and Ca. E. faulkneri L5 possesses the largest genome lacking ftsZ (see Fig. 9). It should be noted that in our analysis we did not include members of the Chlamydieae and Planctomycetes lineages, which do not possess ftsZ but may use other methods to produce a peptidoglycan septum [33]. The only other example of loss of these genes in early-stage symbiosis is the cyanobacterium ‘Nostoc azollae’, an extracellular symbiont of the plant Azola filiculoides [34]. This cyanobacterium still has a large genome with low-coding density and many pseudogenes, including dnaA, but it still possesses ftsZ [35]. An ftsZ pseudogene could not be found in either strain of Ca. E. faulkneri despite extensive searches, suggesting that it was not lost recently. Both strains are missing the key genes mutSLH, involved in the initial recognition of DNA mismatches prior to repair [35] (see Fig. 5). The nucleotide excision repair pathway appears to be complete, and the base excision repair pathway contains a similar gene complement to BAL199, suggesting that while DNA damage caused by UV radiation may be repairable in Ca. E. faulkneri, mismatches from replication errors and mutations will become fixed [35]. The loss of DNA repair pathways is thought to be one of the driving forces for increased rate of evolution observed in some intracellular symbionts [1].
Table 3. Orphan genesa in Ca. E. faulkneri strains L2 and L5.
Strain | Locus tag | Annotation | Homolog in BAL199 | corresponding strain? |
L2 | A1OE_1333 | helix-turn-helix | WP_007672880 | Yes |
family protein | ||||
L2 | A1OE_1515 | lipid A biosynthesis N- | WP_007668018 | No |
terminal domain protein | ||||
L2 | A1OE_465 | N-acetylmuramoyl-L- | WP_007674464 | Yes |
alanine amidase family protein | ||||
L2 | A1OE_470 | peptidase M48 family protein | WP_007674472 | Yes |
L2 | A1OE_48 | ftsK/SpoIIIE | WP_007677281 | Yes |
family protein | ||||
L2 | A1OE_1223 | hypothetical protein | No | |
L2 | A1OE_977 | hypothetical protein | No | |
L2 | A1OE_1030 | hypothetical protein | No | |
L5 | P856_442 | chromosomal replication | WP_007679288 | Yes |
initiator protein DnaA | ||||
L5 | P856_69 | hypothetical protein | No | |
L5 | P856_611 | hypothetical protein | No | |
L5 | P856_614 | hydroxyacylglutathione | Yes | |
hydrolase GloB | ||||
L5 | P856_659 | hypothetical protein | No | |
L5 | P856_249 | hypothetical protein | No | |
L5 | P856_500 | hypothetical protein | No | |
L5 | P856_13 | hypothetical protein | WP_007677288 | No |
These are annotated genes in one Ca. E. faulkneri strain that are not found in the corresponding strain.
The vast majority of extant genes are shared between Ca. E. faulkneri L2 and L5 (see Fig. 4A). Of the small number of orphan genes in each strain, the majority are found as pseudogenes in the corresponding strain or else are short hypothetical genes (see Table 3). We found only one instance where homologs differed in length by more than 20%, a criterion that has been used to identify pseudogenes [36] (see Fig. 10). The one instance of truncation was a multiefflux transporter in L5 (P856_600), which was rendered into two proteins in L2 (A1OE_1073 and A1OE_1074) by a frameshift. When comparing lengths of Ca. E. faulkneri proteins to their homologs in BAL199, very few differed by more than 20% (see Fig. 10 and Table 4). These shortened ORFs may in fact be pseudogenes that have undergone deletions and have not yet been disrupted by in-frame stop codons. Collectively, the low number of identifiable pseudogenes and truncated ORFs would suggest that the majority of annotated protein coding genes are not pseudogenes. However, at least some of these genes may still be nonfunctional, even if transcribed. For instance, although both strains of Ca. E. faulkneri possess the vast majority of peptidoglycan biosynthesis and rod-shape determining genes (except for ftsZ, see Fig. 5), cells are irregular globules [13] that may lack a cell wall. Such irregular cell shape is only seen elsewhere in symbionts with genomes <250 kbp that are missing almost all genes involved in cell envelope biosynthesis and that “appear to lack a cell wall” [1]. Likewise, although intracellular bacteria typically lose lipopolysaccharide pathways [37], Ca. E. faulkneri maintains the genes required for UDP-N-acetyl-D-glucosamine synthesis (glmS, mrsA and glmU) and the majority of genes required for synthesis of the LPS precursor Kdo2-lipid A (lpxACDHBKLM, kdsACB, and kdtA) [38]. However, genes required for the later steps in LPS synthesis are missing.
Table 4. Ca. E. faulkneri genes that are more than 20% shorter than their homolog in BAL199 in at least one strain.
L2 Gene | % Difference in length | L5 Gene | % Difference in length | Annotation |
A1OE_924 | −45.7% | P856_522 | −45.7% | rare lipoprotein A |
A1OE_1441 | −41.1% | P856_761 | −29.5% | rpoZ DNA-directed |
RNA polymerase, omega | ||||
subunit | ||||
A1OE_538 | −38.1% | P856_302 | −35.0% | ccmI |
cytochrome c-type | ||||
biogenesis protein | ||||
A1OE_1235 | −37.8% | P856_668 | −39.7% | conserved |
hypothetical protein | ||||
A1OE_177 | −34.9% | P856_104 | −34.8% | putative glycosyl |
transferase | ||||
A1OE_432 | −32.7% | P856_255 | −20.2% | ccmA cell envelope |
outer membane | ||||
protein | ||||
A1OE_399 | −29.7% | P856_237 | −30.4% | rspP ribosomal |
protein S16 | ||||
A1OE_1503 | −28.8% | P856_799 | −31.3% | rluB |
pseudouridine | ||||
synthase | ||||
A1OE_720 | −28.6% | P856_405 | −28.6% | putative pyruvate |
dehydrogenase E1 | ||||
component, beta | ||||
subunit | ||||
A1OE_72 | −26.8% | P856_52 | −26.8% | hemolysin C |
A1OE_1058 | −23.1% | P856_590 | −31.1% | colicin V production |
family protein | ||||
A1OE_986 | −22.1% | P856_554 | −26.8% | tatB |
A1OE_347 | −19.7% | P856_211 | −20.7% | rplI ribosomal |
protein L9 | ||||
A1OE_1508 | −13.6% | P856_803 | −29.5% | hypothetical protein |
A1OE_741 | −13.6% | P856_420 | −21.3% | hisC histidinol-phosphate |
aminotransferase |
Recent work in insects suggests that when evolutionary pressures change (for example after the acquisition of a second symbiont by the host), a new round of genome degradation and pseudogenization can be precipitated, even in tiny genomes [26], [39]. Our analysis suggests that Ca. E. faulkneri has been under unchanging pressures, at least since the divergence of strains L2 and L5, because we see very few recent pseudogenes and the majority of extant genes are conserved in both L2 and L5. In our estimation the two sequenced strains of Ca. E. faulkneri diverged somewhere between 6 and 31 million years ago, and the conservation of the gene inventories between the strains suggests that most of the degraded genes were already in a state of decay at the point of divergence. This is further supported by the lingering similarity of intergenic regions by TBLASTX but not BLASTN. Very few cases of gene decay since that time are readily apparent, and include ftsK and dnaA, both important genes in chromosomal replication. It is remarkable that ftsZ, which is missing in both strains, was not identified as a pseudogene, given its maintenance in much smaller genomes [1] and its central role in both cell division and maintenance of rod shape.
The ptz Cluster was Present before the Divergence of L2 and L5
Genes within the ptz pathway are not found in one distinct locus, but are in fact scattered throughout the genome (see Fig. 3). We previously suggested [13] that this scattering was a result of an ancestral ptz gene cluster being present in the genome of Ca. E. faulkneri before a period of pervasive genome rearrangements seen in early stages of host-restriction [1]. When comparing the entire ptz pathway in L2 and L5, we observe a similar degree of divergence as with other protein-coding genes in these strains (∼85%, see Table 5) and these genes are part of the almost complete conservation of synteny maintained since the divergence of L2 and L5. This strongly suggests that the acquisition of the ptz pathway dates to before the divergence of Ca. E. faulkneri L2 and L5.
Table 5. Comparison of ptz genes in Ca. E. faulkneri L2 and L5.
Gene | Functiona | Alignment | Protein | Nucleotide |
length (bp) | identity (%) | identity (%) | ||
ptzA | PKS | 9,357 | 86.2 | 86.9 |
ptzB | PKS | 3,753 | 85.4 | 87.0 |
ptzC | PKS | 15,105 | 84.7 | 86.3 |
ptzD | PKS | 19,659 | 84.6 | 85.9 |
ptzE | PKS | 14,400 | 81.7 | 84.9 |
ptzF | PKS | 10,710 | 83.4 | 85.6 |
ptzG | ECH | 747 | 93.6 | 90.1 |
ptzH | KS | 1,224 | 82.8 | 84.2 |
ptzI | HMGS | 1,311 | 93.0 | 90.8 |
ptzJ | ECH | 795 | 90.2 | 87.2 |
ptzK | AT2 | 984 | 86.3 | 86.2 |
ptzL | AT1 | 873 | 83.8 | 86.3 |
ptzM | P450 | 1,347 | 92.2 | 88.8 |
ptzN | P450 | 1,308 | 90.0 | 88.8 |
ptzO | DCR | 804 | 91.8 | 87.2 |
ptzP | Ox | 1,344 | 79.4 | 83.9 |
ptzQ | ER | 1,524 | 86.2 | 86.8 |
ptzR | C | 1,326 | 85.7 | 87.6 |
Abbreviations: AT1, trans-acting acyltransferase; AT2, proofreading acyltransferase [22]; C, condensation; DCR, 2,4-dienoyl-CoA-reductase; ECH, enoyl-CoA-reductase; ER, enoyl-reductase; HMGS, 3-hydroxy-3-methylglutaryl-CoA-synthase; KS, ketosynthase; Ox, thiazoline oxidase; P450, cytochrome P450; PKS, polyketide synthase.
Although the ptz pathway has diverged significantly since the common ancestor of Ca. E. faulkneri L2 and L5, the structure of the patellazoles remains the same. In samples L2, L3 and L5, we previously detected patellazoles A and B at the same retention times and with masses within 5 ppm of calculated values for their published molecular formulas [13]. There are examples of natural product pathways that produce very similar structures despite significant sequence divergence. This situation usually arises where an ecologically important pathway is frequently transferred horizontally between bacteria. In such cases related pathways may be isolated from each other following a horizontal transfer if the descendants of the donor and recipient strain adapt to different environments. For example, the anti-cancer drug ET-743/trabectedin (brand name Yondelis) is a minor groove DNA-alkylating agent [40] produced by Ca. Endoecteinascidia frumentis, a symbiont of the tunicate Ecteinascidia turbinata [41]. The nonribosomal peptide synthetase (NRPS) proteins of the ET-743 pathway are related to others found in free-living bacteria such as Streptomyces lavendulae (actinobacteria), Myxococcus xanthus (δ-proteobacteria) and Pseudomonas fluorescens (γ-proteobacteria). Collectively, these pathways make diversified structures with related core motifs (see Fig. 11). The NRPS proteins that make up these pathways are highly divergent, with protein and nucleotide identities in the region of 20–50% (see Fig. 11). Similarly pederin and the onnamides (see Fig. 11) have related structures but are produced in very different environments. Pederin is found in Paederus spp. beetles, and acts as a chemical defense made by a Pseudomonas sp. symbiont [42], [43], while onnamides are found in several marine sponges [44], [45]. The pederin pathway polyketide synthase (PKS) proteins PedI and PedF produce products analogous to the onnamide pathway proteins OnnB and OnnI, respectively. These protein pairs maintain an identity of 50% (see Fig. 11).
The ptz pathway genes in Ca. E. faulkneri strains L2 and L5 are not as divergent as the cases of ET-743 and pederin pathway homologs. However, the divergence of ptz is notable as the two variants make the same compounds, rather than analogs, and they have been maintained in two descendants of a common ancestor. The closest analog of this system is the γ-proteobacterium Ca. Endobugula sertula, which produces the cytotoxic bryostatins within its host, the bryozoan Bugula neritina. B. neritina has three subspecies, known as “Deep”, “Shallow” and “Northern”, that occupy different habitats [46]. Bryostatins are only detected in the “Deep” and “Shallow” subspecies, with each producing the same core macrocyclic polyketide structure, but with different side chains [46]. Although the full genome of Ca. E. sertula has not been sequenced, there is evidence that genome rearrangements have occurred since the divergence of the “Deep” and “Shallow” forms, because while the known genes in the bry pathway are in a single locus in “Shallow”, they are found on separate clones in “Deep” [46]. Nevertheless, gene sequences in the two pathways are still highly similar (see Fig. 11), in contrast to the ptz pathway.
Our work supports the idea that natural products can be the basis of stable and long-lived symbiotic relationships. Although this idea has developed over several years based on the examples outlined above, generally little is known about the evolutionary history of the producing symbionts. In the case of the pederin pathway there is evidence that natural product pathways have been horizontally acquired relatively recently based on sequence analysis [47]. In this case the symbiosis may also be relatively recent, although an age has not been estimated. Recently a symbiont of the Asian citrus psyllid Diaphorina citri, Ca. Profftella armatura, was found to contain a functional polyketide pathway (termed dip) related to that of pederin [48]. Ca. P. armatura has a 460 kbp genome (89.5% coding density), and thus it is in a more advanced stage of genome reduction than Ca. E. faulkneri. There is some evidence that this symbiont serves a nutritional function in addition to synthesizing the polyketide diaphorin, and thus it is unclear how old dip is or when it was acquired by the symbiont, since nucleotide analysis does not suggest a recent acquisition. Because symbionts with reduced genomes lose the ability to accept horizontally transferred DNA, dip likely dates to early on in the symbiotic relationship. Together with Ca. E. faulkneri, the discovery of Ca. P. armatura suggests that large natural product pathways can be conserved in obligate symbionts over vast evolutionary time scales.
A New Anaplasmataceae Species is Found in L. patella L6 in Place of Ca. E. faulkneri
We previously found that the L. patella animal L6, despite being closely related to L5, did not contain Ca. E. faulkneri or the patellazoles by LCMS [13]. The remaining microbiome was very similar in L5 and L6, allowing us to determine that Ca. E. faulkneri was the likely source of the patellazoles. However, in 16S analysis, one group of sequences was present in L6, but not L5. These were assigned to the Anaplasmataceae family of α-proteobacteria. Shotgun metagenomic sequencing and assembly of DNA sequence derived from the zooids of L6 revealed ten high-coverage contigs (see Table 6) containing predicted genes that in BLASTP searches against NR aligned to homologs in Anaplasmataceae. We examined the nucleotide composition of the annotated coding regions in these contigs. The mean values and ranges for GC%, GC2, GC4 and codon adaptation index (CAI) [49] appeared to be similar for all contigs (see Fig. 12). We tested the statistical significance of the differences between contigs by ANOVA followed by Tukey’s honest significant difference (HSD) test. Only Contig16 was significantly different to any other contig with p<0.05 (see Table S2). All other pairwise tests were nonsignificant, indicating similar nucleotide composition in the remaining contigs. Importantly, the complete 16S, 5S and 23S rRNA genes were assembled within those contigs (see Table 6). In line with other Rickettsiales, the 16S gene is separated from the 5S and 23S rRNA genes. This separation is believed to have occurred some time after the split of ancestral Rickettsiales and mitochondrial lineages [50]. The 16S rRNA gene is highly divergent from known sequences, with the closest relative sharing only 84% identity (Ehrlichia sp. “trout isolate”, accession AF206298). Our own phylogenetic analysis shows that this bacterium is part of the Anaplasmataceae family, but diverges significantly from other genera (see Fig. 13), including another highly-divergent proposed species, Ca. Xenohaliotis californiensis [51]. Interestingly, the latter is a pathogen of abalone that causes withering syndrome [51], and is one of the few described marine species in this family of α-proteobacteria. Together with our findings, this suggests that there may be other highly divergent Anaplasmataceae lineages in marine environments. We term the new species Candidatus “Xenolissoclinum pacificiensis”, to reflect that it is likely not a long-term symbiont of L. patella.
Table 6. Contig lengths in the assembly of Ca. X. pacificiensis.
Contig | Length (bp) | Notes |
Contig1 | 410,650 | Contains 16S rRNA gene |
Contig2 | 36,365 | |
Contig4 | 92,279 | |
Contig5 | 28,937 | |
Contig6 | 53,060 | |
Contig7 | 166,431 | Contains 5S and 23S rRNA genes |
Contig15 | 206,567 | |
Contig16a | 174,382 | |
Contig17 | 38,820 | |
Contig18 | 6,336 |
Contig16 was found to have different nucleotide composition compared with other contigs with p<0.05, and thus was excluded from the final assembly (see Main Text).
The genome of Ca. X. pacificiensis is smaller than those of Ca. E. faulkneri, but it has greater coding density (77.2% vs. 56–57%, see Table 1). Examination of the genes present in the genome of Ca. X. pacificiensis indicate that it is in a less advanced state of genome reduction, compared with Ca. E. faulkneri. Ca. X. pacificiensis possesses recA, maintains the majority of additional genes required for homologous recombination, and the genome still contains prophage and transposon sequences (see Fig. 5). Ca. X. pacificiensis also contains a homolog of the comEC gene, and may be competent for DNA uptake [52]. Unlike Ca. E. faulkneri, Ca. X. pacificiensis retains key genes involved in chromosome replication and cell division - dnaA, ftsK and ftsZ, among others. For example, it possesses parA and parB, which are involved in chromosomal segregation during division [53] and are not found in Ca. E. faulkneri. Ca. X. pacificiensis also possesses the genes mutS and mutL, suggesting that it is able to carry out mismatch repair. Like other Anaplasmataceae, Ca. X. pacificiensis lacks a functional LPS biosynthetic pathway [37] (see Fig. 14), but unlike the majority of this family, it maintains many genes involved in flagellar assembly [54].
Many bacteria in the family Anaplasmataceae are obligate intracellular pathogens that infect mammals through arthropod vectors, such as ticks [37]. For instance, Neorickettsia risticii causes Potomac horse fever [55], and Ehrlichia chaffeensis was recently found to cause disease in humans [37]. E. chaffeensis is found in vacuoles in white blood cells (monocytes, macrophages and dendritic cells), where it actively divides and evades phagocytic destruction [37]. Likewise, mammalian infection with other Anaplasmataceae, such as N. risticii can manifest through intracellular infiltration of white blood cells [37]. We previously visualized Ca. E. faulkneri cells within tunicate blood cells with the amorphous and granular appearance of phagocytes [13], suggesting that in L. patella animal L6, Ca. X. pacificiensis could have displaced Ca. E. faulkneri by colonizing the same cell type. In analysis of 16S amplicon data from different tissues of L6, we found an enrichment of the Ca. X. pacificiensis 16S rRNA gene sequence in the zooids versus the tunic or cloacal contents (see Fig. 15), suggesting that Ca. X. pacificiensis may have similar tissue localization to Ca. E. faulkneri. Further studies would be required in order to determine whether Ca. X. pacificiensis resides within the same cell type as Ca. E. faulkneri. Interestingly, we found a very small number of sequences within 98% identity of the Ca. X. pacificiensis 16S rRNA sequence in animal L2 (2 and 25 sequences in the cloacal contents and zooids out of 7,775 and 5,477 sequences, respectively). This suggests that low-level infection of Ca. X. pacificiensis may be common in this clade of L. patella, and that overt infection only occurs in susceptible individuals.
Genome Analysis Reveals Ca. Endolissoclinum faulkneri and Ca. X. pacificiensis have Different Lifestyles
Both long term vertically-transmitted symbionts and intracellular pathogens go through a process of genome reduction [1], [56]. For instance, both Ca. E. faulkneri and Ca. X. pacificiensis are deficient in amino acid biosynthesis pathways, due to availability of amino acids in the intracellular environment. However, while Ca. E. faulkneri possesses the ptz pathway for the patellazoles, which likely serve as chemical defenses for the host animal, we did not find a compelling symbiotic function for Ca. X. pacificiensis. Like many other members of the family Anaplasmataceae, Ca. X. pacificiensis is either a pathogen of L. patella, or the tunicate acts as a reservoir for infection of other hosts, passed through an unknown vector.
Unlike Ca. E. faulkneri, Ca. X. pacificiensis is likely able to control its own replication and division, and is competent in DNA repair and recombination. In the absence of an advantageous function for the host, Ca. X. pacificiensis is at best a parasite, but it also contains several features that suggest it adopts a pathogenic lifestyle. For instance, although most Ehrlichia do not possess flagellar assembly genes, they have been shown to play a role in the growth of another intracellular pathogen, Legionella pneumophila [57]. Additionally, Ca. X. pacificiensis possesses a type IV secretion apparatus, which has been implicated in the pathogenesis of Ehrlichia and other Anaplasmataceae infections [56]. The genes in this apparatus (see Fig. 14) are in line with other members of the Anaplasmataceae, which commonly lack homologs of virB1, virB2, virB5 and virB7 [56]. In E. chaffeensis infection, tandem repeat- and ankyrin repeat-containing proteins are thought to play a major role in host interactions during infection [37]. Ankyrin repeats are rare in prokaryotes [50], and in the context of Ehrlichia infection these domains are thought to influence host gene expression [37]. We found one ankyrin repeat protein (P857_417) in the genome of Ca. X. pacificiensis, which was predicted to be secreted through a type IV pathway with SSPred [58], suggesting that this protein is a secreted effector in infection.
In some insect systems, the host is thought to tightly control the proliferation of intracellular symbionts [5]. Limited division is one of the hallmarks of symbiosis in contrast to intracellular infection [5]. Therefore the loss of many central replication and division genes in Ca. E. faulkneri distinguishes it as a symbiont in comparison to Ca. X. pacificiensis, in addition to the presence of the ptz pathway for the protective patellazoles. From our gene inventory analysis we conclude that Ca. X. pacificiensis is able to control its own replication and division. In addition, it shares several features common to intracellular pathogens in the family Anaplasmataceae. The known cellular habitats of pathogens such as E. chaffeensis and our own 16S amplicon data suggest that Ca. X. pacificiensis may have displaced Ca. E. faulkneri by taking residence in the same host tissue. Similar phenomena have been observed in insects, where occasional loss of long-term symbionts is observed in specific insect lineages [14]. Presumably this displacement comes at a cost for animal L6. If Ca. X. pacificiensis commonly infects and displaces symbionts in this L. patella population, it may eventually adapt to a symbiotic lifestyle, similar to some Wolbachia species [59], [60]. Ca. X. pacificiensis may be capable of accepting horizontally transferred DNA and thus might be able to take on functions that replace the ptz pathway of Ca. E. faulkneri.
Conclusion
While the progress of genome decay in intracellular symbionts is most well studied in insects, our results show that such phenomena are not limited to this group of hosts. Insect symbionts most often provide nutritional support by synthesizing essential nutrients not found in the insect’s diet, and are sometimes found to be protective against parasites or infection [1]–[3]. The symbiotic relationship of Ca. E. faulkneri and L. patella is instead based on the production of relatively large natural products, and our analysis suggests that these products have been important enough to be conserved against a drive of genome reduction for millions of years. Evidence of such a stable symbiotic relationship cements the role of symbiotic bacteria in natural product production [61], [62], and suggests that intracellular symbionts may be an important source of natural products.
Materials and Methods
Collection, DNA Extraction, Isolation and Sequencing
Permission to perform field research was granted by the Papua New Guinea Department of Environment and Conservation and facilitated by the University of Papua New Guinea. Animals were collected as described previously [13] by scuba. Zooids were dissected from L5 and L6 as described previously [13] from samples that had been preserved in RNAlater. DNA was then extracted using a standard method for tunicates [63], followed by repurification using the Genomic DNA Clean & Concentrator kit (Zymo Research). Double-stranded DNA was quantified using the Quant-it PicoGreen kit (Invitrogen), before being subjected to sequencing on an Illumina HiSeq 2000 in a 101 bp paired-end run (one complete lane for each sample). Before assembly, reads were filtered to remove read pairs that did not have quality scores ≥30 over more than 40 bp on each direction.
COXI Identity Matrix (Fig. 2)
The COXI tree was described previously [13]. Briefly, nucleotide sequences were aligned with ClustalW-MPI [64]. The alignment was inspected manually using ClustalX [65], and any sequences that were particularly short or unilaterally introduced large inserts into the alignment were discarded. The alignment was trimmed using a Perl script (trim_aligned_fasta.pl [13]), and then used as an input for FastTree [66], using the parameters -slow -spr 5 -mlacc 3 -gamma -gtr -nt. Identity values presented here were calculated by re-examining the alignments used to make the tree using a Perl script (identity_matrix.pl [13]). To make the figures, values were imported into Microsoft Excel, where a continuous color scale running from dark green (lowest value in figure) to bright red (highest value in figure) was applied.
Assembly of the Ca. E. faulkneri L5 Genome
An initial assembly was constructed using Velvet [67] with a k-mer size of 61 bp and a coverage cutoff of 5. Protein sequences from the genome of Ca. E. faulkneri L2 were used as queries for a TBLASTN search against the raw assembly. Hit contigs with a % identity to the queries of ≥60% were extracted and aligned to the Ca. E. faulkneri L2 genome. Short contigs that did not align to the L2 genome were rejected, leaving a set of 63 contigs with a combined size of 1.51 Mbp and an n50 of 37.4 kbp. These contigs were used as queries in a BLASTN search against the raw Illumina reads, using an e-value cutoff of 1×10−30. Hit reads were extracted and assembled with Velvet [67] using a k-mer size of 67 bp and an expected coverage of 25 to give an assembly of 5 contigs with total size 1.52 Mbp. These were used as queries in another round of BLASTN searching against the raw reads and subsequent assembly. After removal of runs of Ns with a custom Perl script (fasta_split_Ns.pl, Text S1), contigs from the two iterative assemblies were assembled in Sequencher to give an assembly of 4 contigs totaling 1.51 Mbp. The remaining regions were amplified by PCR (see Table 7) using Platinum Taq High Fidelity (Invitrogen), cloned using the TOPO TA cloning kit (Invitrogen) and sequenced to yield the complete chromosome of Ca. E. faulkneri L5. In order to validate the assembly, the entire set of filtered Illumina reads were aligned to the assembled sequence with Bowtie 2 [68]. Unaligned reads were removed from the resulting sam file using a Perl script (sam_remove_unaligned.pl, Text S2). The resulting sam file was converted to a bam file using Samtools [69], before variants were called (also using Samtools). 96 variant sites were found, indicating a low error rate (0.0063%). For comparison, the same procedure was carried out with reads used to assemble Ca. E. faulkneri L2. This found a similar amount of variants - 34 (0.0023%). The vcf file generated in this analysis are available in the supporting information (see Text S3).
Table 7. Primers used in this study.
Name | Sequence | Reference | Notes | 5′ coordinatea |
ef33_734_Rout_2 | CGTAGACCATAACGCAGTATGG | This study | Contig joining | 702,249 |
ef33_738_Lout_2 | CGCAAGCACTAAACGGCAC | This study | Contig joining | 705,184 |
ef33_1327_Rout | CGTCTATTAAAGGCTGCATCGG | This study | Contig joining | 1,262,269 |
ef33_1329_Lout | GGTTCGCATGAGCTTGTATCG | This study | Contig joining | 1,265,356 |
ef33_829_Rout | TCCACCACTGACATTAGTAGATAC | This study | Contig joining | 798,954 |
ef33_832_Lout | CAGTACAGCGCGAGATACAATG | This study | Contig joining | 802,162 |
ef33_124_Lout | ACACCTTCAGAACTTACAGCAATG | This study | Contig joining | 123,860 |
Thal16SFrev | AGGGTGTGGTTATTGGAGAC | This study | Contig joining | 117,880 |
Thal_16S-F | GTCTCCAATAACCACACCCT | Kwan et al. | Contig joining | 117,899 |
2012 [13] | ||||
Thal_16S-R | GCTTTCGATACTGCATAGCTC | Kwan et al. | Contig joining | 117,512 |
2012 [13] | ||||
Thal_23S_R | CCTCACGGTACTAGTTCAC | Kwan et al. | Contig joining | 119,618 |
2012 [13] | ||||
Supercontig_9- | GAATAATTGATACTCCAGCTAGC | Kwan et al. | Contig joinint | 114,009 |
R-out | 2012 [13] | |||
27F | AGAGTTTGATCCTGGCTCAG | Weisburg et al. | 16S | 116,943 |
1991 [80] | amplification | |||
1492R | GGTTACCTTGTTACGACTT | Reysenbach et al. | 16S | 118,390 |
1992 [81] | amplification | |||
M13_4_TOPO-F | GTAAAACGACGGCCAG | Supplied with | TOPO clone | |
TOPO-TA kit | sequencing | |||
M13_4_TOPO-R | CAGGAAACAGCTATGAC | Supplied with | TOPO clone | |
TOPO-TA kit | sequencing | |||
ef33_829_insert_F | TTGTTAAGTGCATCATGCACCG | This study | Sequencing | 800,604 |
ef33_832_insert_R | AACAGCAAAACTCAGATAATG | This study | Sequencing | 801,342 |
ef33_1327_insert_F | ATGAGATAACTGGATACACGC | This study | Sequencing | 1,263,989 |
ef33_1329_insert_R | TTAGTGTAGGAGTAGTATTGTTC | This study | Sequencing | 1,264,424 |
ef33_734_insert_F | TCAATCAACAAGAGAGGAGTAC | This study | Sequencing | 703,427 |
ef33_738_insert_R | AAGACGTCATTTGGCATAGTTAGG | This study | Sequencing | 704,265 |
ef33_23Sreg_124F2 | ATTCAAATAGCAACCGGGATAAC | This study | Sequencing | 123,190 |
ef33_23Sreg_124F3 | TAAGGATAATCTGCCATACATAAC | This study | Sequencing | 122,527 |
ef33_23Sreg_124R1 | CCTGACTGCGAGGCTGAC | This study | Sequencing | 121,371 |
ef33_23Sreg_C2F2 | CTACCCCCTACTCTGTGCC | This study | Sequencing | 120,807 |
ef33_23Sreg_R1 | GAGGTCAGCTTACAAGAAAACCG | This study | Sequencing | 118,477 |
The coordinates shown refer to the chromosome of Ca. E. faulkneri L5.
Assembly of the Draft Ca. X. pacificiensis Genome
An initial assembly was carried out using Meta-Velvet [70] with a k-mer size of 61 bp, and examined manually. Several contigs with k-mer coverage ∼30× seemed to contain genes related to Anaplasmataceae family α-proteobacteria. To isolate the genome of this organism, an assembly was carried out using Velvet [67] with the parameters -cov_cutoff 22 -exp_cov 30 -max_coverage 40. Contigs larger than 10 kbp were used as queries in BLASTN searches against the reads similarly to the assembly of Ca. E. faulkneri. Contigs from both the first and second round assemblies were manually filtered to remove tunicate contigs and assembled in Sequencher. The resulting assembly had 17 contigs and an n50 of 174.4 kbp. An initial annotation was constructed using Clovr [71] and loaded into a MySQL database using Ergatis [72]. Proteins from this annotation were used as queries in a BLASTP search against the NR database. The outputs from these searches were used to assign phylogeny with Megan [73]. Contigs were rejected if they did not contain a single gene assigned to the family Anaplasmataceae. The GC content, GC2, GC4 and CAI for all predicted protein-coding ORFs were calculated using Perl scripts (genbank_multi_process.pl [Text S4], CAI_calculate.pl [13]). For CAI calculations, genes from Contig1 (which contains the complete 16S rRNA gene) were used to calculate reference RCSU and w values [67]. The results of these calculations were plotted as boxplots in R, using the ggplot2 package. ANOVA analysis was carried out in R, using the aov function, followed by the TukeyHSD test for significance (see Table S2).
Annotation of Bacterial Genomes
The contigs of Ca. X. pacificiensis and the complete Ca. E. faulkneri L5 chromosome were annotated with Clovr [71], and then loaded into a MySQL database (Chado schema [74]) using Ergatis [72]. The databases were manually manipulated using the Manatee interface (http://manatee.sourceforge.net/igs/index.html).
Identification of Homologs in L2, L5 and BAL199
L5 proteins were used as queries in a BLASTP search against L2 proteins with default parameters and an e-value cutoff of 10 to identify homologs. The hits were processed according to the following algorithm.
Retain only best (lowest e-value) hit (subject) for each query.
Order hits in ascending order of e-value.
Discard pairs where subject occurs a second and subsequent times.
Discard pairs where query and subject produce dissimilar hit lists in BLASTP searches against NR. (First 10% in descending e-value list checked).
With the assumption that L2 and L5 are syntenic, calculate the expected coordinate in L5 for every gene in L2 that still exists in the list. For each gene calculate the difference between expected and observed coordinate in L5.
Order the hits in descending order of absolute difference between the expected and observed coordinate in L5. Examine each pair manually in the manner of point 4 (First 10% in list examined).
Order the hits in descending order of absolute length difference between genes in L2 and L5. Move start site back in the shorter gene if homology extends to an earlier start codon (as determined by TBLASTN searches using the longer gene as a query against the whole genome of the strain containing the shorter gene).
Orphan genes are genes in L2 and L5 that do not have a paired gene in the list resulting from this process.
Orphan genes were examined with care, and hypothetical orphans with length less than 300 bp and no homology to any bacterial gene in BLASTP searches against NR were removed from the list of annotated genes. Both sets of homologs were then used as queries in BLASTP searches against BAL199 proteins in our previous annotation [13]. The results were examined manually to detect BAL199 annotation errors, and lower similarity hits were checked by searching the query against the NR database in a BLASTP search (default parameters). Homologs to BAL199 were deemed real when BAL199 was ranked in the top 100 hits against NR. The resulting hits were then examined using a Perl script that checked whether L2–L5 homologs aligned to the same BAL199 protein (BAL199_check.pl, Text S5). The coordinates of homolog pairs in L2 and L5 were used to plot Figure 4B using the ggplot2 package in R. The lengths of the corresponding homolog pairs were also used to plot Figure 10 using the ggplot2 package in R.
Intergenic Synteny Analysis in Ca. E. faulkneri
Intergenic sequences in Ca. E. faulkneri strains L2 and L5 were extracted from GenBank files obtained directly from Manatee using a Perl script (genbank_multi_process.pl, Text S4). Intergenic sequences smaller than 100 bp were removed. The resulting sequences from L2 were used as queries in BLASTN and TBLASTX searches against a blast database of the intergenic sequences in L5 using default parameters, i.e. an e-value cutoff of 10. The top hit for each query in the BLASTN search was used to determine the coordinates of the points in Figure 4C, which was plotted using the ggplot2 package in R. Because TBLASTX searches typically yield many duplicate hits between the same query and subject corresponding to different reading frames, a Perl script was used (check_blastx_results.pl, Text S6) to group together these hits and calculate the average % identity weighted by length of alignment between intergenic sequence pairs. The midpoint coordinate for each intergenic sequence in its corresponding genome was used to plot figure 4D.
Identification of Pseudogenes in Ca. E. faulkneri Strains
Pseudogenes were detected in each Ca. E. faulkneri strain using TBLASTN with default settings by querying the orphan genes from one strain against a database of the intergenic sequences not assigned to genes in the corresponding strain. Hits that were classified as pseudogenes had the following characteristics:
Several hits for the same query localized to an area not larger than the query sequence in the subject genome.
The hits are in a locus within the subject genome consistent with the conservation of synteny observed in other analyses.
In order to detect pseudogenes that were potentially degraded in both strains, remaining intergenic regions larger than 100 bp were used as BLASTX queries against the entire NR database (default settings). Hits with e-values lower than 1×10−3 against one or more bacterial nonhypothetical genes were considered pseudogenes. Intergenic sequences that contained identified pseudogenes were removed from the intergenic set of sequences, then the GC percent of sequences in the sets of pseudogenes, intergenic sequences, coding sequences and RNA genes in both strains of Ca. E. faulkneri were tabulated. ANOVA analysis and the TukeyHSD test were carried out in R, as with the analysis of Ca. X. pacificiensis contigs (vide supra). It was found that the intergenic, coding sequences and RNA genes in the respective strains were not significantly different, so these groups were combined. The pseudogenes from each strain were also combined into a single group, since the small sample size of each strain individually would limit the detection of statistical differences. ANOVA and the TukeyHSD test were then repeated in R, to give the p values reported in Figure 8.
Analysis of Gene Inventories
The presence and absence of genes for figures 5 and 14 was assessed a number of ways. Protein sequences from Ca. E. faulkneri L2 and L5, BAL199 and Ca. X. pacificiensis were used as queries in a BLASTP search against the NR database (default parameters), with -max_target_seqs set to 200. The resulting blast tables were imported into Megan [73], and their functional annotations were viewed in the KEGG analyzer section of the program. The automatic annotations generated by Clovr [71] were also used, as were manual annotations made in Manatee.
Divergence Comparisons (Figure 6)
Protein coding genes of the bacterial genomes were extracted from GenBank files using a Perl script (genbank_multi_process.pl, Text S4). Homologous genes in the strain pairs were determined as with Ca. E. faulkneri L2/L5/BAL199, described above. The % identities for each homolog pair were tabulated and imported into R, where the distribution of identities was plotted as a density plot with the ggplot2 package. Plots were exported as SVG files and manually normalized so that the maximum value was the same perpendicular distance from the x-axis in Adobe Illustrator. The accession numbers of the genomes used were: Buchnera aphidicola APS: NC_002528, Buchnera aphidicola Sg: NC_004061, Sulcia muelleri GWSS: NC_010118, Sulcia muelleri SMDSEM: NC_013123, Brucella melitensis bv. 1 str. 16M: NC_003317, Brucella ovis ATCC 25840: NC_009504.
Construction of Genome Figures 3 and 7
Genome figures were constructed using Circos [75], using scripts described previously [13]. For Figure 7, the coordinates of stop codons in three frames were generated with a Perl script (Make_start_stop_heatmap_tracks.pl, Text S7, which uses an additional Perl module: Text S9), and the inner L2 genome representation was added later in Adobe Illustrator.
Comparison of Divergence Amongst Related Natural Product Biosynthetic Pathways
Biosynthetic gene sequences used for Figure 11 were retrieved from NCBI and the relevent groups were aligned with Clustal-Omega [76]. Protein alignments were constructed first, and then nucleotide alignments were constructed from these using a Perl script (nucleotide_translation_alignment.pl, Text S8). Identity values and shading were calculated as with the Figure 2. The accession numbers of the pathway records used were: ET-743 pathway: HQ609499, safracin pathway: AY061859, saframycin A pathway: DQ838002, saframycin Mx1 pathway: MXU24657, pederin pathway: AY328023, AY426537, onnamide pathway: AY688304, bryostatin “Deep”: DQ889941, DQ889942, bryostatin “Shallow”: EF032014.
16S rRNA Gene Amplicon Sequencing by 454 and Analysis
Amplification of 16S rRNA gene sequences and sequencing by 454 pyrosequencing was carried out as previously described [13]. Broad categorization was carried out using the Clovr-16S pipeline [71]. The Ca. E. faulkneri L2 and L5 16S rRNA gene sequences obtained from assembly and Sanger sequencing were used as queries in a BLASTN search (default parameters) against databases containing the raw 454 reads. Reads were classified as belonging to Ca. E. faulkneri or Ca. X. pacificiensis when they shared ≥98% identity with the relevant query sequence. Both Ca. E. faulkneri sequences were used as queries against L6 samples, but no reads above the identity threshold were found.
Analysis of Genome Size, Number of Genes and Presence of ftsZ and dnaA among Intracellular Bacteria (Figure 9)
Complete genomes for intracellular bacteria were downloaded from NCBI as GenBank files and processed with a Perl script (genbank_multi_process.pl, Text S4). The genome sizes and number of protein coding genes were taken directly from tabulated outputs of the script, and the presence or absence of annotated ftsZ and dnaA genes was confirmed manually. The accession numbers of the genomes used are included in the Supporting Information (Table S1).
Construction of the α-proteobacterial Phylogenetic Tree (Figure 13)
The 16S rRNA gene sequence for Ca. X. pacificiensis was uploaded to the Ribosomal Database Project webserver [77], and additional sequences were selected from the RDP database. Good quality sequences that were ≥1200 bp from type strains classified as δ-proteobacteria were selected to act as an outgroup. Good quality type strain sequences ≥1200 bp were also selected from the following α-proteobacterial orders: Rhodobacterales, Caulobacterales, Kordiimonadales, Kiloniellales, Parvularculales, Rhizobiales, Sphingomonadales, Rhodospirillales and Sneathiellales. Additionally both type and nontype strain sequences were selected from Rickettsiales. Collectively, these sequences were downloaded as an aligned fasta from RDP, and the alignment was manually inspected in ClustalX. Sequences that appeared to unilaterally cause large insertions in the alignment were discarded, and the alignment was then trimmed using a Perl script (trim_aligned_fasta.pl [13]). The phylogenetic tree was constructed using FastTreeMP [66], using the parameters -slow -spr 5 -mlacc 3 -gamma -gtr -nt. The tree was rooted and manipulated using the Interactive Tree of Life webserver [78].
Accession Numbers
The genome sequence data for Ca. E. faulkneri L5 and Ca. X. pacificiensis L6 have been submitted to the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov). The accession numbers are CP006745 for Ca. E. faulkneri L5 and AXCJ00000000 for Ca. X. pacificiensis.
Supporting Information
Acknowledgments
We thank the people and government of Papua New Guinea for permission to collect materials; C. M. Ireland (University of Utah) for aid with collection; R. van Wagoner and M. K. Harper (University of Utah) for use of LCMS instrumentation.
Funding Statement
This work was funded by National Institutes of Health GM092009 (www.NIH.gov). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. McCutcheon JP, Moran NA (2012) Extreme genome reduction in symbiotic bacteria. Nat Rev Microbiol 10: 13–26. [DOI] [PubMed] [Google Scholar]
- 2. Degnan PH, Yu Y, Sisneros N, Wing RA, Moran NA (2009) Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors. Proc Natl Acad Sci USA 106: 9063–9068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Scarborough CL, Ferrari J, Godfray HCJ (2005) Aphid protected from pathogen by endosymbiont. Science 310: 1781. [DOI] [PubMed] [Google Scholar]
- 4. Moran NA (1996) Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc Natl Acad Sci USA 93: 2873–2878. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Douglas AE (2011) Lessons from studying insect symbioses. Cell Host & Microbe 10: 359–367. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Delsuc F, Brinkmann H, Chourrout D, Philippe H (2006) Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature 439: 965–968. [DOI] [PubMed] [Google Scholar]
- 7.Monniot C, Monniot F, Laboute P (1991) Coral reef ascidians of New Caledonia. Paris: ORSTROM.
- 8. Schmidt EW, Nelson JT, Rasko DA, Sudek S, Eisen JA, et al. (2005) Patellamide A and C biosynthesis by a microcin-like pathway in Prochloron didemni, the cyanobacterial symbiont of Lisso-clinum patella . Proc Natl Acad Sci USA 102: 7315–7320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Donia MS, Fricke WF, Partensky F, Cox J, Elshahawi SI, et al. (2011) Complex microbiome underlying secondary and primary metabolism in the tunicate-Prochloron symbiosis. Proc Natl Acad Sci USA 108: E1423–E1432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Behrendt L, Larkum AWD, Trampe E, Norman A, Sørensen SJ, et al. (2012) Microbial diversity of biofilm communities in microniches associated with the didemnid ascidian Lissoclinum patella. ISME J 6: 1222–1237. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Corley DG, Moore RE, Paul VJ (1988) Patellazole B: A novel cytotoxic thiazole-containing macrolide from the marine tunicate Lissoclinum patella . J Am Chem Soc 110: 7920–7922. [Google Scholar]
- 12. Zabriskie TM, Mayne CL, Ireland CM (1988) Patellazole C: A novel cytotoxic macrolide from Lissoclinum patella . J Am Chem Soc 110: 7919–7920. [Google Scholar]
- 13. Kwan JC, Donia MS, Han AW, Hirose E, Haygood MG, et al. (2012) Genome streamlining and chemical defense in a coral reef symbiosis. Proc Natl Acad Sci USA 109: 20655–20660. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Moran NA, McCutcheon JP, Nakabachi A (2008) Genomics and evolution of heritable bacterial symbionts. Ann Rev Genet 42: 165–190. [DOI] [PubMed] [Google Scholar]
- 15. Hebert PDN, Ratnasingham S, deWaard JR (2003) Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc Royal Soc B 270: S96–S99. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Bock DG, MacIsaac HJ, Cristescu ME (2012) Multilocus genetic analyses differentiate between widespread and spatially restricted cryptic species in a model ascidian. Proc Royal Soc B 279: 2377–2385. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Tarjuelo I, Posada D, Crandall KA, Pascual M, Turon X (2004) Phylogeography and speciation of colour morphs in the colonial ascidian Pseudodistoma crucigaster . Mol Ecol 13: 3125–3136. [DOI] [PubMed] [Google Scholar]
- 18. Tarjuelo I, Posada D, Crandall KA, Pascual M, Turon X (2001) Cryptic species of Clavelina (Ascidiacea) in two different habitats: Harbours and rocky littoral zones in the northwestern Mediterranean. Mar Biol 139: 455–462. [Google Scholar]
- 19. Pérez-Portela R, Turon X (2008) Cryptic divergence and strong population structure in the colonial invertebrate Pycnoclavella communis (Ascidiacea) inferred from molecular data. Zoology 111: 163–178. [DOI] [PubMed] [Google Scholar]
- 20. Caputi L, Andreakis N, Mastrototaro F, Cirino P, Vassillo M, et al. (2007) Cryptic speciation in a model invertebrate chordate. Proc Natl Acad Sci USA 104: 9364–9369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Rubinstein ND, Feldstein T, Shenkar N, Botero-Castro F, Griggio F, et al. (2013) Deep sequencing of mixed total DNA without barcodes allows efficient assembly of highly plastic ascidian mitochondrial genomes. Genome Biol Evol 5: 1185–1199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Olson RR, McPherson R (1987) Potential vs. realized larval dispersal: Fish predation on larvae of the ascidian Lissoclinum patella (Gottschaldt). J Exp Mar Biol Ecol 110: 245–256. [Google Scholar]
- 23. Stackebrandt E, Goebel BM (1994) Taxonomic note: A place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 44: 846–849. [Google Scholar]
- 24. Zhang GI, Hwang CY, Cho BC (2008) Thalassobaculum litoreum gen. nov., sp. nov., a member of the family Rhodospirillaceae isolated from coastal seawater. Int J Syst Evol Microbiol 58: 479–485. [DOI] [PubMed] [Google Scholar]
- 25. Tamas I, Klasson L, Canback B, Naslund AK, Eriksson AS, et al. (2002) 50 million years of genomic stasis in endosymbiotic bacteria. Science 296: 2376–2379. [DOI] [PubMed] [Google Scholar]
- 26. McCutcheon JP, McDonald BR, Moran NA (2009) Convergent evolution of metabolic roles in bacterial co-symbionts of insects. Proc Natl Acad Sci USA 106: 15394–15399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Foster JT, Beckstrom-Sternberg SM, Pearson T, Beckstrom-Sternberg JS, Chain PSG, et al. (2009) Whole-genome-based phylogeny and divergence of the genus Brucella . J Bacteriol 191: 2864–2870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kuo CH, Moran NA, Ochman H (2009) The consequences of genetic drift for bacterial genome complexity. Genome Res 19: 1450–1454. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Toh H, Weiss BL, Perkin SAH, Yamashita A, Oshima K, et al. (2006) Massive genome erosion and functional adaptations provide insights into the symbiotic lifestyle of Sodalis glossinidius in the tsetse host. Genome Res 16: 149–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Burke GR, Moran NA (2011) Massive genomic decay in Serratia symbiotica, a recently evolved symbiont of aphids. Genome Biol Evol 3: 195–208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Clayton AL, Oakeson KF, Gutin M, Pontes A, Dunn DM, et al. (2012) A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect-bacterial symbioses. PLoS Genet 8: e1002990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Reyes-Lamothe R, Nicolas E, Sherratt DJ (2012) Chromosome replication and segregation in bacteria. Ann Rev Genet 46: 121–143. [DOI] [PubMed] [Google Scholar]
- 33. Adams DW, Errington J (2009) Bacterial cell division: Assembly, maintenance and disassembly of the Z ring. Nat Rev Microbiol 7: 642–653. [DOI] [PubMed] [Google Scholar]
- 34. Ran L, Larsson J, Vigil-Stenman T, Nylander JAA, Ininbergs K, et al. (2010) Genome erosion in a nitrogen-fixing vertically transmitted endosymbiotic multicellular cyanobacterium. PLoS One 5: e11486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Schofield MJ, Hsieh P (2003) DNA mismatch repair: Molecular mechanisms and biological function. Ann Rev Microbiol 57: 579–608. [DOI] [PubMed] [Google Scholar]
- 36. Lerat E, Ochman H (2005) Recognizing the pseudogenes in bacterial genomes. Nucl Acids Res 33: 3125–3132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. McBride JW, Walker DH (2011) Molecular and cellular pathobiology of Ehrlichia infection: Targets for new therapeutics and immunomodulation strategies. Exp Rev Mol Med 13: e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Wang X, Quinn PJ (2010) Lipopolysaccharide: Biosynthetic pathway and structure modification. Prog Lipid Res 49: 97–107. [DOI] [PubMed] [Google Scholar]
- 39. McCutcheon JP, von Dohlen CD (2011) An interdependent metabolic patchwork in the nested symbiosis of mealybugs. Curr Biol 21: 1366–1372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Kwan JC, Luesch H (2010) Weapons in disguise - activating mechanisms and protecting group chemistry in nature. Chem Eur J 16: 13020–13029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Rath CM, Janto B, Earl J, Ahmed A, Hu FZ, et al. (2011) Meta-omic characterization of the marine invertebrate microbial consortium that produces the chemotherapeutic natural product ET-743. ACS Chem Biol 6: 1244–1256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Piel J (2002) A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. Proc Natl Acad Sci USA 99: 14002–14007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Piel J, Wen G, Platzer M, Hui D (2004) Unprecedented diversity of catalytic domains in the first four modules of the putative pederin polyketide synthase. ChemBioChem 5: 93–98. [DOI] [PubMed] [Google Scholar]
- 44. Piel J, Hui D, Wen G, Butzke D, Platzer M, et al. (2004) Antitumor polyketide biosynthesis by an uncultivated bacterial symbiont of the marine sponge Theonella swinhoei . Proc Natl Acad Sci USA 101: 16222–16227. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Piel J (2010) Biosynthesis of polyketides by trans-AT polyketide synthases. Nat Prod Rep 27: 996–1047. [DOI] [PubMed] [Google Scholar]
- 46. Trindade-Silva AE, Lim-Fong GE, Sharp KH, Haygood MG (2010) Bryostatins: Biological context and biotechnological prospects. Curr Opin Biotechnol 21: 834–842. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Piel J, Höfer I, Hui D (2004) Evidence for a symbiosis island involved in horizontal acquisition of pederin biosynthetic capabilities by the bacterial symbiont of Paederus fuscipes beetles. J Bacteriol 186: 1280–1286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Nakabachi A, Ueoka R, Oshima K, Teta R, Mangoni A, et al. (2013) Defensive bacteriome symbiont with a drastically reduced genome. Curr Biol 23: 1478–1484. [DOI] [PubMed] [Google Scholar]
- 49. Sharp PM, Li WH (1987) The codon adaptation index - a measure of directional synonymous codon usage bias, and its potential applications. Nucl Acids Res 15: 1281–1295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Collins NE, Liebenberg J, de Villiers EP, Brayton KA, Louw E, et al. (2005) The genome of the heartwater agent Ehrlichia ruminantium contains multiple tandem repeats of actively variable copy number. Proc Natl Acad Sci USA 102: 838–843. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Friedman CS, Andree KB, Beauchamp KA, Moore JD, Robbins TT, et al. (2000) ‘Candidatus Xenohaliotis californiensis’, a newly described pathogen of abalone, Haliotis spp., along the west coast of North America. Int J Syst Evol Microbiol 50: 847–855. [DOI] [PubMed] [Google Scholar]
- 52.Draskovic I, Dubnau D (2005) Competence for genetic transformation. In: Mullany P, editor, The Dynamic Bacterial Genome, Cambridge: Cambridge University Press. 235–273.
- 53. Bignell C, Thomas CM (2001) The bacterial ParA-ParB partitioning proteins. J Biotechnol 91: 1–34. [DOI] [PubMed] [Google Scholar]
- 54. Rahman MA, Cheng Z, Matsuo J, Rikihisa Y (2012) Penicillin-binding protein of Ehrlichia chaffeensis: Cytokine induction through MyD88-dependent pathway. J Infect Dis 206: 110–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Lin M, Zhang C, Gibson K, Rikihisa Y (2009) Analysis of complete genome sequence of Neorickettsia risticii : Causative agent of Potomac horse fever. Nucl Acids Res 37: 6076–6091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Hotopp JCD, Lin M, Madupu R, Crabtree J, Angiuoli SV, et al. (2006) Comparative genomics of emerging human ehrlichiosis agents. PLoS Genet 2: e21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Pruckler JM, Benson RF, Moyenuddin M, Martin WT, Fields BS (1995) Association of flagellum expression and intracellular growth of Legionella pneumophila . Inf Immun 63: 4928–4932. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Pundhir S, Kumar A (2011) SSPred: A prediction server based on SVM for the identification and classification of proteins involved in bacterial secretion systems. Bioinformation 6: 380–382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Saridaki A, Bourtzis K (2010) Wolbachia: More than just a bug in insects genitals. Curr Opin Microbiol 13: 67–72. [DOI] [PubMed] [Google Scholar]
- 60. Weeks AR, Turelli M, Harcombe WR, Reynolds KT, Hoffmann AA (2007) From parasite to mutualist: Rapid evolution of Wolbachia in natural populations of Drosophila . PLoS Biol 5: e114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Piel J (2004) Metabolites from symbiotic bacteria. Nat Prod Rep 21: 519–538. [DOI] [PubMed] [Google Scholar]
- 62. Piel J (2009) Metabolites from symbiotic bacteria. Nat Prod Rep 26: 338–362. [DOI] [PubMed] [Google Scholar]
- 63. Schmidt EW, Donia MS (2009) Chapter 23. Cyanobactin ribosomally synthesized peptides - a case of deep metagenome mining. Meth Enzymol 458: 575–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Li KB (2003) ClustalW-MPI: ClustalW analysis using distributed and parallel computing. Bioinf 19: 1585–1586. [DOI] [PubMed] [Google Scholar]
- 65. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinf 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
- 66. Price MN, Dehal PS, Arkin AP (2010) FastTree 2– approximately maximum-likelihood trees for large alignments. PLoS One 5: e9490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Zerbino DR, Birney E (2008) Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18: 821–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Langmead B, Salzberg SL (2012) Fast gapped-read alignment with Bowtie 2. Nat Methods 9: 357–359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinf 25: 2078–2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Namiki T, Hachiya T, Tanaka H, Sakakibara Y (2012) MetaVelvet: An extension of Velvet assembler to de novo metagenome assembly from short sequence reads. Nucl Acids Res 40: e155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Angiuoli SV, Matalka M, Gussman A, Galens K, Vangala M, et al. (2011) CloVR: A virtual machine for automated and portable sequence analysis from the desktop using cloud computing. BMC Bioinf 12: 356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Orvis J, Crabtree J, Galens K, Gussman A, Inman JM, et al. (2010) Ergatis: A web interface and scalable software system for bioinformatics workows. Bioinf 26: 1488–1492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Res 21: 1552–1560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74. Mungall CJ, Emmert DB, The FlyBase Consortium (2007) A Chado case study: An ontology-based modular schema for representing genome-associated biological information. Bioinf 23: i337–i346. [DOI] [PubMed] [Google Scholar]
- 75. Krzywinski M, Schein J, Birol I, Connors J, Gascoyne R, et al. (2009) Circos: An information aesthetic for comparative genomics. Genome Res 19: 1639–1645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, et al. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7: 539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77. Cole JR, Wang Q, Cardenas E, Fish J, Chai B, et al. (2009) The Ribosomal Database Project: Improved alignments and new tools for rRNA analysis. Nucl Acids Res 37: D141–D145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78. Letunic I, Bork P (2011) Interactive Tree Of Life v2: Online annotation and display of phylogenetic trees made easy. Nucl Acids Res 39: W475–W478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79. Jensen K, Niederkrüger H, Zimmermann K, Vagstad AL, Moldenhauer J, et al. (2012) Polyketide proofreading by an acyltransferase-like enzyme. Chem Biol 19: 329–339. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173: 697–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81. Reysenbach AL, Giver LJ, Wickham GS, Pace NR (1992) Differential amplification of rRNA genes by polymerase chain reaction. Appl Env Microbiol 58: 3417–3418. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.